Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Sep 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 455.0    0Xt7.1-st63e05.5.5                          15 PI      93         18      313                PREDICTED: similar to germinal histone H4 gene [Danio rerio]
     2 450.0    0Xt7.1-TNeu101g16.5                         11 PI      93         24      313                PREDICTED: similar to germinal histone H4 gene [Mus musculus]
     3 429.0    0Xt7.1-st73e18.3                             8 PI      90          5      313                PREDICTED: similar to histone H2A [Danio rerio]
     4 673.0    0Xt7.1-st79e10.5                             6 PI      98         43      407                germinal histone H4 gene [Gallus gallus]
     5 450.0    0Xt7.1-st55g13.5                             6 PI      93         24      313                germinal histone H4 gene [Gallus gallus]
     6 473.0    0Xt7.1-ANBT409.5                             4 PI      100         1      248                PREDICTED: similar to germinal histone H4 gene [Mus musculus]
     7 442.0    0Xt7.1-st83l24.5                             3 PI      92         18      313                germinal histone H4 gene [Gallus gallus]
     8 720.0    0Xt7.1-XZG57143.3                            2 PI      98          8      407                germinal histone H4 gene [Gallus gallus]

 This cluster: approximate FL confidence score = 95%

 1012078583 Xt7.1-st111h15.3 - 19 ESTs
                                                                       -160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-st111h15.3                                                                                                                                                                 TGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGCAATATAAATATATATAAATAAACGCTATGTAGGCTGCCAGAGCAAAGGGGTTATTCTATTTTATTGGGCGGTCATATAACGGCCAGACATTTTGGCGG
                                                  Xt7.1-CHK-1008230798                                                                                                                                                                       TGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGCAATATAAATATATATAAATAAACGCTATGTAGGCTGCCAGAGCAAAGGGGTTATTCTATTTTATTGGGCGGTCATATAACGGCCAGACATTT
                                                      consensus depths                                                                                                                                                                     10    10    18    18    18    18    18    18    18    18    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    19    18    18    18    18    17    18    16    18    16    18    16    18    16    17    16    17    16    17    16    16    15    16    15    16    15    16    13    14    12    12    12    12    12    12     6    10     6     6     6     6     4     5     2     5     2     3     2     3     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATATAAAAA
                                               BLH ATG       5     540                                                                                                                                                                 
                                               BLH OVR       5     990                                                                                                                                                                 
                                               ORF LNG       5       5                                                                                                                                                                 
                                                                                                                                                                                                                                            PROTEIN === Sc ==== 2e-050     NP_009563.1 Histone H4 (HHF1 and HHF2 code for identical proteins); Hhf1p [Saccharomycescerevisiae] ==================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Sp ==== 8e-053     XP_781796.1 PREDICTED: similar to histone (his-67) [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Ce ==== 5e-053     NP_492641.1 histone (his-67) [Caenorhabditis elegans] ================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Dm ==== 3e-053     NP_524352.1 Histone H4 replacement CG3379-PC [Drosophila melanogaster] ===============================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Hs ==== 2e-053     NP_003529.1 H4 histone family, member A [Homo sapiens] ===============================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xl ==== 2e-053     AAA49761.1 histone H4 [Xenopus laevis]  ==============================================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Xt ==== 2e-053     CAJ83618.1 similar to histone 1, H4h [Xenopus tropicalis] ============================================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = Dr ==== 1e-053     XP_689539.1 PREDICTED: similar to germinal histone H4 gene [Danio rerio] =============================================================================================================================================================================================================
                                                                                                                                                                                                                                            PREDICTED = ?? ==== 1e-053     XP_692214.1 PREDICTED: similar to germinal histone H4 gene [Danio rerio] =============================================================================================================================================================================================================
                                                                                                                                                                                                                                            PROTEIN === Gg ==== 9e-054     NP_001032934.1 germinal histone H4 gene [Gallus gallus] ==============================================================================================================================================================================================================================
                                                                       PREDICTED - Mm ---- 4e-054     XP_981474.1 PREDICTED: similar to germinal histone H4 gene [Mus musculus] ---------------------------------------------------------========================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-st111h15.3                                                                                                                                                          TGA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------TAA------------------------------------------TAA---------------------------------------------------------TGA---------ATG---------------------------------------------TGAATG---------------------------TGA---------------------TAA---------------TAA---------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                ]
  3   1   2       bld Gas  5g3  in                    TGas066k01.q1kT7                                                                                                                                                    GGGTTTTGAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGCAATATAAATATATATAAATAAACGCTATGTAGGGCTGCCAGAGCAAAGGGGTTATTAAAAAAAAAAAAAAAAAA
  5   1   2   32  add Gas7 PIPE                            XZG18483.5p ....................................................................................................................................................CGTTTTGAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCAATaaaagataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGGG
  5   1   2       bld Gas  5g3  in                   TGas066k01.p1cSP6                                                                                                                                                         TTGAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAAGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGGCATATAAATATATATAAATAAACGCTATG
  3   1   2       bld Gas8 5g3  in                          st48g23.3p                                                                                                                                                          TGAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCAAAGAGATG
  3   1   2       bld Gas8 5g3  in                         st111h15.3p                                                                                                                                                           GAAGATTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATG
  3   1   2       bld Gas8 5g3  in                          st90h10.3p                                                                                                                                                           GAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGAT
  3   1   2      seed Gas8 5g3  in                          st91h10.3p                                                                                                                                                           GAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGG
  3   1   2       bld Gas8 5g3  in                          st92h10.3p                                                                                                                                                           GAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGNTCTNANGGGCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTC
  3   1   2       bld Gas8 5g3  in                          st93h10.3p                                                                                                                                                           GAAGGTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAA
  5   1   2       bld Neu  5x3                       TNeu051d15.p1cSP6                                                                                                                                                               GTTGAACATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCA
  5   1   2       bld Gas8 5g3  in                          st90h10.5p                                                                                                                                                                     CATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATATAAAAAAAAAA
  5   1   2       bld Gas8 5g3  in                          st91h10.5p                                                                                                                                                                     CATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATATAAAAAAAAAA
  5   1   2       bld Gas8 5g3  in                          st92h10.5p                                                                                                                                                                     CATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATATAAAAAAAAAA
  5   1   2       bld Gas8 5g3  in                         st111h15.5p                                                                                                                                                                      ATGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGCAATATAAATATATATAAATAAACGCTATGTAGGCTGCCNGAGAAAAAAAAAA
  5   1   2       bld Gas8 5g3  in                          st48g23.5p                                                                                                                                                                       TGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGCAATATAAATATATATAAATAAACGCTATGTAGGCTGCCAGAAAAAAAAAA
  5   1   2       bld Gas8      in                          st60f02.5p                                                                                                                                                                       TGTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCATTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGCAATATAAATATATATAAATAAACGCTATGTAGGCTGCCAGAGCAAAGGGGTTATTCTATTTTATTGGGCGGTCATATAACGGCCAGACATTTTGGCGGACTT
  5   1   2       add Gas8                                  st23g21.5p                                                                                                                                                                        GTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCAAAAATAAATAAAAAAAAAAAGAAAAAAAAAAAAAATTAAAAAAAAAA
  5   1   2       bld Gas8 5g3  in                          st93h10.5p                                                                                                                                                                        GTCTGGCAGAGGCAAGGGCGGTAAGGGCCTGGGGAAAGGAGGCGCCAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCACTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATATAAAAAAAAAA
  3   1   2       bld Gas8      in                          st60f02.3p                                                                                                                                                                                                                     CAAGCGCCACAGGAAGGTGCTGCGGGATAACATCCAGGGGATCACCAAGCCCGCCATCCGCCGCCTGGCACGCAGAGGGGGAGTCAAGCGCATCTCCGGCCTCATTTATGAGGAGACTCGGGGGGTGCTGAAAGTTTTCCTGGAGAACGTTATCCGGGACGCTGTCACCTACACCGAGCACGCCAAGAGGAAGACTGTTACCGCTATGGATGTGGTGTATGCTCTCAAGCGCCAGGGCCGCATTCTCTACGGATTCGGGGGTTAAACCCTCTTATTCCCTCACAGCATCATTTCCCAAAGGCCCTTTTAAGGGCCCCCACTATTTCAGGAAAAGGCTGTGTCTGTATATTATCTGCTCCCTATAAATTGATTAGATACAATGTTACGGGTTGGGAAGGAAAGTAGGTCCGGGCCCACAGTGCGGATCTGAATGGCTGAAGGGATAAATCTCCTGAATAGGTGACTTGGCTGTAATAACTCGAGCTAAAGAGATGGGGCAATATAAATATATATAAATAAACGCTATGTAGGCTGCCAGAGCAAAGGGGTTATTCTATTTTATTGGGCGGTCATATAACGGCCAGACATTTTGGCGGACTTTTTGAATAAGCCAATGGCTCCCACAGTATGGGCTATTAGTCGGCAGATATAATTGGGGGTCTCGGTGACTGACAGGAGGGAAAGGAGAGGATTTGGTTGCGAGTAGAAAGCGCTGATGTTTATTATTGCGGGAATGTAACCAATGTGACACCAATGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)