Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 25 Jun 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012078407 Xt7.1-CABC5357.3 - 20 ESTs
                                                                       ......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABC5357.3                           GGCATTGTCACCGCACACAGCTGCATTAGAAGCTGCGGGTGTTGGAGCTGTAGGTTTACGGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAATACATACTGCTGAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008230638                                 GTCACCGCACACAGCTGCATTAGAAGCTGCGGGTGTTGGAGCTGTAGGTTTACGGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAATACATAxxxxxxAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                2     2     3     3     4     4     4     5     4     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    11    12    10    11     9    12    10    12    11    13    11    13    12    14    11    15    11    15    10    16    10    16     9    15    10    16    10    16    10    16    10    16    10    16    10    16    12    16    12    16    12    16    12    15    11    14    11    14    10    13    10    13    11    14    11    14    11    14    11    14    11    14    11    14    12    14    12    14    12    13    12    13    12    13    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    10    10    10    10     9    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     7     8     6     7     3     5     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---------G--
                                               BLH ATG      94    1875                           
                                               BLH MIN      94     202                           
                                               BLH MPR      94     202                           
                                               BLH OVR      94    1039                           
                                               CDS MIN      94     202                           
                                               ORF LNG      94      94                           
                                                                                                                                                                                                     PROTEIN --- Ce ==== 1e-084     NP_499752.2 F53A2.7 [Caenorhabditis elegans] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PROTEIN === Sc ==== 3e-087     NP_015297.1 induced under stress conditions; Erg10p [Saccharomyces cerevisiae] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN --- Gg ==== 2e-091     NP_001034376.1 acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase) [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                           PROTEIN -== Dm ==== 3e-131     NP_612094.2 CG9149-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                        PREDICTED - Sp ==== 4e-139     XP_001198891.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN === Hs ==== 4e-169     NP_005882.1 acetyl-Coenzyme A acetyltransferase 2; acetoacetyl Coenzyme A thiolase [Homosapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN === Mm ==== 7e-172     NP_033364.1 acetyl-Coenzyme A acetyltransferase 2; t-complex protein 1, related sequence 1[Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                     PROTEIN -== Dr ==== 1e-177     NP_571445.2 acetyl-CoA acetyltransferase 2 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN === Xl ==== 0          AAH72129.1 MGC69098 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PROTEIN === ?? ==== 0          NP_001079879.1 acetyl-CoA acetyltransferase 2 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                               PREDICTED = Xt ==== 0          AAH61429.1 Unknown (protein for MGC:76038) [Silurana tropicalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABC5357.3                                                                                              TGA------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------ATG------ATG------------------------ATG---------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------ATG------------------TGA---------------------TAAATG------------------------------------------------------------------------------------------------------------------------TGA------TGA---TAA---------TAA------------------------------TGA
                                                                   ORF                                                                                                                         [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   1           Gas1 FL                     IMAGE:5385015.FL-MGC                                      CGCACACAGCTGCATTAGAAGCTGCGGGTGTTGGAGCTGTAGGTTTACGGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCAGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTGAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCGCTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAAAAAAAAAAATAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu0 5g                            IMAGE:6993665 CTGGGCTCGGAACTTGACAGCAGAGGGGCATTGTCACCGCACACAGCTGCATTAGAAGCTGCGGGTGTTGGAGCTGTAGGTTTACGGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTTCTTCCAGAAAAAGGCCCCGTGGGAAGTAAAAGTTGATGAATTTCCCCCCCACATGGGAGGCAACGGTAGAAAGCAATGTTCCAAATTAAAAGCCCATAATTTTTCCTGGAAGGATGGGAAATTGGGGAACCAGGTTACCTTCCCAGGCCTAAATGGCCCTCCAGGGGAATTCCAATTGGAA
  5   1   2   10  bld Eye  5g3  in                         CCAX7819.b1 ..........................GGCATTGTCACCGCACACAGCTGCATTAGAAGCTGCGGGTGTTGGAGCTGTAGGTTTACGGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAG
  5   1   2       bld Gas1 FL   in                    IMAGE:5385015.y1                                  GGATCGCACACAGCTGCATTAGAAGCTGCGGGTGTTGGAGCTGTAGGTTTACGGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAA
  5   1   2       bld In54 5g                         IMAGE:8944968.5p                                                TGCATTAGAAGCTGCGGGTGTTGGAGCTGTAGGTTTACAGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAATATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAGGCCCCGTGGAAGTAAAGTTGATGATTCCCCGACATGGAGCACGTAGAAGCATGTCCAATTAAGCCATTTTTCTGAGGATGGAGTGGACAGTTACTCAGCTATGCTCGGGGATCATGATGGAGCAGCAGCTGTATTCTATAAGAGTCGAGCAGGACGCAGGTCTGGTCCATGCCCATAGTCCTCACCAGTAGGCTGGATCTCCTCTGGAATGGACTTGCCAATAAAGCTTGAAGGAGCGGGACTGTGAGGGGTATATGATCCAGCTTGACTCAGTGGCTGGTAACGTGGCTAACAGATCGTAGG
  5   1   2       bld In63 5g                         IMAGE:8961211.5p                                                               CGTCGTTAGGAGCTGTAGGTTACGGTTTTGGTGAGTGGCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAGGCCCGTGAAGTAAAAGTTGATGAATTCCTCCGACATGAAGCACGTAGAAGCAATGTCCAAATTAAGCATATTTTCTGAGATGGAGTGGACAGTTACTCAGCTATGCCTCGGGGATCATGATGAGCAGCAGCTGTATTCTAATAAGGAGTCGAGCAGACGCAGGTCTGTCCATGCACACATAGTCTCTCAGCGCAGTAGCTGATCCCTCATCTGGGATGGACTATGCACAATAAAAGATGGAAAGCAGCTGACTTGTAAGGTATATGATCCAAGCCTTGAATAGCTGGCTGGATAGACTGGCTTACAAAGTACTCTTCAAGTTC
  5   1   2   10  bld Fat1 5g3  in                         CABC5357.5p ...................................................................................................GCACCGCCTGGAGACGCCAGTATGAGCTCAAGAGAGGAAAGAGTGGCCATTGTATCTGCAGCCCGCACCCCTATAGGTTCCTTTAACGGTGCCCTATCGACCTTACCTGCCCATACCTTGGGCTCTACTGTTATCAAGGAGGTTCTGAAAAGAGCTGCAATTCAACCACAAGAAGTCTCCGAAGTGATATTTGGCCAAGTTCTGACTGCAGGTGCAGGACAGAACCCAGCTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAAGCAGACGCAGGGGTCTGGTCCCAATGGCACACATAG
  5   1   2       bld Egg                            TEgg127p02.p1kSP6                                                                                                                                                                                                                                                                                                                                         CTCGACAAGCCAGCGTAGCTGCAGGGGTCCCTTACAGTATTCCAGCATGGAGCTGCCAAATGATATGTGGGTCTGGTCTAAAGGCAGTGAGCTTGGGGGCTCAGTCTATAAAGACCGGGGAGGCTGATATTGTTGTGGCGGGAGGTATGGAGAGCATGAGTCAGGCTCCACATTTAGTGCACATGAGAGCTGGGGTTAAAGCTGGTGATGTCTCCTTGCAGGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGC
  5   1   2       bld Tbd1      out                        CBXT6019.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACAGCATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGTAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCAGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTGAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCA
  5   1   2       bld Ova1      in                          CABE393.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATAATGTGTGATGGACTAAATGATGCTTTTTACAAGTATCACATGGGAATTACTGCTGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAAGTGAAATCCAAGTTTGAAGAACA
  5   1   2       bld Gas       in                   TGas115g05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGAAAATGTGGCCAAACAATGGAAAGTTACCAGAGAGGAACAGGATCTGCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTT
  3   1   2      seed Fat1 5g3  in                         CABC5357.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAATACATACTGCTGGCCTCTCGCCCTA
  3   1   2       bld Ova1      in                          CABE393.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTTGCAGTACAGTCACAAAACAGAACTGAGGCAGCACAAAAAGCTGGTTATTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAATAC
  5   1   2       bld HdA                            THdA011p21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCGGGGAATCCCCGGGCAAAAAGCTGGTTATTTTGATAAAGAGATTGTTCCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCA
  5   1   2       bld Ski1      in                         CABJ6329.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATCGATTCAATCGGCACGAGGAATAAAACCTGTCTTTGTCCTGCACTGGTGCTCTGCCTTTCCAGTCTCATAGAGAAAAGGAGGACACAGCTCTCAGCATAATAATCTAGCACACATGCATTTCAAACACTCTAAAGATTTCAGTTCCCTGTAACCATCTTTTCCAGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAA
  3   1   2       bld Gas       in                    TGas115g05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCTGTTACAGTTCCTTCCAGAAAAGGCCCCGTGGAAGTAAAAGTTGATGAATTCCCCCGACATGGAAGCAACGTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAANGCCANTTTGTGTTTATTTAATACATAAAAAAAAAAAAAAAAAAA
  3   1   2       chi Int1      out                       CAAP11295.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         agttttaaccttgaaagtgagttgcaggtaaaactcagtccctgtataaaatgtataatgaagcagtagaatttttaatgaatcagattagagagtgtaggactggccagaccagggatgactgacgttgttggccagcttgaagtatattgcaatatatggacaaacaatccctgttttgcttgaaggggagggcatttcttggtagcttaatgcacagaatgtctttatgtcctatataAATTGAGTGCAAAGGATTTCCTATCTGTCAGTACTTTAAGAGAGCATTCTGCAAGTTCAGAGGTTATTTGATGCACAATATATAGTTTGAGACAAATTGGTGGACTTGATAAGCTTAATGGTTCTTCCAATTCAATTTCCTCATTTGTTTTTACACAGGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAATACATACTGCTGTTAATAG
  3   1   2       bld Ski1      in                         CABJ6329.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCAGTCTCATAGAGAAAAGGAGGACACAGCTCTCAGCATAATAATCTAGCACACATGCATTTCAAACACTCTAAAGATTTCAGTTCCCTGTAACCATCTTTTCCAGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAATACATACTGCTGTT
  3   1   2       bld Eye  5g3  in                         CCAX7819.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTAGAAGCAATGTCCAAATTAAAGCCATATTTTCTGAAGGATGGAAGTGGAACAGTTACTCCAGCTAATGCCTCGGGGATCAATGATGGAGCAGCAGCTGTAATTCTAATAAAGGAGTCAGAAGCAAGACGCAGGGGTCTGGTCCCAATGGCACACATAGTCTCCTCAGCGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTTAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCACTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTA
  3   1   2       bld Gas1 FL   in                    IMAGE:5385015.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGAGCAAGTAGGCTTGGATCCCTCCATCATGGGAGTTGGACCTATTGCAGCAATTAGAAAAGCAGTTGAGAAGGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTGAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCGCTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAAAAAGAAAAAATAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld Tad5      out                        XZT71669.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCAGGCTGGAGCCTTGATGAGGTTGACTTATTTGAAATCAACGAGGCCTTTGCAGCTCAGGCTGTGGCTGTGGTGAAAGACTTGGGCCTTAACCCAGAAAAAGTCAACTGTCAAGGTGGCGCTGTGGCCCTTGGTCACCCTCTTGGAATGTCTGGCTGCCGTATTTTGGTTACTCTACTTTATGCCTTAGAAAGAACTGGTGGGAAGAAAGGAGTAGCTGCCTTATGCATAGGAGGAGGAATGGGCATAGCCATGTGCATTGAACGAACCAGTTGAAGGGTATATATTAGCCATAACTAAATGAGTGCAAGTCTTTTCTTGTGCATCTGCATTTTTTGTACATGGACACAAAGCACTACAAGTGAAATCCAAGTTGAAGAACATTCCAGGAAGAGGTCCAGCCAAGATGCCACTTTTATTAGATGATCGCTGTGACCTTAAATCTTGCAATAAAAGCATTTGTGTTTATTTAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAANGGNGGGCGCCAGGGCCGAAATTTTTAAAACGGGGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)