Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012078554 Xt7.1-TNeu110f24.3 - 24 ESTs
                                                                       ......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu110f24.3                           TGTGACTGAGGCGGATACCGGCACAGTATGAAGCGCACAGCGCGGAGTCCGTCGAAGGGGAAAACGGAGAGAGGAAGCTGAACATCCTGCGCATAACTATGGGCACAAGCTATTCCCCTGCAGCGCTGCTCCTCCTCCTCATCTTACTCCTGCTGCGCTCAGATGCCATCTCCGTGTTACCGGCACCCAGAAATGTACGCATTGACTCATACAACCTGCAGCACAAATTGCTTTGGGATCCCATCGAATCGGAAAATGTAACTTACACAGTGCAATATATGGGGAACTATATAGGTGAGGATGAATATAATGACATTTGTGAGAACCTTACTGAGACCGTTTGTAATTTTACGGACGAGATCAACTTTGAGTTGAAGGTTATTTTGAGAGTACGAGCAGAACTGGGACCACTGCATTCCAGCTGGAGTGAAACATCTGAATTCCAAGCAATGAATCACACCAAAATAAGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACAGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGATCATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAAATGACCGATCTGGAGGCCTCAGCTGAGTACTGTGTGTCGGTCACTGCTCTCCTGATGGGCCCTCATTACAGTCTGACTGGGGAGACAAGCCACATAGTGTGTGCCCAAACGCCAGCAACTCCAGGTTTAACTGCAGACAAAGTTATTTTTCTTTCGGTGGGACTCCTTCTTGGCTGTTGTATATTCCTGGGATTCAGCTATACTTTCTTCAGGCAGCGCAGACTGATCAAAATGTGGCTGTACCCCCCATACAGTATACCCCCCGACATAGAGCAGTACTTGCAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAAT
                                                  Xt7.1-CHK-1008229443                                 TGAGGCGGATACCGGCACAGTATGAAGCGCACAGCGCGGAGTCCGTCGAAGGGGAAAACGGAGAGAGGAAGCTGAACATCCTGCGCATAACTATGGGCACAAGCTATTCCCCTGCAGCGCTGCTCCTCCTCCTCATCTTACTCCTGCTGCGCTCAGATGCCATCTCCGTGTTACCGGCACCCAGAAATGTACGCATTGACTCATACAACCTGCAGCACAAATTGCTTTGGGATCCCATCGAATCGGAAAATGTAACTTACACAGTGCAATATATGGGGAACTATATAGGTGAGGATGAATATAATGACATTTGTGAGAACCTTACTGAGACCGTTTGTAATTTTACGGACGAGATCAACTTTGAGTTGAAGGTTATTTTGAGAGTACGAGCAGAACTGGGACCACTGCATTCCAGCTGGAGTGAAACATCTGAATTCCAAGCAATGAATCACACCAAAATAAGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACAGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGATCATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAAATGACCGATCTGGAGGCCTCAGCTGAGTACTGTGTGTCGGTCACTGCTCTCCTGATGGGCCCTCATTACAGTCTGACTGGGGAGACAAGCCACATAGTGTGTGCCCAAACGCCAGCAACTCCAGGTTTAACTGCAGACAAAGTTATTTTTCTTTCGGTGGGACTCCTTCTTGGCTGTTGTATATTCCTGGGATTCAGCTATACTTTCTTCAGGCAGCGCAGACTGATCAAAATGTGGCTGTACCCCCCATACAGTATACCCCCCGACATAGAGCAGTACTTGCAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAATCAAATC
                                                      consensus depths                                2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     5     6     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9    10    10    11    11    11    11    11    11    12    12    13    13    13    13    13    13    14    14    14    14    14    14    15    15    15    15    13    14    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    10    11     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10    10    11    10    11    10    11    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     7     7     7     7     7     7     7     6     7
                                               BLH ATG      98      87                           
                                               BLH MIN      35      34                           
                                               BLH MPR      32      34                           
                                               BLH OVR      98     132                           
                                               ORF LNG      98      13                           
                                                                                                                                                                                                                     PREDICTED = Xt ==== 1e-007     NP_001072391.1 hypothetical protein LOC779845 [Xenopus tropicalis] ===================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                        PROTEIN --- Dr ==== 3e-014     NP_001029357.2 interleukin 10 receptor, beta-like [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                             PROTEIN --- Mm ---- 2e-023     NP_032364.1 interferon gamma receptor 2 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                         PROTEIN === Gg ==== 2e-029     NP_001008676.1 IFNGR2 [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                      PROTEIN --- Hs ---- 2e-029     NP_005525.2 interferon-gamma receptor beta chain precursor; interferon gamma receptoraccessory factor-1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                   
                                                                                                                                 PROTEIN === Xl ==== 3e-109     AAI24883.1 Unknown (protein for IMAGE:8318600) [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu110f24.3                             TGA---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------ATG---------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------TAG---------------TAG---ATG------------------------------------------------------------------------------------------ATG---------------------TGA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG
                                                                   ORF                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  5   1   2   10  bld Limb 5g3  in                        CBSU2696.fwd GAAAGGCTGGTAAGGCTGCGGGACCGTGTGACTGAGGCGGATACCGGCACAGTATGAAGCGCACAGCGCGGAGTCCGTCGAAGGGGAAAACGGAGAGAGGAAGCTGAACATCCTGCGCATAACTATGGGCACAAGCTATTCCCCTGCAGCGCTGCTCCTCCTCCTCATCTTACTCCTGCTGCGCTCAGATGCCATCTCCGTGTTACCGGCACCCAGAAATGTACGCATTGACTCATACAACCTGCAGCACAAATTGCTTTGGGATCCCATCGAATCGGAAAATGTAACTTACACAGTGCAATATATGGGGAACTATATAGGTGAGGATGAATATAATGACATTTGTGAGAACCTTACTGAGACCGTTTGTAATTTTACGGACGAGATCAACTTTGAGTTGAAGGTTATTTTGAGAGTACGAGCAGAACTGGGACCACTGCATTCCAGCTGGAGTGAAACATCTGAATTCCAAGCAATGAATCACTCCAAAATAGGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACTGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGAACATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAAATGACCGATCTGGAGGCCTCAGCTGAGTACTGTGTGTTGGTCACTGCTCTCCTGATGGGCCCTCATTACAGTCTGACTGGGGAGACAAGCCACAT
  5   1   2       bld Egg  5g                        TEgg130d10.p1kSP6                           TGTGACTGAGGCGGATACCGGCACAGTATGAAGCGCACAGCGTGGAGTCCGTCGAAGGGGAAAACGGAGAGAGGAAGCTGAACATCCTGCGCATAACTATGGGCACAAGCTATTCCCCTGCAGCGCTGCTCCTCCTCCTCATCTTACTCCTGCTGCGCTCAGATGCCATCTCCGTGTTACCGGCACCCAGAAATGTACGCATTGACTCATACAACCTGCAGCACAAATTGCTTTGGGATCCCATCGAATCGGAAAATGTAACTTACACAGTGCAATATATGGGGAACTATATAGGTGAGGATGAATATAATGACATTTGTGAGAACCTTACTGAGACCGTTTGTAATTTTACGGACGAGATCAACTTTGAGTTGAAGGTTATTTTGAGAGTACGAGCAGAACTGGGACCACTGCATTCCAGCTGGAGTGAAACATCTGAATTCCAAGCAATGAATCACACCAAAATAAGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACAGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGATCATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAATGACCGA
  5   1   2   12  bld Gas7 5g3  in                         XZG42322.5p ...............................CTGAGGCGGATACCGGCACAGTATGAAGCGCACAGCGCGGAGTCCGTCGAAGGGGAAAACGGAGAGAGGAAGCTGAACATCCTGCGCATAACTATGGGCACAAGCTATTCCCCTGCAGCGCTGCTCCTCCTCCTCATCTTACTCCTGCTGCGCTCAGATGCCATCTCCGTGTTACCGGCACCCAGAAATGTACGCATTGACTCATACAACCTGCAGCACAAATTGCTTTGGGATCCCATCGAATCGGAAAATGTAACTTACACAGTGCAATATATGGGGAACTATATAGGTGAGGATGAATATAATGACATTTGTGAGAACCTTACTGAGACCGTTTGTAATTTTACGGACGAGATCAACTTTGAGTTGAAGGTTATTTTGAGAGTACGAGCAGAACTGGGACCACTGCATTCCAGCTGGAGTGAAACATCTGAATTCCAAGCAATGAATCACACCAAAATAAGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACAGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGATCATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAAATGACCGATCTGGAGGCCTCAGCTGAGTACTGTGTGTCGGTCACTGCTCTCCTGATGGGCCCTCATTACAGTCTGACTGGGGAGACAAGCCACATAGTGTGTGCCCAAACGCCCAGCACTCCAGGTTTAACTGCAGACAAAGTTATTTTTCTTTCGGTGGGA
  5   1   2   12  bld Gas7 5g3  in                         XZG47061.5p .............................................................TACAGCGCGGAGTCCGTCGAAGGGGAAAACGGAGAGAGGAAGCTGAACATCCTGCGCATAACTATGGGCACAAGCTATTCCCCTGCAGCGCTGCTCCTCCTCCTCATCTTACTCCTGCTGCGCTCAGATGCCATCTCCGTGTTACCGGCACCCAGAAATGTACGCATTGACTCATACAACCTGCAGCACAAATTGCTTTGGGATCCCATCGAATCGGAAAATGTAACTTACACAGTGCAATATATGGGGAACTATATAGGTGAGGATGAATATAATGACATTTGTGAGAACCTTACTGAGACCGTTTGTAATTTTACGGACGAGATCAACTTTGAGTTGAAGGTTATTTTGAGAGTACGAGCAGAACTGGGACCACTGCATTCCAGCTGGAGTGAAACATCTGAATTCCAAGCAATGAATCACACCAAAATAAGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACAGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGATCATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAAATGACCGATCTGGAGGCCTCAGCTGAGTACTGTGTGTCGGTCACTGCTCTCCTGATGGGCCCTCATTACAGTCTGACTGGGGAGACAAGCCACATAGTGTGTGCCCAAACGCCAGCAACTCCAGGTTTAACTGCAGACAAAGTTATTTTTCTTTCGGTGGGAC
  5   1   2       bld Egg       ?                    TEgg006g03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                       CTTTGACTTGAAGGTTATTTTGACAGTACGAGCAGAACTGGGACCAGTGCATTCCACCTGGAGTGAAACATCTGAATTCCCAGCAATGAATCCCACCAAAATAAGTCCTGTGAAATCTCTAACCGGGGCCTCCAGGGAG
  5   1   2       bld Ova1      in                         CABE2368.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATCGATTCGAGCTGGAGTGAAAATCTGAATTCCAAGCAATGAATCACACCAAAATAAGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACAGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGATCATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAAATGACCGACCTGGAGGCCTCAGCTGAGTACTGTGTGTCGGTCACTGCTCTCCTGATGGGCCCTCATTACAGTCTGACTGGGGAGACAAGCCACATAGTGTGTGCCCAAACGCCAGCAACTCCAGGTTTAACTGCAGACAAAGTTATTTTTCTTTCGGTGGGACTCCTTCTTGGCTGTTGTATATTCCTGGGATTCAGCTATACTTTCTTCAGGCAGCGCAGACTGATCAAAATGTGGCTGTACCCCCCATACAGTATACCCCCCGACATAGAGCAGTACTTGCAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGC
  5   1   2       bld Thy1      in                       CBST12066.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAAAATAAGTCCTGTGAAATCTCTAACCGTGTCCTCCAGGGAGGCAGAACACAACAGTCTCTATGTCAGTTTTGAGTCTCCTCTACAACCAGAGATCATCCCACAAAAGGGCAAAATGAAGTATTTGTTACAATACTGGAAAAAAGGTTCTGCTGCAAAGACTAATCTATCGACAAACGGGACATTTCGTAAAATGACCGACCTGGAGGCCTCAGCTGAGTACTGTGTGTCGGTCACTGCTCTCCTGATGGGCCCTCATTACAGTCTGACTGGGGAGACAAGCCACATAGTGTGTGCCCAAACGCCAGCAACTCCAGGTTTAACTGCAGACAAAGTTATTTTTCTTTCGGTGGGACTCCTTCTTGGCTGTTGTATATTCCTGGGATTCAGCTATACTTTCTTCAGGCAGCGCAGACTGATCAAAATGTGGCTGTACCCCCCATACAGTATACCCCCCGACATAGAGCAGTACTTGCAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAAGAACACAGCCTT
  3   1   2       bld Gas7 5g3  in                         XZG42322.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGCCAGCAACTCCAGGTTTAACTGCAGACAAAGTTATTTTTCTTTCGGTGGGACTCCTTCTTGGCTGTTGTATATTCCTGGGATTCAGCTATACTTTCTTCAGGCAGCGCAGACTGATCAAAATGTGGCTGTACCCCCCATACAGTATACCCCCCGACATAGAGCAGTACTTGCAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACTCTAAACAAAAAC
  3   1   2       bld Gas7 5g3  in                         XZG47061.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCGGTGGGACTCCTTCTTGGCTGTTGTATATTCCTGGGATTCAGCTATACTTTCTTCAGGCAGCGCAGACTGATCAAAATGTGGCTGTACCCCCCATACAGTATACCCCCCGACATAGAGCAGTACTTGCAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACAAAAT
  5   1   2       bld Gas                            TGas142f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGCGCAGACTGATCAAAATGTGGCTGTACCCCCCATACAGTATACCCCCCGACATAGAGCAGTACTTGCAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTACTTTACTCT
  5   1   2       bld Neu       in                   TNeu110f24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGC
  5   1   2       bld Sto1      in                        CABG10906.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAGATCCCCCCTTGAATGGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGNGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGA
  5   1   2       bld Tbd1      out                       CBXT19941.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGATACCCGAACGAAAGCAAAGATATGGATTTGGCAGAAGTGCAGTACGATCACATTTCCATTGTGGAAAGTGAATCATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGGAAGAACTGGAAATGCACACAAGCACACAGCCGGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGCGCACAATGTGACATTGGCTGCTATGGGGGACGCTCAGCCATGTGACTCCCGAATTTCACTCATTGCACCTGTGT
  3   1   2       bld Neu       in                    TNeu110f24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATGACAGAAAAGCCATTATTGTAATGAAGGAACCCTTAAGAAGAGAATAGGTGAGAAAGGCTGGAAAGGAGGAGGGGGCCCTCGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTGTATGATTTTTATGACGTAAAAATGAAGAATCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Sto1      in                        CABG10906.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGGCCCTCGGCAGCAATGTAGTACNACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAATC
  5  -1   2      seed Spl1      out                       CABK10141.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGGCAGCAATGTAGTAACACATACAGGGAGCCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAATCAAAAAAAAAA
  3   1   2       bld Gas0                                 dad48b07.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCATGGGCATCGCTGGAAACCTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCGTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGGGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGA
  3   1   2       bld Thy1      in                       CBST12066.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAAACNTATTTCAGGAATAATACTGTAAGCCAAGGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAATC
  3   1   2       bld Limb 5g3  in                        CBSU2696.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGTATCCAGCACTTTTATAACTCCCTGCGCTTACTTGCTGGAAATTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGTACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAATC
  3   1   2       bld Ova1      in                         CABE2368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGTATTTTAACAATAACTGAGGAACACAGCCTTGATATAAACTCACAGGCAAGAAACTCCCTTCCCAGGGCACAATGGTACCTTGGCAACGGAGCAGGCTACCTTAGTTACCTTTTGTGATGGAACGGAGTATCAGAGCTTGACAGAGAGGGCCCCGGCTGGCCTCAGACATTGCTACTTGCAACAAAATGGTATTTGCACTTATTTAGTGCCCATTAGAGGCATTTTTGTCAGTAGCCAATGAAACTGCTTGTTTTTGGACTAAGGGGAGAAACCAATGGAAACACAGAACATACAGACTCCTTGCAGATAGTGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAATC
  3   1   2       bld Lun1      in                        CABD14019.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTAAGGGGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGGC
  5   1   2       bld Lun1      in                        CABD14019.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACTAAGGGGCCCAGGAAAGAACTGGAAATGCACACAAGCACACAGCCAGCCTGAGTGCACACTTACAGGCGGATAACATTGAAGTCAATGGCTGCACCGACGGTTCATAGCGGTATAGACACTCTCTCTGCCGGCAGAGAAGGCGCACAATGTGACATTGGCTGCTATGGGGGACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGGC
  5   1   2       bld Thy1      in                        CBST5565.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GACGCCATGTGACTCCCGAATTTCACTCATTGCACTTGTGTGAAGGGGAGGAACACACAGTTCCATGAACGGATTCCCTTTTATTGCACTGCACTTTAACAGCAACATTAACAGAAGCTTGTTGTATTTTATTGCAATGCATTGTGAATGTTACTGTGCAACCACTTTCTAATAGACTTCTAACTTTTTTTCAAATGTTTTATGATTTTTATGACGTAAAAATGAATGAATCAAATCTCTGTGTACTTTAGTCTCTGTTCCAAATGTTCTCTGTTCATTTATGATCCCATGGGGAGTGGCCAGGTATCTATCAGACTTTCTAGGACTGGTCACCTTGAAGGAACAGTAACATCAAAAAATTAGGGTGTTTTAGGGTAATTGATCTGTAGTGTGCTGTTGCTCTGCAAAAAACTGGTGTTTTTGCTTCAGAGGGGCTACTATGTAGATGTGTTGCTGTGTGGCCCCGGGGGCAGCCATTCAAGCTGGAAAAAAGGAGAGGGGGCACAGGTTGCATAGCGGATAACTAGTAGATAAGCCCCATATAATGGGGGTTTATCTGTTGTCTGATGGGTGGCCTGTGCCTTTTCTCCTTTGAGTGGCTGCCCCCGTGGCTACACAGCAGCTTGTTTATATAAACTATAGTGGCCTTTCTGAGGCAGACACACCGGTTGTAGCAATGCAGGGCAACAGTACATTGTATTATAATTA
  3   1   0       add Thy1      in                        CBST5565.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CTTCAGAGGGGCTACTATGTAGATGTGTTGCTGTGTGGCCCCGGGGGCAGCCATTCAAGCTGGAAAAAAGGAGAGGGGGCACAGGTTGCATAGCGGATAACTAGTAGATAAGCCCCATATAATGGGGGTTTATCTGTTGTCTGATGGGTGGCCTGTGCCTTTTCTCCTTTGAGTGGCTGCCCCCGTGGCTACACAGCAGCTTGTTTATATAAACTATAGTGGCCTTTCTGAGGCAGACACACCGGTTGTAGCAATGCAGGGCAACAGTACATTGTATTATAATTACTTTTGTACACTTTCATTTTTTGGTGTTACTGTTCCTTTAAAGTTTAGTATGTTATAAAATGGCCTATTCTTAGCGACCTTTCAGTTGGTCTTAATTTTTTATAGTTGTTAAATTTATTTGCTTTCCCCGGCAGCCAAAAACTATTCCTCTGTGAGGTTAGTTTTATTGTTATTACTTTTTATTGCTTATCTTTCTCTTTAGTCCCTCAACTATTCATATTCCTGTCTTTTTTTCAAAACACTGCCTAGTTGCTAGGTTAAATAGCAACCAGATAGCGGCTTACATATCAAACTAGAGAGCTGCTACAAAAAAGCAAAGTAATCCAGAAACCACAAATAATAAAGAAATGCAAATTGTGTGAGAATATTACTCTCTACATCATATTAAAAGTTAACTTAAAGATG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)