Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 19 Jun 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ12328.5                           7 END     5          16       71                Dapk1-prov protein [Xenopus laevis]
     2   2.0    0Xt7.1-CAAK1623.5                            2 END     2           6      100                MGC83745 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     3 118.0    0(repeat)                                    0 REP     88       2315     2511                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012078432 Xt7.1-CAAK8207.3 - 31 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK8207.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTTGGTCACCGACAGTGATGTTGATGAACTTGTGCAGATCCTGGATGCAATGGACATTTGTGCCCGAGATCTAAGCAGCGGAGCTATGGTGGACATCCCTGCCCTCATTAAAACAGACAACCTCCACCGATCATGGGCTGATGAAGAAGAGGACATAATGATTTATGGAGGTGTTAGAATTGTTCCTGTGGAACACCTTACTCCCTTTCCGTGTGGAATTTTTCACAAAGTTCAAGTTAATTTATGCCGATGGGTACATCAACAGAGCGCCGACGGTGATGCTGATATACGTTTATGGGTAAACGGTTGTAAAATAGCAAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCATGGTCAAGGAATTGAAGTGCAAGTTAGGGGTCTGGAAACTGAGAAAATCAAGTGTTGTCTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAACAACGTTGCCTGGTCTTTTAACTGTAAAACATTACTTGAGCCCTCAACAGCTAAGAGAGCATCACGAGCCACTGATGGTTTACCAACCTAGAGACTTTTTTCGGGCCCAAATACAAAAGGAGACTTCACTGGCTAACACCATGGCTGGATACAAAGAGAGCTTTAGCAGCATTCTTTGTTTTGGGTGCCTGGATGTTTACTCTCAAGGAAACCTAGGCCTGGATCACCATGTGTCCGATATCAATATTCTTGTTAGAAGAAAGCTCAGCCGACTTTTAGACCCACCAGATCCCATGGGAAAGGACTGGTGTCTACTAGCTATGAATTTGGGCCTACCTGACTTAGTTGCCAAATACAATACTAACAATTCTGTACAAAAAGACTTTTTGCCTAGTCCAATGTGTGCTCTTCTGCAGGAATGGAGCAATTCTCCTGAAAGTACTGTATCGCTCCTAATGTCTAAACTGAGAGAACTTGGGCGCAGGGATGCAGCAGATTTTTTACTAAAAGCATCCTCTGTTTTTAAGGTGACTCTTGATATCCATGGACAAGAAGCCTATGCGGCAAGCTGCAACAGCGGCACATCCTATAATTCAATTAGCTCAGTCGTGTCACGATGAGTAAATTAGTCCGCATGATCTTCTATAGCTATCTAAACAACCAGTATGAGAAGTGTAGTTTATATGTGTTTCATAGGGGTTTCTAACCATTAATTTATAAACAATGTCAAAGAATGCCACATGCCATCAGAACCTGGTAGCTTTCTACTTTTTAATAAGGGTGACTGCCTTTTATCATATATTTTAAAGGCTCCCATGAATTTTTCACTCCAGAGTTCTATAATAATGTGCTGCTAGTTACTGCCACCTGAACAGATAATATATACTGTTCATTTTTTCTAATTAATTCTTTTATACATTTTACTAACCAGACTGGACAGTTGTTCACGTGTAGAAGAGAGGGCTCTCATTTTATGTCTGCTGATTTGGTAACTGATTCAGCTACAGATGATAGCAAATTTTGCTGTACATTAGAGTTGCCCAACCTGCAGACCTCAAGCTCTTGGATAATGCCATTTTACTTTATCAGTAGCTGGCAGAGCCCAGGTTGGACAGCCCCCTCTGTTTATATTCATAAAGCCAATACAGCAGCATGAGTGCCTTGCTCTCACAGGTTAGGTTACAATAGGCCAGAACCTGCTCTCAAGCACTTTCCACTGGGCTCTACCTCTCTATCGTTGTCTCCACGATAATCCTTGTGTCAAAAGAACATTTAAGATTTAACACATTAAACTTCCTTCATCATGAATACATACAATTACCTTCCTATTTTGCGAAGATTACTGCAAGAACTATACAAGGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCATTCATTCCAGACATCTCAGGTATGAGTTCTAACTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCATGAAGCAAGTTAGTCGCCTGCGATAGATCTCTGCATCACAGGTAATTAACCCGTCCAAAATGCCTTTCCACCGGCACCTATTGTTGTCGGTGAAAAGGAAGCCTACTCATCATGGTAGTAGAGATCATTGCGGGTGACTGGCTCGCTCTGTAGGCCATCAGCTTAAGGGTGAAGACACACGGAGCTACTAGTAGCAGCTACTTGTCACAGCTACTAAAATAGACAATGCTGATCATTTACTGATAATTGTCTCTATGTGTGTTTTAGCAGAGGCAATTCTCTGTTGTCTATGGCGGGGTATTTTCTGGCGTTTAGTAACCATGACAAGTAGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGT
                                                  Xt7.1-CHK-1008228067                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCACCGACAGTGATGTTGATGAACTTGTGCAGATCCTGGATGCAATGGACATTTGTGCCCGAGATCTAAGCAGCGGAGCTATGGTGGACATCCCTGCCCTCATTAAAACAGACAACCTCCACCGATCATGGGCTGATGAAGAAGAGGACATAATGATTTATGGAGGTGTTAGAATTGTTCCTGTGGAACACCTTACTCCCTTTCCGTGTGGAATTTTTCACAAAGTTCAAGTTAATTTATGCCGATGGGTACATCAACAGAGCGCCGACGGTGATGCTGATATACGTTTATGGGTAAACGGTTGTAAAATAGCAAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCATGGTCAAGGAATTGAAGTGCAAGTTAGGGGTCTGGAAACTGAGAAAATCAAGTGTTGTCTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAACAACGTTGCCTGGTCTTTTAACTGTAAAACATTACTTGAGCCCTCAACAGCTAAGAGAGCATCACGAGCCACTGATGGTTTACCAACCTAGAGACTTTTTTCGGGCCCAAATACAAAAGGAGACTTCACTGGCTAACACCATGGCTGGATACAAAGAGAGCTTTAGCAGCATTCTTTGTTTTGGGTGCCTGGATGTTTACTCTCAAGGAAACCTAGGCCTGGATCACCATGTGTCCGATATCAATATTCTTGTTAGAAGAAAGCTCAGCCGACTTTTAGACCCACCAGATCCCATGGGAAAGGACTGGTGTCTACTAGCTATGAATTTGGGCCTACCTGACTTAGTTGCCAAATACAATACTAACAATTCTGTACAAAAAGACTTTTTGCCTAGTCCAATGTGTGCTCTTCTGCAGGAATGGAGCAATTCTCCTGAAAGTACTGTATCGCTCCTAATGTCTAAACTGAGAGAACTTGGGCGCAGGGATGCAGCAGATTTTTTACTAAAAGCATCCTCTGTTTTTAAGGTGACTCTTGATATCCATGGACAAGAAGCCTATGCGGCAAGCTGCAACAGCGGCACATCCTATAATTCAATTAGCTCAGTCGTGTCACGATGAGTAAATTAGTCCGCATGATCTTCTATAGCTATCTAAACAACCAGTATGAGAAGTGTAGTTTATATGTGTTTCATAGGGGTTTCTAACCATTAATTTATAAACAATGTCAAAGAATGCCACATGCCATCAGAACCTGGTAGCTTTCTACTTTTTAATAAGGGTGACTGCCTTTTATCATATATTTTAAAGGCTCCCATGAATTTTTCACTCCAGAGTTCTATAATAATGTGCTGCTAGTTACTGCCACCTGAACAGATAATATATACTGTTCATTTTTTCTAATTAATTCTTTTATACATTTTACTAACCAGACTGGACAGTTGTTCACGTGTAGAAGAGAGGGCTCTCATTTTATGTCTGCTGATTTGGTAACTGATTCAGCTACAGATGATAGCAAATTTTGCTGTACATTAGAGTTGCCCAACCTGCAGACCTCAAGCTCTTGGATAATGCCATTTTACTTTATCAGTAGCTGGCAGAGCCCAGGTTGGACAGCCCCCTCTGTTTATATTCATAAAGCCAATACAGCAGCATGAGTGCCTTGCTCTCACAGGTTAGGTTACAATAGGCCAGAACCTGCTCTCAAGCACTTTCCACTGGGCTCTACCTCTCTATCGTTGTCTCCACGATAATCCTTGTGTCAAAAGAACATTTAAGATTTAACACATTAAACTTCCTTCATCATGAATACATACAATTACCTTCCTATTTTGCGAAGATTACTGCAAGAACTATACAAGGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCATTCATTCCAGACATCTCAGGTATGAGTTCTAACTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCATGAAGCAAGTTGGTCGCCTGCGATAGATCTCTGCATCACAGGTAATTAACCCGTCCAAAATGCCTTTCCACCGxCxCCTATTGxxGTCGxxxxxAAGGAAGxxxAxxxxxxxTGGTAGTAGAGATCATTGCGGGTGACTGGCTCGCTCTGTAGGCCATCAGCTTAAGGGTGAAGACACACGGAGCTACTGGTAGCAGCTACTTGTCACAGCTACTAAAATAGACAATGCTGATCATTTACTGATAATTGTCTCTATGTGTGTTTTAGCAGAGGCAATTCTCTGTTGTCTATGGCGGGGTATTTTCTGGCGTTTAGTAACCATGACAAGTAGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGCATC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     4     4     3     3     3     3     3     3     3     3     4     4     5     5     5     5     5     5     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     5     5     5     5     5     5     2     4     2     5     2     5     2     5     4     7     4     7     4     8     4     7     5     8     5     8     3     8     6     9     5    10     5    10     5    10     5    10     5    10     6    10     7    11     8    13     8    13     8    15    10    15    13    16    14    17    15    17    14    17    14    16    12    16    14    16    14    16    14    15    14    15    13    15    14    14    14    16    14    16    14    16    14    16    13    16    14    16    12    16    14    16    14    16    14    16    16    16    16    16    16    16    16    16    16    16    15    16    15    16    15    16    16    16    16    16    16    17    17    17    17    17    17    17    17    17    16    17    17    17    17    17    16    17    15    17    17    17    17    17    17    17    15    17    15    17    16    17    14    16    15    16    13    14    13    14    11    14
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -T----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --G---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----T------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                       ...PROTEIN --- Ce ---- 7e-037     NP_490840.2 DAP (Death-Associated Protein) Kinase homolog family member (dapk-1) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-055     XP_780774.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-129     XP_686606.1 PREDICTED: similar to Death-associated protein kinase 1 (DAP kinase 1) [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 6e-180     NP_598823.1 death associated protein kinase 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_004929.2 death-associated protein kinase 1 [Homo sapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED - Gg ---- 0          XP_425037.2 PREDICTED: hypothetical protein, partial [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH77360.1 Dapk1-prov protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 0          NP_001086727.1 death-associated protein kinase 1 [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK8207.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATG---------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------TAG------TGA---------------TAA---------ATG---------------ATG------------------------TAA---------------------------ATG------------------------------------------------------------------------ATG---------------------------ATG------TAG------------------------------------------TAA---------------------------------------------------------------------------------------TAA---------------ATG---------------------TAG---------------------------------TAA---------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------TAA---------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------TAA---------------------------------------TAA---------------------------------------------------------------------------------------------------ATG---------------------------TAG------------------------------ATG---------------TAG---------------------------------TAA------------------------------------------------------------------TAGTAG------------------------------------------TAA---TGA------------------------------------------TAA------------TGA---------------------------------------------------------ATG------------------------------------TAG---------------------------------------------ATG------------------------TAA------------------------------------------TAA------TAATGA---------------------------------TGA---------------------------------------------------TAG---TAG---------------------TGA------TAAATG------------TAA---------------------------------------------------------TAA---------------------------------------------------------------TAG------------------------------------------------------------TAA---------------------------------------------------------TGAATG------------------TAA---------------------TAA---------------------------------------TAA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Tbd0                               IMAGE:6980745                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAATTCCGGGATGTTAATATAATGCAGAGTGAGACCGTCCAAGATGTTGTGCTTCTAGATCCACGATGGCTGTGTCACAATGTCCTCGGAAAGCTACTCTCTGTAGAAAACCCAAAAGCCCTACACCATTACAGGGGAAGGTATACAATGGAAGATATTCAGCGCTTGGTCACCGACAGTGATGTTGATGAACTTGTGCAGATCCTGGATGCAATGGACATTTGTGCCCGAGATCTAAGCAGCGGAGCTATGGTGGACATCCCTGCCCTCATTAAAACAGACAACCTCCACCGATCATGGGCTGATGAAGAAGAGGACATAATGATTTATGGAGGTGTTAGAATTGTTCCTGTGGAACACCTTACTCCCTTTCCGTGTGGAATTTTTCACAAAGTTCAAGTTAATTTATGCCGATGGGTACATCAACAGAGCGCCGACGGTGATGCTGATATACGTTTATGGGTAAACGGTTGTAAAATAGCAAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCATGGTCAAGGAATTGAAGTGCAAGTTAGGGGTCTGGAAACTGAGAAAATCAAGTGTTGTCTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAACAACGTTGCCTGGTCTTTTAACTGTAAAACATTACTTGAGCCCTCACAGCTAAGAGAGCATCACGAGCCACTGATGGTTTACAACCTAGAGACTTTTTTCGGGCCCAATACAAAAGGAGACTTCACTGGCTAACACCTGGCTG
  5   1   2       bld Brn2                                CAAJ24257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTTGGTCACCGACAGTGATGTTGATGAACTTGTGCAGATCCTGGATGCAATGGACATTTGTGCCCGAGATCTAAGCAGCGGAGCTATGGTGGACATCCCTGCCCTCATTAAAACAGACAACCTCCACCGATCATGGGCTGATGAAGAAGAGGACATAATGATTTATGGAGGTGTTAGAATTGTTCCTGTGGAACACCTTACTCCCTTTCCGGGTGGAATTTTTCACAAAGTTCAAGTTAATTTATGCCGATGGGTACATCAACAGAGCGCCGACGGTGATGCTGATATACGTTTATGGGTAAACGGTTGTAAAATAGCAAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCATGGTCAAGGAATTGAAGTGCAAGTTAGGGGTCTGGAAACTGAGAAAATCAAGTGTTGTCTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAACAACGTTGCCTGGTCTTTTAACTGTAAAACATTACTTGAGCCCTCAACAGCTAAGAGAGCATCACGAGCCACTGATGGTTTACCAACCTAGAGACTTTTTTCGGGCCCAAATACAAAAGGAGACTTCACTGGCTAACACCATGGCTGGATACAAAGAGAGCTTTAGCAGCATTCTTTGTTTTGGGTGCCTGGATGTTTACTCTCAAGGAAACCTAGGCCTGGATCACCATGTGTCCGATATCAATATTCTTGTTAGAAGAAAGCTCAGCCGACTTTTAGACCCACCAGATCCCATGGGAAAGGACTGGTGTCTACTAGCTATGAATTTGGGCCTACCTGACTTAGTTGCCAAATACAATACTAACAATTCTGTACAAAAAGA
  5   1   2       bld Brn2      in                        CAAJ19582.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTAATTTATGCCGATGGGTACATCAACAGAGCGCCGACGGTGATGCTGATATACGTTTATGGGTAAACGGTTGTAAAATAGCAAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCATGGTCAAGGAATTGAAGTGCAAGTTAGGGGTCTGGAAACTGAGAAAATCAAGTGTTGTCTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAACAACGTTGCCTGGTCTTTTAACTGTAAAACATTACTTGAGCCCTCAACAGCTAAGAGAGCATCACGAGCCACTGATGGTTTACCAACCTAGAGACTTTTTTCGGGCCCAAATACAAAAGGAGACTTCACTGGCTAACACCATGGCTGGATACAAAGAGAGCTTTAGCAGCATTCTTTGTTTTGGGTGCCTGGATGTTTACTCTCAAGGAAACCTAGGCCTGGATCACCATGTGTCCGATATCAATATTCTTGTTAGAAGAAAGCTCAGCCGACTTTTAGACCCACCAGATCCCATGGGAAAGGACTGGTGTCTACTAGCTATGAATTTGGGCCTACCTGACTTAGTTGCCAAATACAATACTAACAATTCTGTACAAAAAGACTTTTTGCCTAGTCCAATGTGTGCTCTTCTGCAGGAATGGAGCAATTCTCCTGAAAGTACTGTATCGCTCCTAATGTCTAAACTGAGAGAACTTGGGCGCAGGGATGCAGCAGATTTTTTACTAAAAGCATCCTCTGTTTTTAAGGTGACTCTTGATATCCATGGACAAGAAGCCTATGCGGCAAGCTGCAACAGCGGCACATCCTATAATTTCATTAGCTCAGTCGTGTCACGATGAGTAAATTAGTCCGCATGATCTTCTATAGCTATCTAAAACACCAGTATGAGAAGTGTAG
  5   1   2       bld Brn3      in                         CAAK8207.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTTATGCCGATGGGTACATCAACAGAGCGCCGACGGTGATGCTGATATACGTTTATGGGTAAACGGTTGTAAAATAGCAAATCGAGGGGCAGAGGTTTTGGTGTTGATGGTCAACCATGGTCAAGGAATTGAAGTGCAAGTTAGGGGTCTGGAAACTGAGAAAATCAAGTGTTGTCTACTTCTTGAATCCATTTGCAGTATCATTGACAACTTATTTGCAACAACGTTGCCTGGTCTTTTAACTGTAAAACATTACTTGAGCCCTCAACAGCTAAGAGAGCATCACGAGCCACTGATGGTTTACCAACCTAGAGACTTTTTTCGGGCCCAAATACAAAAGGAGACTTCACTGGCTAACACCATGGCTGGATACAAAGAGAGCTTTAGCAGCATTCTTTGTTTTGGGTGCCTGGATGTTTACTCTCAAGGAAACCTAGGCCTGGATCACCATGTGTCCGATATCAATATTCTTGTTAGAAGAAAGCTCAGCCGACTTTTAGACCCACCAGATCCCATGGGAAAGGACTGGTGTCTACTAGCTATGAATTTGGGCCTACCTGACTTAGTTGCCAAATACAATACTAACAATTCTGTACAAAAAGACTTTTTGCCTAGTCCAATGTGTGCTCTTCTGCAGGAATGGAGCAATTCTCCTGAAAGTACTGTATCGCTCCTAATGTCTAAACTGAGAGAACTTGNGCGCAGGGATGCAGCAGATTTTTTACTAAAAGCATCCTCTGTTTTTAAGGTGACTCTTGATATCCATGGACAAGAAGCCTATGCGGCAAGCTGCAACAGCGGCACATCCTATAATTTCATTAGCTCAGTCGTGTCACGATGAGTAAATTAGTCCGCATGATCTTCTATAGCTATCTAAACAACCAGTATG
  5   1   2       bld Egg                            TEgg124o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTAGACCCACCAGATCCCATGGGAAAGGACTGGTGTCTACTAGCTATGAATTTGGGCCTACCTGACTTAGTTGCCAAATACAATACTAACAATTCTGTACAAAAAGACTTTTTGCCAAGTCCAATGTGTGCTCTTCTGCAGGAATGGAGCAATTCTCCTGAAAGTACTGTATCGCTCCTAATGTCTAAACTGAGAGAACTTGGGCGCAGGGATGCAGCAGATTTTTTACTAAAAGCATCCTCTGTTTTTAAGGTGACTCTTGATATCCATGGACAAGAAGCCTATGCGGCAAGCTGCAACAGCGGCACATCCTATAATTCAATTAGCTCAGTCGTGTCACGATGAGTAAATTAGTCCGCATGATCTTCTATAGCTATCTAAACAACCAGTATGAGAAGTGTAGTTTATATGTGTTTCATAGGGGTTTCTAACCATTAATTTATAAACAATGTCAAAGAATGCCACATGCCATCAGAACCTGGTAGCTTTCTACTTTTTAATAAGGGTGACTGCCTTTTATCATATATTTTAAAGGCTCCCATGAATTTTTCACTCCAGAGTTCTATAATAATGTGCTGCTAGTTACTGCCACCTGAACAGATAATATATACTGTTCATTTTTTCTAATTAATTCTTTTATACATTTTACTAACCAGACTGGACAGTTGTTC
  5   1   2       bld Int1      in                        CAAP14100.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTATCGCTCCTAATGTCTAAACTGAGAGAACTTGGGCGCAGGGATGCAGCAGATTTTTTACTAAAAGCATCCTCTGTTTTTAAGGTGACTCTTGATATCCATGGACAAGAAGCCTATGCGGCAAGCTGCAACAGCGGCACATCCTATAATTCAATTAGCTCAGTCGTGTCACGATGAGTAAATTAGTCCGCATGATCTTCTATAGCTATCTAAACAACCAGTATGAGAAGTGTAGTTTATATGTGTTTCATAGGGGTTTCTAACCATTAATTTATAAACAATGTCAAAGAATGCCACATGCCATCAGAACCTGGTAGCTTTCTACTTTTTAATAAGGGTGACTGCCTTTTATCATATATTTTAAAGGCTCCCATGAATTTTTCACTCCAGAGTTCTATAATAATGTGCTGCTAGTTACTGCCACCTGAACAGATAATATATACTGTTCATTTTTTCTAATTAATTCTTTTATACATTTTACTAACCAGACTGGACAGTTGTTCACGTGTAGAAGAGAGGGCTCTCATTTTATGTCTGCTGATTTGGTAACTGATTCAGCTACAGATGATAGCAAATTTTGCTGTACATTAGAGTTGCCCAACCTGCAGACCTCAAGCTCTTGGATAATGCCATTTTACTTTATCAGTAGCTGGCAGAGCCCAGGTTGGACAGCCCCCTCTGTTTATATTCATAAAGCCAATACAGCAGCATGAGTGCCTTGCTCTCACAGGTTAGGTTACAATAGGCCAGAACCTGCTCTNCAGCACTTTCCACTGGGCTCTACCTCTCTATCGTTGTCTCCACGATAATCCTTGTGTC
  3   1   2       bld Brn2      in                        CAAJ19582.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTTTCACTCCAGAGTTCTATAATAATGTGCTGCTAGTTACTGCCACCTGAACAGATAATATATACTGTTCATTTTTTCTAATTAATTCTTTTATACATTTTACTAACCAGACTGGACAGTTGTTCACGTGTAGAAGAGAGGGCTCTCATTTTATGTCTGCTGATTTGGTAACTGATTCAGCTACAGATGATAGCAAATTTTGCTGTACATTAGAGTTGCCCAACCTGCAGACCTCAAGCTCTTGGATAATGCCATTTTACTTTATCAGTAGCTGGCAGAGCCCAGGTTGGACAGCCCCCTCTGTTTATATTCATAAAGCCAATACAGCAGCATGAGTGCCTTGCTCTCACAGGTTAGGTTACAATAGGCCAGAACCTGCTCTCAAGCACTTTCCACTGGGCTCTACCTCTCTATCGTTGTCTCCACGATAATCCTTGTGTCAAAAGAACATTTAAGATTTAACACATTAAACTTCCTTCATCATGAATACATACAATTACCTTCCTATTTTGCGAAGATTACTGCAAGAACTATACAAGGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCCACAACATAAATATTACAAATAAATGTTGTTTAACC
  5   1   2       bld Egg                            TEgg048f21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATATACTGTTCATTTTTTCTAATTAATTTTTTTATACATTTTACTAACCAGACTGGACAGTTGTTCACGTGTAGAAGAGAGGGCTCTCATTTTATGTCTGCTGATTTGGTAACTGATTCAGCTACAGATGATAGCAAATTTTGCTGTACATTAGAGTTGCCCAACCTGCAGACCTCAAGCTCTTGGATAATGCCATTTTACTTTATCAGTAGCTGGCAGAGCCCAGGTTGGACAGCCCCCTCTGTTTATATTCATAAAGCCAATACAGCAGCATGAGTGCCTTGCTCTCACAGGTTAGGTTACAATAGGCCAGAACCTGCTCTCAAGCACTTTCCACTGGGCTCTACCTCTCTATCGTTGTCTCCACGATAATCCTTGTGTCAAAAGAACATTTAAGATTTAACACATTAAACTTCCTTCATCATGAATACATACAATTACCTTCCTATTTTGCGAAGATTACTGCAAGAACTATACAAGGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTT
  5   1   2       bld Egg       in                   TEgg045o22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGACAGTTGTTCTCGTGTAGAAGAGAGGGCTCTCATTTTATGTCTGCTGATTTGGTAACTGATTCAGCTACAGATGATAGCAAATTTTGCTGTACATTAGAGTTGCCCAACCTGCAGACCTCAAGCTCTTGGATAATGCCATTTTACTTTATCAGTAGCTGGCAGAGCCCAGGTTGGACAGCCCCCTCTGTTTATATTCATAAAGCCAATACAGCAGCATGAGTGCCTTGCTCTCACAGGTTAGGTTACAATAGGCCAGAACCTGCTCTCAAGCACTTTCCACTGGGCTCTACCTCTCTATCGTTGTCTCCACGATAATCCTTGTGTCCAAAGAAC
  5   1   2       bld Egg                            TEgg101k10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACTTTCCACTGGGCTCTACCTCTCTATCGTTGTCTCCACGATAATCCTTGTGTCAAAAGAACATTTAAGATTTAACACATTAAACTTCCTTCATCATGAATACATACAATTACCTTCCTATTTTGCGAAGATTACTGCAAGAACTATACAAGGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCATTCATTCCAGACATCTCAGGTATGAGTTCTAACTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCATGAAGCGGGTTGGTCGCCTGCGATAGATCTCTGCATCACAGGTAGTTAACCCGTCCAAAATGCCTTTCCGCCGGCTCCTATTGTTGTCGGTGGAAGGGAAGTTGGTCGCCTGTGGTAGTAGAGATCATTGCGGGTGACTGGCTCGCTCTGT
  5   1   2       bld Ova1      in                         CABE1778.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATACAATTACCTTCCTATTTTGCGAAGATTACTGCAAGAACTATACAAGGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCATTCATTCCAGACATCTCAGGTATGAGTTCTAACTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCATGAAGCGGGTTGGTCGCCTGCGATAGATCTCTGCATCACAGGTAATTAACCCGTCCAaaatgcctttccgccggcagcggtgggagtcgccggcggaggggcctgctcatcgcttcggctttccgaagtCACCGCACCTGTAGTCAACCACGGGACTTCGGAGGCCGGGGCGGTGTGTGGGCCTTTCCGCTGGCGGCTCCTGTTGTTGTCGGTGGAAAGGAAGTTGGTCGCCTGTGGTAGTAGAGATCATTGCGGGTGACTGGCTCGCTCTGTAGGCCATCAGCTTAAGGGTGAagacacacggagctactggtggcagctgcttgtcacggctgctaaaatagacggtgctgatcatttgctgatggttgtctctatgtgtgttttagcagaggcaattctctgttgtctatggcggggtgttttctggcgtttggtggccgtga
  5   1   2       bld Tad5                                 XZT64724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCCTATTTTGCGAAGATTACTGCAAGAACTATACAAGGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCATTCATTCCAGACATCTCAGGTATGAGTTCTAACTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCATGAAGCAAGTTAGTCGCCTACGATAGATCTCTGCATCACAGGTAATTAACCCGTCCAaaatgcctttccaccggcaacaataggagtcgccagcagaaaggcctactcatcacttcagctttccgaagtcaccgcacctgtagtcaaccacaggacttcaaaaaccaaagcgaagtgtaggcctttccactggcaactcctattgttgtcagtgaaaaggAAGTTAATCGCCTGTGGTAGTAGAGATCATTGCAGGTGACTAACTCACTCTGTAGGCCATCAGCTTAAGGGTGAagacacacggagctactagtagcagctaattgtcacagctactaaaatagacaatgctgatcatttactgataattgtctctatgtgtgttttagcagaggcaattctctgttgtctatggcggggtattttctggtgtttagtaaccatgacaagtagctgctaTTATGTTTCTTCACTCTNATGGT
  5   1   2       bld Gas7                                 XZG56643.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCTTCTTGCATATTCCCCTGCAGTTAGCAATGAGACTCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCATTCATTCCAGACATATCAGGTATGAGTTCTAACTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCATGAAGCAAGTTAGTCGCCTACGATAGATCTCTGCATCACAGGTAATTAACCCGTCCAAAATGCCTTTCCACCGACTCCTATTGTTGTCGGTGAAAAGGAAGTTAATCGCCTGTGGTAGTAGAGATCATTGCAGGTGACTGGCTCACTCTGTAGGCCATCAGCTTAAgggtgaagacacacggagctactagtagcagctacttgtcacagctactaaaatagacaatgctgatcatttactgataattgtctctatgtgtgttttagcagaggcaattctctgttgtctatggcggggtattttctggcgtttagtaaccatgacaagtagctgctaTTATGTTTCTTCACTCTATTGGGTAAAAAGGAAACTTCCATGACTCTTATACAATTAT
  5   1   2       bld Egg                            TEgg127m17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCTATTGCTCAGGTACAATATTGATTTTATCATTTCCAAGCAGATATGTGAACAATTAGAAGTATTGTAGGTTTTTTCCTTTTAACTCCTTCGAGTACTTGAATGGTTGTCAGCACACTTTACCTAAACAGTGCTTTTCAGGTCATCCAGAATAGCGGGAGTTAAACTGAAATGCTTTACCAGTCTCAACTTTCCCTCCTGCCCATTCATTCCAGACATCTCAGGTATGAGTTCTAACTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCATGAAGCAAGTTGGTCGCCTGCGATAGATCTCTGCATCACAGGTAGTTAACCCGTCCAAAATGCCTTTCCACCGG
  3   1   2       bld Int1      in                        CAAP14100.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAGTTCTACTTATCCTCATTTGTATGCTTAGTTTTGTATTGTAAAAAGGACCTTAAGGCTGATGGCCCGTGGAGCGAGTTGGTCGCCTGCGATAGATCTCTGCATCACAGGTAATTAACCCGTCCAAAATGCCTTTCCGCTGGCGGCTCCTATTGTTGTCGGTGAAAAGGAAGTTGATCGCCTGTGGTAGTAGAGATCATTGCAGGTGACTGGCTCGCTCTGTGGGCCATCAGCTTAGGGGTGAAGACACACGGAGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGAGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGA
  3   1   2       bld Egg       in                    TEgg045o22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGGTAGTAGAGATCATTGCGGGTGGCTGGCTCGCTCTGTAGGCCATCGGCTTAAGGGTGAAGACACACGGAGCTACTGGTGGCGGCTGCTTGTCACGGCTGCTAGAATGGACGGTGCTGGTCGTTTGCTGATGATTGTCTCTATGTGTGTTTTGGCAGAGGCGGTTCTCTGTTGTCTATGGCGGGGTATTTTCTGGCGTTTGGTGGCCGTGACGGGTGGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATAAATGTAAATATATATGAATAAACANNTGTTGCCTGTTGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Brn3      in                         CAAK8207.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTGGTAGTAGAGATCATTGCGGGTGACTGGCTCGCTCTGTAGGCCATCAGCTTAAgggtgaagacacacggagctactagtagcagctacttgtcacagctactaaaatagacaatgctgatcatttactgataattgtctctatgtgtgttttagcagaggcaattctctgttgtctatggcggggtattttctggcgtttagtaaccatgacaagtagctgctaTTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGC
  3   1   2       bld Brn2 5g3  out                       CAAJ12328.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGACTGGCTCGCTCTGTAGGCCATCAGCTTAAGGGTGAagacacacggagctactggtagcagctacttgtcacagctactaaaatagacaatgctgatcatttactgataattgtctctatgtgtgtnttagcagaggcaattctctgttgtctatggcggggtattttctggcgtttagtaaccatgacaagtagctgctaTTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGC
  3   1   2       bld Ova1      in                         CABE1778.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGCTTAAGGGTGAagacacacggagctactggtggcagctgcttgtcacggctgctaaaatagacggtgctgatcatttgctgatggttgtctctatgtgtgttttagcagaggcaattctctgttgtctatggcggggtgttttctggcgtttggtggccgtgaCGGGTGGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTG
  3   1   2       bld Brn2      out                       CAAJ13618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGgtagcagctacttgtcacagctactaaaatagacaatgctgatcatttactgataattgtctctatgtgtgttttagcagaggcaattctctgttgtctatggcggggtattttctggcgtttagtaaccatgacaagtagctgctaTTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTT
  3   1   2       bld Brn3      out                        CAAK1623.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GTCCAAAATGCCTTTCCGCCGGCTCCTATTGTTGTCGGTGAAAAGGAAGTTGATCGCCTGTGGTAGTAGGGATCATTGCGGGTGACTGGCTCGCTCTGTAGGCCATCAGCTTAAGGGTGAAGACACACGGAGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGCATC
  5   1   2       bld Egg       in                   TEgg065b03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GATTCTCTGTTGTCTGTGGCGGGGTGTTTTCTGGCGTTTGGTGGCCATGACAAGTGGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATT
  3   1   2       bld Egg       in                    TEgg065b03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGTTTGTGGGGGGGTGTTTTTTGGCGTTTGGTGGCCATGACAAGTGGCGGCTATTATGTTTTTTCACTCTATTGGTTAAAAAGGAAACTTCCATGATTTTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTTTAATGAAAAGAAATTTTTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGGGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTTTTTGGCAATCGCTGAGTTTTATAAATGCAAGGGGTTTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTTTTAGTTATTATAGTTTGCACACAACAACAGGCAGCATTTAGGGTGCATTATTTGATTTTTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGTTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATTTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAAACATGTTGCATGGGGCTTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Brn3      out                       CAAK11593.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATGGCGGGGTATTTTCTGGCGTTTAGTGACCATGACAAGTAGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTG
  3   1   2      seed Brn2 PIPE out                       CAAJ22979.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCGTTTAGTAACCATGACAAGTAGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTCTTATACAATTATTTCCTTGCTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTCTAATGAAAAGAAATCTCTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTCTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTG
  3   1   2       bld Brn3 5g3  out                        CAAK4361.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTAGTAACCATGACAAGTAGCTGCTATTATGTTTCTTCACTCTATTGGTTAAAAAGGAAACTTCCATGACTTTTATACAATTATTTCCCTGGTAATCTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTTTAATGAAAAGAAATTTTTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTTTTGGCCAAAGAAGCCGTAGGATAGAGTTTGCTGGGACTGTTTGGCAATCGCTGAGTTTTATAAATGCAAGGGGTTTTTTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTTTGTAAAGCATTACTGTTTTTTTAAATCCCTGCAAGGGCCCTTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATTTAGGGGGCATTATTTGATTTTTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTTTAAAACCCAGCCAATGTGGAAGGGGGAAATTACCTTTTTTTTTGGAAGCTGCATGTGTTTTGAATGGACATATGTACATGTATATAAAGGGGTAACCCTTCCCTTTATTAATGTTTTATTTGTAGGACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGG
  3   1   2       bld Brn2 5g3  out                       CAAJ16432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTATGTTTCTTCCCTCTATTGGTTAAAAAGGAAACTTCCATGACTTTTATACAATTATTTCCCTGGTAATCTGGACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTTTAAAGAAAAGAAATCTTTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGGGGCATTATTCCCTGTTTTTGGCCAAAGAAGCAGTAGGATAGAGTTTGCTGGGGCTGTTTGGCAATCGCTGAGTTTTATAAATGCAAGGGGTTTTTTAAAAACCTGGGGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTTCTGTTTATTTAAATCCCTGCAAGGGCCCTTTATATTATTAGGTATTATAGGTTGCCCCCAACAACAGGCAGGATTTAGGGGGCATTATTTGATTTTTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACCCAGCCAATGTGGAAGGGGGGAATTACATTTTTTTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGGGGAACCCTTCCCTTTATTAAAGTTTTATTTGGAGGACAATTTTAAACTTTTTATATTTGGAAA
  3   1   2       bld Egg       out                   TEgg014h11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTCACTTTATTGGTTAAAAAGGAAACTTCCATGACTTTTATACAATTATTTCCTTGGTAATTTGTACTTGCCAACATTCCTTTTAAGCAATTTTCACTAACTTAACTGTTTTAATGAAAAGAAATTTTTGTGCAAAGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTTTGGCAATCGCTGAGTATTATAAATGCAAGGGGTTTATTAAAAACCTGGTGTTGAACGTTTATATAGACATATTTTATGTAAAGCATTTCTGTTTATTTAAATCCCTGCAAGGGCCATTTATATTATTAGTTATTATAGTTTGCCCCCAACAACAGGCAGCATTTAGGGGGCATTATTTGATTTTTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACCCAGCCAATGTGGAAGGGGGAAATTACATTTATTTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGGGTAACCTTTCCATTTATTAAAGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld BrSp      in                     EC2BBA18CG05.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCATTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATA
  5   1   2       bld BrSp      in                     EC2BBA18CG05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGACTGAAGGGGTCATGAGCCATTTGTGTGTGGCATTATTCCCTGTTATTGACCAAAGAAGCAGTAGGATAGAGTTAGCTGGGACTGTCTGGCAATCGCTGAGTATTATAAATGCAAGGGGTTATTAAAAACCTGGTGTTGAACGTTCATATAGACATATTTTATGTAAAGCATTACTGTTTATTTAAATCACTGCAAGGACCATTTATATTATTAGTTATTATAGTTTGCACACAACAACAGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp                            EC0CBA002AG06.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCAGCATCTAGGGTGCATTATTTGATTTCTTGTACTTGAAACAAAGAAGCAAGGTCAGTTGCTTTGGTTTATAAAACACAGCCAATGTGGAAGGGGGAAATTACATTTATCTTTGGAAGCTGCATGTGTTATGAATGGACATATGTACATGTATATAAAGGAGTAACCTTTCCATTTATTAATGTTTTATTTGTAGTACAATTTTAAACTTTTTATATTTGTAAATATATATGAATAAACATGTTGCCTGTTGCATCAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)