Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC11363.3                          18 END     1           3        5                (no blast hit)
     2   0.0    0Xt7.1-CAAK11634.3                           7 END     1           3       14                (no blast hit)
     3  1.75    0Xt7.1-CAAP12315.5                           4 END     4          12      100                (no blast hit)
     4   2.0    0Xt7.1-CABD7010.3                            2 END     2           6      100                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012078718 Xt7.1-CABE13594.3.5 - 32 ESTs
                                                                       ......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CABE13594.3.5                                                                                                                                                                                 TGGCTGTCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACCCATACAGAGACCCAGGCATCAGAAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTAGTCCCATCCAGAACCCAATCACAAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTCTTTAGAAGAAGAAAAGAAAGAAAGCTAGAAGAGATGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATTATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAA
                                                  Xt7.1-CHK-1008227812                                                                                                                                                                                       TCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTxxCxAxCCATACxxxxxxxxxxxxATCAGAAxxxxxTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCAxxxxxTGAAGAAAGTCAxxxxxxxAxGxCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTxxxxxCATCCAGAACCCAATCACAAAxxAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTxxxxAGAAGAAGAAAAGAAAGAAAxxxxxxAGAGATGxxxxxCATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAAxxATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATxxxxxxTATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                      2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     4     4     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     3     4     4     4     4     4     4     4     4     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     3     7     5     9     5     9     5     9     5     9     4     9     4     9     4     8     4     8     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     8     4     8     4     8     4     8     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     8     4     9     4    11     4    11     4    11     4    11     6    12     6    12     7    13     5    12     4    10     4    10     5    12     5    10     5    10     5    10     5    10     5    10     6    11     6    11     7    12     7    13     7    13     7    13     8    14     8    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     8    15     9    16     9    16     9    16     9    16     9    17     9    17     9    17     9    16     9    16     9    16     9    16     9    16     9    15     9    15     9    15     9    15     9    15     9    15     9    15     9    15     9    15     9    15     9    16     9    16     9    16     9    16     7    15     7    15     7    15     7    15     7    15     8    15     4    15     4    15     4    14     4    14     4    14     4    13     4     8
  5   1   2  SIG                                     Xt7.1-CABE13594.3                                                                                                                                                                                 TGGCTGTCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTNGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAA
  5   1   2  SIG                                     Xt7.1-CAAP12315.3                                                                                                                                                                                                                                                                                                                     ATTTCTGTCACTGCTACAGCTGCTGCCACTCATCACCTCCACCACAAACAAACAAACACGGTTCGCTGGTCGGAGAAGTGGTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATTGCGGTATTTGAAATGACCGGGTGCAACGTTTTTACAAGGTATTTTCTAATAAAGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTAGATTAAAAAATGGATGCATCATATGATACNATAAGCCTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAA
  5   1   2                                           Xt7.1-CABK2932.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGTTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTAGAA
  5   1   2                                           Xt7.1-CABE2867.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAG------------------------------------CATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAAT
  5   1   2                                           Xt7.1-CBTC3138.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTCTTGTCTTTGTTGTATATGCAGTAGCAATGAAAATATAATTTTCTAGTATACTTTGGAGCAGAGAAAGCATGGTATGTCCTTTATTTAATGCATGTTTGATCTGGTGCTAACAGTTCTGAGGTAAGGAAATGATAATTAAATGTAAAGAAAAAGCTAATGGCTTGTGAATATTTTATGTTTGTTAAATATATTATTCATGTAAATGTAATGCATGGGATATTTATATTAGATTTATATTAGTCCAAATCAAAAAGGTGCTTAATAATTGTTGGTTACATTTGCATCTGAATTTACCATTAAAGTTTGGTTACTTCTTGTGTATATCCCCAGTTATCCAAAATGGAAATGTTTCAGGTCAAAATGATAAAACGGGAGCATAGAGCACAACAAATAGGTGAATTATACTAACATGCATTGCTTACCTGATCAACACACCACCTTCTTTGCAAGTTTCAATGGGGGTACATGCTCCCTTTCCACAGAGTGAAAGATGATAAGACAAAGTTCAGTTACTCTATATACTTGTTATAATCCAAATTGCTCTTAATATATTCCTCACCTTTAGATTTAAAAAATGGATGCATCATATGATAACATAAGCCTTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAA
  5   1   2                                           Xt7.1-CABE5783.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGATTAAGTGTCGGAGGACCTTCAGTTAGTACTAGATTAACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTC
  5   1   2  SIG                                      Xt7.1-CBTC4602.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCACAGCCTATTTCATCAGCTTCACTGTCTACAAG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCAAATGTTGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGCTAAAGTAACCTCAGAGAGAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGTACTGCAACTACTGAACTGAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AATGGAAGACAC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGACAGTGATGATGACACTGTTCG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCATCCAGAACCCAATCACAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAGAAGAAGAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACAGGATAACTC
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------AC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ----------C-
                                               BLH ATG     253     866                                                                                                                                                                                 
                                               BLH MIN     214     206                                                                                                                                                                                 
                                               BLH OVR     253     245                                                                                                                                                                                 
                                               ORF LNG     253      43                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                         PREDICTED - Bf ---- 1e-007     AAM18868.1 unknown [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 2e-009     NP_013018.1 Suppressor of mutant AC40 subunit of RNA polymerase I and III (high serine);Srp40p [Saccharomyces cerevisiae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 1e-018     NP_001021829.1 Y73E7A.9 [Caenorhabditis elegans] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- ?? ---- 5e-034     NP_001084901.1 WD repeat-containing protein 42A [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 7e-038     NP_611296.2 CG5124-PA [Drosophila melanogaster] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 2e-074     XP_795377.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 0          XP_692923.1 PREDICTED: similar to IQ motif and WD repeats 1 isoform a [Danio rerio] --------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Gg ---- 0          XP_416649.2 PREDICTED: similar to IQ motif and WD repeats 1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                               PREDICTED - Mm ---- 0          XP_922634.2 PREDICTED: similar to IQ motif and WD repeats 1 isoform a isoform 4 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---= 0          NP_001017977.1 IQ motif and WD repeats 1 isoform b [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xl ==== 0          AAI24851.1 Unknown (protein for MGC:154279) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN === Xt ==== 0          AAI21611.1 Novel protein similar to IQ motif and WD repeats 1 (IQWD1) [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CABE13594.3.5                                                                                                                                                                                                                                           TGA------------------------------------------------------------------------------ATG------------------------TAG------------------------TAA---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG---ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------ATG------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------ATG------------------TGAATG------------------------------------------------------------------------------------------TGA------------------TAA---------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2  SIG                                     Xt7.1-CABE13594.3                                                                                                                                                                                 TGGCTGTCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTNGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAA
                                                  Xt7.1-CHK-1008293186                                                                                                                                                                                       TCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTNGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAA
  0   1   1           Ova1 FL                         CABE13594.FL-MGC                                                                                                                                                                           GATACATGGCTGTCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FLt5                   TEgg058p08.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCCGGGTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAAAAAAA
  5   1   4   10 seed Tail 5g3  in                         CBSW5605.b1 ..........................................................................................................................................AAACACGGTTCGCTGGTCGGAGAAGTGGGTAAGATACATGGCTGTCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTGAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTAT
  5   1   2       ext Ova1 FL   in                        CABE13594.5p                                                                                                                                                                     CCGAGGGATACATGGCTGTCAGAGCGTCCTTTACCGCTTCCGGCCCTGTGTATTGCTCGCACTGAGCGCCTGACAGAACTTTACAGCGGGAGCCTGTAACAGGCAGAGTGGCCGCCTTCCTTTAAGCTGTAGTCGTGCACAGTTTTTCCCGATGAAGTCAAGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCTAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCT
  5   1   3        nb Egg  5g                        TEgg083p05.p1kSP6                                                                                                                                                                                                                                                                                                                                     AGCATCTGCGCTTTTGTTTAGTCACGAGTCGCTATTACCTTGCGCAAAGAAATCCGATTGCCATTTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTGCACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACT
  5   1   2       add Lun1      out                        CABD7010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTNCATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGATTCACCTTCTGTGATTAGCAAACAGCTC
  5   1   2       ext Brn4      in                        CAAL20989.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCCACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAATGAGCCGGTACTGC
  5   1   2       ext Egg  FLt5 in                   TEgg058p08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCCGGGTGTTAAGCGCCTAACACTCCGAGGAGATTGCGTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGATAAATAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCACCAGAAAACCAAACATACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACCAGCCATACAGAGACCCAAGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAACAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGATGCTCCAACCCTGCTGATAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACTAGTACAATGAAGCTGGACTTCACTGATGAATGGAGCAATAGATCTTCGAGATCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCTAGTGAAATGGAAGACACATCT
  3   1   2       ext Brn4      in                        CAAL20989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGCAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAG
  5   1   2       ext Eye       out                        CCAX8632.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATT
  3   1   0       chi Egg       out                   TEgg058p17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATNGAGGAGAAGACNGACNTGAATGAGCCCCACCACCACCCAGTCGTTCTGCCTCTGTTGTGTGTACTGGGACACTATTGATTTTAGTTTCCATTATATTTTATCTAAATTTCCAGTCAGTTATACAATAGCTCATTTCTAGGGTTAATGTTTTGTTATTAGTGCTGCATCGGATTTGGAATCAGTAGCACTTGTTTCTGAAAGGAACAAAAAAATATATGTATAACTTTACATATGAAATGTGCAGACATTCCATTTTGAGATGTAAATATGGTACTGAAAATAATGTGTTGTTTAATATTAAAGCATTATGAACGTCAAAAAAAAAAAAAAAA
  3   1   2       ext Ova1 FL   in                        CABE13594.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTNGAAGAAGAAAAGAAAGAAAAGAGCTNGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTT
  3   1   2       ext Ski1      out                        CABJ3653.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTNGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAATTCT
  3   1   2       ext Egg  FLt5 in                    TEgg058p08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAATCTGTGTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGAGTTCAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACATTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGTTTCACTCAACCATATACGGGCAGATTGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTTCATTATGTAAAAGACAATTTATTATCATTTTCCTAAATGGATTTGGCACGATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAAAGACCTTCAAAATATTTCCAGCTTTTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTACTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAAAAAAA
  3   1   0       chi Spl2      out                       CBSS2487.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGCTTTAATAGAATCTGACAACACTACATCACCAGCAGGAAATTACACAACCTCACTGTGAAGAACCATTTTCACTGCTTCAAATGAAAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAATTCT
  5  -1   3        nb Gas       out                  TGas122c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTGTTATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGA
  3   1   4      seed Tail 5g3  in                         CBSW5605.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTAAAAAAAAAAAAAAA
  5   1   2       ext Te5                                  CAAO8056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaNGGGGGGGCCCCCCGGAAAAAAAAAAAAGGGCCCCCTGGGGGGACAACCCCCCGGGGAAAAAGAAAACAGCC
  5   1   2  SIG                                     Xt7.1-CAAP12315.3                                                                                                                                                                                                                                                                                                                     ATTTCTGTCACTGCTACAGCTGCTGCCACTCATCACCTCCACCACAAACAAACAAACACGGTTCGCTGGTCGGAGAAGTGGTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATTGCGGTATTTGAAATGACCGGGTGCAACGTTTTTACAAGGTATTTTCTAATAAAGCA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTTAGATTAAAAAATGGATGCATCATATGATACNATAAGCCTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAA
                                                  Xt7.1-CHK-1008293174                                                                                                                                                                                                                                                                                                                           GTCACTGCTACAGCTGCTGCCACTCATCACCTCCACCACAAACAAACAAACACGGTTCGCTGGTCGGAGAAGTGGTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATTGCGGTATTTGAAATGACCGGGTGCAACGTTTTTACAAGGTATTTTCTAAT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TTAAAAAATGGATGCATCATATGATACNATAAGCCTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAA
  5   1   4   14 seed Te4  5g3  in                         CAAN2919.5p ....................................................................................................................................................................................................................................................................................................................ATTTCTGTCACTGCTACAGCTGCTGCCACTCATCACCTCCACCACAAACAAACAAACACGGTTCGCTGGTCGGAGAAGTGGTTGGACAAGCCAGCCTGAAAGGATATACAGGAACTGGACTATGTCACGGTGCTATTCTGGTCTAATATGGGATGTACGGAAACGCTCTCTTGGATTGAGTGAGCCCGATGTGGTCCGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATTGCGGTATTTGAAATGACCGGGTGCAACGTTTTTACAAGGTATTTTCTAATAAAGCATTT
  3   1   2       ext Int1      out                       CAAP12242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTTTAGATTAAAAAATGGATGCATCATATGATACNATAAGCCTGCTCCTCTTTGTATTATTTCNATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAA
  3   1   3        nb Int1      out                       CAAP12315.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGATTTAAAAAATGGATGCATCATATGATANCATAAGCCTTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAA
  3   1   4      seed Te4  5g3  in                         CAAN2919.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTNGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATG
  5   1   2                                           Xt7.1-CABK2932.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGTTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTAGAA
                                                  Xt7.1-CHK-1008293180                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTGTTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTAGAAGAAAAA
  5   1   4      seed Spl1      in                         CABK2932.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGTAGCAACTATTTGGGAAGAAGAGAGTTTGTGCAAAGACTTAAATTGGAAGCAACATTAAACATTCATGATGGTTGTGTAAACTCAATTTCTTGGGGTAGTACAGGAGAATACATTTTATCTGGTTCTGATGATACCACTTTGGTTATCACTAACCCGTACAATAAAAAAGTCCTGACAAGAATTCGATCAGGTCACAGAGCCAATATTTTTAGTGCAAAGTTCCTGCCTCTTACCAATGACAAGCAGATTATATCCTGCTCCGGAGATGGAGTTATATTTTTTACAGATATTGAGAAAGATGCAGACACAAACAGGCAATGTCAATTTACATGTCATTATGGAACCGCATATGAGATCATGACAGTACCCAATGATCCCTACACATTTTTGTCCTGTGGTGAAGATGGAACGGTTAGATGGTTTGATACCAGGACGAAGACCAGCTGTACTAAAGAAGACTGCAAAGATGATATTCTAATAAACTGCAGACGAGCTGCTACCTCAATTGCAATTTGTCCAACGGCACCATACTATCTTGCAGTTGGATGTTCGGACAGCTCAGTGAGAATATATGATCGCCGTATGCTTGGAACTAGAGCAACGAACAATTATTCAAATCGTGGAACTACAGGAATGTGTGTCCGCTTTGTTCCCTCACATCTTACCAACAAATCCTGCAGAGTGACCTCTTTATGCTATAGTGAAGATGGGCAAGAGGTTCTAGTGAGCTACTCCTCTGACTACATTTACCTATTTGATCCTAAAAATGACCAAGCAAAAGAGCTCAAATTGCCATCATCTGATCAGAAAAGGGAGGAGGTAAGGCAACCCCCTGTTAAGCGCCTAAGACTCCGAGGAGATTG
  3   1   4      seed Spl1      in                         CABK2932.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAGCGCCTAAGACTCCGAGGAGATTGTTCTGATACAGGTCCAAGGGCAAGACCTGAAAGTGAACGAGAAAGAGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTAGAAGAAAAAAAA
  5   1   2                                           Xt7.1-CABE2867.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAG------------------------------------CATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAAT
                                                  Xt7.1-CHK-1008293176                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCT------------------------------------------------AAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGAC
  5   1   4      seed Ova1      in                         CABE2867.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGATGGAGATCAAAGCACCAATGCATCACTAATGCAAAGAATGTCTGACATGCTCTCAAGGTGGTTTGAAGAGGCTAGTGAAGTTGCACAGAGCAGCAGAAGACGAAACAGACTGCAAAATAGAGGAACTTCACAGCCTATTTCATCAGCTTCACTGTCTACAAGCCATACAGAGACCCAGGCATCAGAAACTTTTCCAGAGGTGGCTGCCTCCTCAGAACAGCCATCTTCCTCATCAAATGTTGAAGAAAGTCACTCAATGACGTCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAG
  3   1   4      seed Ova1      in                         CABE2867.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATCTATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAATTCCAAAAAAAAAAAAAAA
  5   1   2                                           Xt7.1-CBTC3138.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTCTTGTCTTTGTTGTATATGCAGTAGCAATGAAAATATAATTTTCTAGTATACTTTGGAGCAGAGAAAGCATGGTATGTCCTTTATTTAATGCATGTTTGATCTGGTGCTAACAGTTCTGAGGTAAGGAAATGATAATTAAATGTAAAGAAAAAGCTAATGGCTTGTGAATATTTTATGTTTGTTAAATATATTATTCATGTAAATGTAATGCATGGGATATTTATATTAGATTTATATTAGTCCAAATCAAAAAGGTGCTTAATAATTGTTGGTTACATTTGCATCTGAATTTACCATTAAAGTTTGGTTACTTCTTGTGTATATCCCCAGTTATCCAAAATGGAAATGTTTCAGGTCAAAATGATAAAACGGGAGCATAGAGCACAACAAATAGGTGAATTATACTAACATGCATTGCTTACCTGATCAACACACCACCTTCTTTGCAAGTTTCAATGGGGGTACATGCTCCCTTTCCACAGAGTGAAAGATGATAAGACAAAGTTCAGTTACTCTATATACTTGTTATAATCCAAATTGCTCTTAATATATTCCTCACCTTTAGATTTAAAAAATGGATGCATCATATGATAACATAAGCCTTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------CAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAA
                                                  Xt7.1-CHK-1008293182                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGTCTTTGTTGTATATGCAGTAGCAATGAAAATATAATTTTCTAGTATACTTTGGAGCAGAGAAAGCATGGTATGTCCTTTATTTAATGCATGTTTGATCTGGTGCTAACAGTTCTGAGGTAAGGAAATGATAATTAAATGTAAAGAAAAAGCTAATGGCTTGTGAATATTTTATGTTTGTTAAATATATTATTCATGTAAATGTAATGCATGGGATATTTATATTAGATTTATATTAGTCCAAATCAAAAAGGTGCTTAATAATTGTTGGTTACATTTGCATCTGAATTTACCATTAAAGTTTGGTTACTTCTTGTGTATATCCCCAGTTATCCAAAATGGAAATGTTTCAGGTCAAAATGATAAAACGGGAGCATAGAGCACAACAAATAGGTGAATTATACTAACATGCATTGCTTACCTGATCAACACACCACCTTCTTTGCAAGTTTCAATGGGGGTACATGCTCCCTTTCCACAGAGTGAAAGATGATAAGACAAAGTTCAGTTACTCTATATACTTGTTATAATCCAAATTGCTCTTAATATATTCCTCACCTTTAGATTTAAAAAATGGATGCATCATATGATAACATAAGCCTTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGA
  5   1   4      seed Bone      in                        CBTC3138.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GTTTCTTGTCTTTGTTGTATATGCAGTAGCAATGAAAATATAATTTTCTAGTATACTTTGGAGCAGAGAAAGCATGGTATGTCCTTTATTTAATGCATGTTTGATCTGGTGCTAACAGTTCTGAGGTAAGGAAATGATAATTAAATGTAAAGAAAAAGCTAATGGCTTGTGAATATTTTATGTTTGTTAAATATATTATTCATGTAAATGTAATGCATGGGATATTTATATTAGATTTATATTAGTCCAAATCAAAAAGGTGCTTAATAATTGTTGGTTACATTTGCATCTGAATTTACCATTAAAGTTTGGTTACTTCTTGTGTATATCCCCAGTTATCCAAAATGGAAATGTTTCAGGTCAAAATGATAAAACGGGAGCATAGAGCACAACAAATAGGTGAATTATACTAACATGCATTGCTTACCTGATCAACACACCACCTTCTTTGCAAGTTTCAATGGGGGTACATGCTCCCTTTCCACAGAGTGAAAGATGATAAGACAAAGTTCAGTTACTCTATATACTTGTTATAATCCAAATTGCTCTTAATATATTCCTCACCTTTAGATTTAAAAAATGGATGCATCATATGATAACATAAGCCTTGCTCCTCTTTGTATTATTTTCATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGA
  3   1   4      seed Bone      in                        CBTC3138.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGACAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAATTCT
  5   1   2                                           Xt7.1-CABE5783.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGATTAAGTGTCGGAGGACCTTCAGTTAGTACTAGATTAACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTC
                                                  Xt7.1-CHK-1008293178                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGATTAAGTGTCGGAGGACCTTCAGTTAGTACTAGATTAACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGA
  3   1   4      seed Ova1      in                         CABE5783.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGATTAAGTGTCGGAGGACCTTCAGTTAGTACTAGATTAACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAG
  5   1   4      seed Ova1      in                         CABE5783.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCTATAGCTACTGAACAACTAGAAACTTTTGCTTCATCAGATGGAGGCTCCAACCCTGCTGAGAGAGCTAAAGTAACCTCAGAGAGAGAGAAAAATGAGCCGGTACTGCAATTACATTATAGCACTGAAGGAACAACAACAAGTACAATAAAGCTGGACTTCACAGATGAATGGAGCAATAGATCTTCAAGTTCTGTAGCTGTGAAAGTCGGGAACAATGAAAGTACTGCAACTACTGAACTGACACAACCAAGTGAAATGGAAGACACATCTGAAAGTACAGAGCAGCATGTAGAGACAACATGCAGTGACCCTGGAATGGAACAAGAAAGCCCTGGAAAATCCAACAGAAGCTCAAATAATGAAGGACTTCCAGATACATCTGTGACTGCAGCAACATCTGTAAGCTCTACGCACCAGGAGACTGACAGTGATGATGACACTGTTCGAGTCCCATCCAGAACCCAATCACAAAATAGATTAAGTGTCGGAGGACCTTCAGTTAGTACTAGATTAACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CBTC4602.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTT
                                                  Xt7.1-CHK-1008293184                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAATTCT
  5   1   4      seed Bone      in                        CBTC4602.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GATAAATTACAAGGAGAACTGCAGCAGCTCGTATCCAGGAGCTCTTTAGAAGAAGAAAAGAAAGAAAAGAGCTAGAAGAGATGGACATGCAAAATGTACATCAGCCCTCCTCAAAAATAGTGTACAAAGGTCACCGGAATTCACGAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGAC
  5   1   2       ext HeRe      in                     EC2CAA19DD09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAACAATGATTAAAGAGGCTGCATTTTGGGGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATCCCTGATAGGAAAAATTGTTTGGGTG
  3   1   2       ext HeRe      in                     EC2CAA19DD09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCAAAAACTTTGTCATGAGTGGATCTGATTGTGGTCACATCTTCATCTGGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAA
  3   1   4      seed Bone      in                        CBTC4602.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGATCGGCATACAGCAAATCATTTAATGCTTTTAGAAGCTGATAATCATGTGGTAAACTGTCTGCAGCCACACCCATATGACCCAATTTTAGCATCATCTGGAATAGACTACAATATTAAGATATGGTCTCCTCTTGAACAAGACAAATGCTTTAACTGGAGACTTGCTGAAGAGGTGATTTCACGGAATGAGTTAATGCTGGAAGAAACAAGAAACACTATTACAGTCCCAGCATCTTTCATGCTAAGAATGTTGGCTTCACTCAACCATATACGGGCAGATCGAGGAGAAGACCGACCTGAAGGAGCCGGTCAGGATAACTCCAATGAAGATGAATGATTGTACTTCTCTTATGAGGATTTAAGCATATTGCATTATGTAAAAGCAATTTATTATCATTTTCCTAAATGGATTTGGCAAATTTTATTTTATAATATGAAAGTTTTGTATTGTGACTGAATGAAGAGCCTACAAAATATTGCCAGCTTCTACTCAAGATTGAATATATATATATATATCCTGATAGGAAAAATTGTTTGGGTGTGACATGTAAATAAACTCTGGTAACTTATTGTTTTAAATTTAAAATGAAAAAAAAAAAACATTTTTAAATATAGACACATAATAAACTTTGGCATGGCTTTTGGTCAGTGGAATTGACCTTAATTCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)