Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu072l04.3                         27 END     3          10       11                at rich interactive domain 4a (rbp1 like) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABL528.5                             7 END     3          10       42                retinoblastoma-binding protein 1 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012078732 Xt7.1-TTbA001o24.3 - 30 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA001o24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCAATACAGCCCCATAGTTACTCTGTGGCATCTCCACTTGCACTCAGTCATGACGAGTCACACAGCATAAAAAGTGAAAGTGACATAACAATTGAAGTGGATAGTGTGGCAGAAGAATCCCAAGAAGGCCTTTGTGAGAGCGAATCTGCAAATGGATTTGAGGCCAGCACCACTTCAAGCAATTGTAGTGTAACGGCACAGGAAGCAGATATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCACCCAGGGCATACAAATGGACTCTGCAGCTAAGTGAACTGGATAACATGACTGGCACTGAGAAGATAGTCTTCCTCCAAGACAAGCTGCAGGAAATGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCGAAAAAGGTTAAAAAAGAAGGACCGGGAAGTGTCCAATACAGGAGCCTCAATGTCTTCAGGATCATCAGAGACAGGCATGAGCCCTTCTTCTGCTTCTCCCCCACAGAACACTCTTGCTCTGGAGTGCAGGTGATACCTGCCTTCTCCTCCTTTCCAGCAGTCTGCTGCCATGGACACAACTATCCCCCACTATACCACCACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAATAAAAAAAAAAAAAAAAGAAAAACGAAGAGAAGGGTCTAGCTTAGTTCTCTACCAATACAACACAGTAGCTCTTAAAAATGAATGATTTTGTTTTTGTTTTTTTGGCGCTTGGCTCTACAACACTGAACAAGCTATTCTCATATTCCTAAAACTTTGGCAGTCTTTGTACTTACCTCCCTGCAGGAAATTTCTGTCCACTTAACTCTTTCTAAGCCAGTTTCCATGTTACTATACTGCTGAATGATGCTCCTACATGCAGCATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCTCTCCGTGTTTAATATACTGTAGACTAACAAATATGGATTCTCTAGACCAATGTTTTTAACCAGATCCCAACACAGCCTTTGTAATCAGGAAACCCCAGCTTCTCTTATATTCATATATATATATATATCTATAAAAGCACTGCAGTTTAGTAAATCACTGATTGATTGTCATTTATCCCTTTTCTGCCAGAAGGGCAGATGAATGGACCTCGCTTTCTGGCAACGTTGAGGGTAATTTTTAGTCTGCCTGGGGTATGCAGAATCCAGGGGTAAGACTTGCCCCCACCCAC
                                                  Xt7.1-CHK-1008228161                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACAGCCCCATAGTTACTCTGTGGCATCTCCACTTGCACTCAGTCATGACGAGTCACACAGCATAAAAAGTGAAAGTGACATAACAATTGAAGTGGATAGTGTGGCAGAAGAATCCCAAGAAGGCCTTTGTGAGAGCGAATCTGCAAATGGATTTGAGGCCAGCACCACTTCAAGCAATTGTAGTGTAACGGCACAGGAAGCAGATATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCACCCAGGGCATACAAATGGACTCTGCAGCTAAGTGAACTGGATAACATGACTGGCACTGAGAAGATAGTCTTCCTCCAAGACAAGCTGCAGGAAATGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCGAAAAAGGTTAAAAAAGAAGGACCGGGAAGTGTCCAATACAGGAGCCTCAATGTCTTCAGGATCATCAGAGACAGGCATGAGCCCTTCTTCTGCTTCTCCCCCACAGAACACTCTTGCTCTGGAGTGCAGGTGATACCTGCCTTCTCCTCCTTTCCAGCAGTCTGCTGCCATGGACACAACTATCCCCCACTATACCACCACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAATAAAAAAAAAAAAAAAAGAAAAACGAAGAGAAGGGTCTAGCTTAGTTCTCTACCAATACAACACAGTAGCTCTTAAAAATGAATGATTTTGTTTTTGTTTTTTTGGCGCTTGGCTCTACAACACTGAACAAGCTATTCTCATATTCCTAAAACTTTGGCAGTCTTTGTACTTACCTCCCTGCAGGAAATTTCTGTCCACTTAACTCTTTCTAAGCCAGTTTCCATGTTACTATACTGCTGAATGATGCTCCTACATGCAGCATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCTCTCCGTGTTTAATATACTGTAGACTAACAAATATGGATTCTCTAGACCAATGTTTTTAACCAGATCCCAACACAGCCTTTGTAATCAGGAAACCCCAGCTTCTCTTATATTCATATATATATATATATCTATAAAAGCACTGCAGTTTAGTAAATCACTGATTGATTGTCATTTATCCCTTTTCTGCCAGAAGGGCAGATGAATGGACCTCGCTTTCTGGCAACGTTGAGGGTAATTTTTAGTCTGCCTGGGGTATGCAGAATCCAGGGGTAAGACTTGCCCCCACCCACCCTCCA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     3     3     5     7     5     9     6    12    12    12     8    12     8    12     8    12     8    12     6    10     8    10     8    10     8    10    10    12    10    12    11    14    11    14    11    14    12    14    12    14    12    14    12    14    12    14    12    14    12    14    13    15    15    15    15    15    15    15    15    15    14    15    14    15    15    15    14    15    15    15    15    15    15    15    14    15    14    15    15    17    16    17    16    17    16    17    16    17    16    16    16    16    16    16    16    16    15    15    14    15    14    15    14    15    15    15    15    15    14    14    14    14    14    14    14    14    14    14    12    14     9    14     9    14     9    14     9    13     9    13     9    12     5     6     4     4     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -------C----
                                                                       ...PREDICTED - Sp ---- 3e-012     XP_793989.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 6e-013     NP_001026838.1 hypothetical protein LOC327404 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Mm ---- 2e-102     XP_928605.1 PREDICTED: similar to retinoblastoma-binding protein 1 isoform I isoform 9 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-105     NP_002883.3 retinoblastoma-binding protein 1 isoform I [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 3e-110     NP_001012920.1 retinoblastoma-binding protein 1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA001o24.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------ATG------------------------ATG---------------------------------------------------TGA------------------------------------ATG------------------------------TAG------------------------------------------------------TGA------------TGA------TAATGA------------------------------------------------------------------------------------------------------TAA------------------------------------ATG------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAA---TGA------------------------------------------------------TAA---------------------ATG------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------TAA---------------------------------------TGA---------ATG---------------------ATG------------ATG------------TAG------ATG---------------------------------TAA---------------------------TGA------TAA---------------ATG---------TAA---------------------------------------TAG---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------TGAATG---------------------TGA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Gas       in                   TGas130g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGGGGTAATGGAAAAGGTGGAGCAAGACACACAAACCATACACCCACCTACGCTGCCTCCTGCAATACAGCCCCATAGTTACTCTGTGGCATCTCCACTTGCACTCAGTCATGACGAGTCACACAGCATAAAAAGTGAAAGTGACATAACAATTGAAGTGGATAGTGTGGCAGAAGAATCCCAAGAAGGCCTTTGTGAGAGCGAATCTGCAAATGGATTTGAGGCCAGCACCACTTCAAGCAATTGTAGTGTAACGGCACAGGAAGCAGATATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCAC
  5   1   2       bld Ova1      in                        CABE11333.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCAATACAGCCCCATAGTTACTCTGTGGCATCTCCACTTGCACTCAGTCATGACGAGTCACACAGCATAAAAAGTGAAAGTGACATAACAATTGAAGTGGATAGTGTGGCAGAAGAATCCCAAGAAGGCCTTTGTGAGAGCGAATCTGCAAATGGATTTGAGGCCAGCACCACTTCAAGCAATTGTAGTGTAACGGCACAGGAAGCAGACATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCACCCAGGGCATACAAATGGACTCTGCAGCTAAGTGAACTGGATAACATGACTGGCACTGAGAAGATAGTCTTCCTCCAAGACAAGCTGCAGGAAATGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCGAAAAAGGTTAAAAAAGAAGGACCGGGAAGTGTCCAATACAGGAGCCTCAATGTCTTCAGGATCATCAGAGACAGGCATGAGCCCTTCTTCTGCTTCTCCCCCACAGAACACTCTTGCTCTGGAGTGCAGGTGATACCTGCCTTCTCCTCCTTTCCAGCAGTCTGCTGCCATGGACACAACTATCCCCCACTATA
  5   1   2       bld Egg                            TEgg087o05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAGTGAAAGTGACATAACAATTGAAGTGGATAGTGTGGCAGAAGAATCCCAAGAAGGCCTTTGTGAGAGCGAATCTGCAAATGGATTTGAGGCCAGCACCACTTCAAGCAATTGTAGTGTAACGGCACAGGAAGCAGATATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCACCCAGGGCATACAAATGGACTCTGCAGCTAAGTGAACTGGATAACATGACTGGCACTGAGAAGATAGTCTTCCTCCAAGACAAGCTGCAGGAAATGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCG
  5   1   2       bld Sto1      in                        CABG10848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGAGCGAATCTGCAAATGGATTTGAGGCCAGCACCACTTCAAGCAATTGTAGTGTAACGGCACAGGAAGCAGACATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCACCCAGGGCATACAAATGGACTCTGCAGCTAAGTGAACTGGATAACATGACTGGCACTGAGAAGATAGTCTTCCTCCAAGACAAGCTGCAGGAAATGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCGAAAAAGGTTAAAAAAGAAGGACCGGGAAGTGTCCAATACAGGAGCCTCAATGTCTTCAGGATCATCAGAGACAGGCATGAGCCCTTCTTCTGCTTCTCCCCCACAGAACACTCTTGCTCTGGAGTGCAGGTGATACCTGCCTTCTCCTCCTTTCCAGCAGTCTGCTGCCATGGACACAACTATCCCCCACTATACCACCACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTT
  5   1   2       bld Gas7      in                         XZG27391.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATGGATTTGAGGCCAGCACCACTTCAAGCAATTGTAGTGTAACGGCACAGGAAGCAGATATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCACCCAGGGCATACAAATGGACTCTGCAGCTAAGTGAACTGGATAACATGACTGGCACTGAGAAGATAGTCTTCCTCCAAGACAAGCTGCAGGAAATGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCGAAAAAGGTTAAAAAAGAAGGACCGGGAAGTGTCCAATACAGGAGCCTCAATGTCTTCAGGATCATCAGAGACAGGCATGAGCCCTTCTTCTGCTTCTCCCCCACAGAACACTCTTGCTCTGGAGTGCAGGTGATACCTGCCCTCTCCTCCTTTCCA
  5   1   2       bld Lun1      ?                         CABD13776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCAATTGTAGTGTAACGGCACAGGAAGCAGACATAACAGAAAAGGGTCATAAAAGGATAAATGAGAGCCTCAGTGGATCATTAGCAAAGAAACAAAAGCGCACACCAAAGCGAATAAGTACTTCATCTAAAGTTGAAAAGAATGGCATAGGCCAAAGTAGTGACAGTGAAGACCTTTCCACGCTGGATACTTCCAGTAAATGTACTCCTATTAAACACCCGGGTGTGTTGAAACCGCAAAAGATCATAAGATCTCCTGTCAGAATCACCTCCCCTCATAATAAAGATGGCGAAAAGGATAAGCATCGAGAAAAGCACCATCCGCATACATCACCCAGGGCATACAAATGGACTCTGCAGCTAAGTGAACTGGATAACATGACTGGCACTGAGAAGATAGTCTTCCTCCAAGACAAGCTGCAGGAAATGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCGAAAAAGGTTAAAAAAGAAGGACCGGGAAGTGTCCAATACAGGAGCCTCAATGTCTTCAGGATCATCAGAGACAGGCATGAGCCCTTCTTCTGCTTCTCCCCCACAGAACACTCTTGCTCTGGAGTGCAGGTGATACCTGCCTTCTCCTCCTTTCCAGCAGTCTGCTGCCATGGACACAACTATCCCCCACTATACCACCACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCA
  5   1   2       bld Liv1      in                         CAAR4056.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    NGAGGAGAAAATACTACATGTCCTTGAAATCAGAAGTAGCCACAATAGACAGAAAGCGAAAAAGGTTAAAAAAGAAGGACCGGGAAGTGTCCAATACAGGAGCCTCAATGTCTTCAGGATCATCAGAGACAGGCATGAGCCCTTCTTCTGCTTCTCCCCCACAGAACACTCTTGCTCTGGAGTGCAGGTGATACCTGCCTTCTCCTCCTTTCCAGCAGTCTGCTGCCATGGACACAACTATCCCCCACTATACCACCACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTT
  3   1   2       bld Ova1      out                        CABE6958.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATACCACCACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAAT
  3   1   2       bld Brn1      out                         CABL528.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATACCACCACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATT
  3   1   2       bld Gas       in                    TGas130g12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGNTATTATCTTACAACTTGTTAAATATATTTATTCAAACCATTGGATGTTGTATTTTTATGTATTTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1      in                         CAAR4056.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATAGAGCACTCTTACCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAAT
  3   1   2       bld Gas                             TGas120o21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTAAAAAAAAAAAAAAAAAGATAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG27391.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCGGTTTGACATGCCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATTTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAAT
  3   1   2       bld Egg       out                   TEgg063a21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGTTTGACATTGCCAAGTGTTTTTTTTTTTTTGCCATTTTTGAATATTCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCACACCTCTTCATTTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACTTTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTATTTCTATGAATTTTCAGAGTTTTTATTTTGTACAAAAAAAAAA
  3   1   2       bld TbA       out                   TTbA001o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTATAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA       out                   TTbA001p08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGACATTGCCAAGTGTTTTTTTTTTTTTTTGCCATTTTTGAATAATCCTCTGCTGAATTGCATAATGAATTCCCTTTTCACCAGGTCTTTTTTTTTTATTCTTATTAAATAAGATTATTGGAGATAGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGAGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTATAAAAAAAAAAAAAAAAAAGCG
  3   1   2      seed Liv1      in                         CAAR3628.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAAT
  5   1   2       bld Liv1      in                         CAAR3628.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGGAGACTAGCAGTCAGTGGGCCACAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAATAAAAAAAAAAAAAAAAAA
  5  -1   2       bld HdA                            THdA052g01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCCGCAGACCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGAGTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGGAGCCTACTCCTCTTCATTCTATAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTCTTAAAGCTGTAAGCGAGACACAATACATTGTGAAAGGGAGTGCGTAGTTGGCTGAAAACTACATTCAAACAGACGTGTTGCACTTGTACAGGAATGTAGAGCACACGATTATGCAAATATTTTAAATGTCTATCAAAGTTTACA
  5   1   2       bld Egg       in                   TEgg051f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGGGGCCGACTCCAATGAAAAATAAGACTCCTACAAAGGCCCACAGAAAGAAACCTGGAAAATGGACTGCTAGTTAGCACCTACCAACTGCAGCTTTCCGTTCCACCTGGCTGCCTCTCCTCTTCATTCTCTAGCGTCTTCATTTTGGAAGCACTTGCGATCTACAGAACTGCCAAAGTCCAATGTGTTCAGCAGAGTGCCCAGTTTTAAAGCTGTAAGCGAGACAAAATACATTGTGAAAGGGAGTGTGTAGTTGGCTGAAAACTACATTCAAACAGACGTCTTCCACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAATAAAAAAAAA
  3   1   2       bld Tad5      out                        XZT11679.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTCCTCTTCATTTTCAGGGGTCTTCATTTTGGAAGCCCTTGCGATCTCCAGAACTGCCAAAGTCCAATTTGTTCCGCAGAGTGCCCCGTTTTAAAGCTGTAAGCGGGCCAAAATCCCTTTTGAAAGGGAGTGTGTAGTTGGCTGAAAACTCCATTCAAACAGACGTTTTCCCCTTTTTCCCGGAATTTAGGGCCCCCGGTTAGGCAAATATTTTAAATGTTTTTTAATGTTTCCAGGGGAATTGGGAAGGTTTTCAGGGGATTTTCCTCCCCCCTGGCAAAAATATTTGGTCTTTTTTTTTAGGTAATTTTCAGGGTTTTTATTTGGTTCCAAAAAAGGGCAAAAAGAAAATTTTT
  3   1   2       bld Ova1      in                        CABE11333.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACTTTTAACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAATAAAAAAAAAAAAAAAAGAAAAACGAAGAGAAGGGTCTAGCTTAGTTCTCTACCAATACAACACAGTAGCTCTTAAAAATGAATGATTTTGTTTTTGTTTTTTTGGCGCTTGGCTCTACAACACTGAACAAGCTATTCTCATATTCCTAAAACTTTGGCAGTCTTTGTACTTACCTCCCTGCAGGAAATTTCTGTCCACTTAACTCTTTCTAAGCCAGTTTCCATGTTACTATACTGCTGAATGATGCTCCTACATGCAGAATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCAAAAAAAC
  3   1   2       bld Sto1      in                        CABG10848.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CACTTTTTACAGGAATTTAGAGCACACGATTATGCAAATATTTTAAATGTTTATTAATGTTTACAGTGGAATTGTGAATGTTTTCAGTGGACTATCCTACCCCCTGGCAAATATATTTTGTCTTTTTTTCTATGTAATTTTCAGAGTTTTTATTTTGTTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAATAAAAAAAAAAAAAAAAGAAAAACGAAGAGAAGGGTCTAGCTTAGTTCTCTACCAATACAACACAGTAGCTCTTAAAAATGAATGATTTTGTTTTTGTTTTTTTGGCGCTTGGCTCTACAACACTGAACAAGCTATTCTCATATTCCTAAAACTTTGGCAGTCTTTGTACTTACCTCCCTGCAGGAAATTTCTGTCCACTTAACTCTTTCTAAGCCAGTTTCCATGTTACTATACTGCTGAATGATGCTCCTACATGCAGAATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTC
  5   1   2       bld Spl2      in                        CBSS9353.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTACAAAAAAAGACAAAAAGAAAATATATAACAGCAGCAAAGTTATTTAACAAGATTTCTAAAGCTGATTTTTTTTTCCTTCTTTTTTTTTGTGTAAAATAAGGTATTATCTTACAACTTGTTAAATATATTTATTCAAACATTGGATGTTGTATTTTTATGTATTTTTTAAAATATTAATAAAAAAAAAAAAAAAAGAAAAACGAAGAGAAGGGTCTAGCTTAGTTCTCTACCAATACAACACAGTAGCTCTTAAAAATGAATGATTTTGTTTTTGTTTTTTTGGCGCTTGGCTCTACAACACTGAACAAGCTATTCTCATATTCCTAAAACTTTGGCAGTCTTTGTACTTACCTCCCTGCAGGAAATTTCTGTCCACTTAACTCTTTCTAAGCCAGTTTCCATGTTACTATACTGCTGAATGATGCTCCTACATGCAGCATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCTCTCCGTGTTTAATATACTGTAGACTAACAAATATGGATTCTCTAGACCAATGTTTTTAACCAGATCCCAACACAGCCTTTGTAATCAGGAAACCCCAGCTTCTCTTATATTCATATATATATATATATCTATAANAGCACTGCAGTT
  5  -1   2       bld Kid1      in                         CABA6886.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTTTTTTTTGGCGCTTGGCTCTACAACACTGAACAAGCTATTCTCATATTCCTAAAACTTTGGCAGTCTTTGTACTTACCTCCCTGCAGGAAATTTCTGTCCACTTAACTCTTTCTAAGCCAGTTTCCATGTTACTATACTGCTGAATGATGCTCCTACATGCAGCATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCTCTCCGTGTTTAATATACTGTAGACTAACAAATATGGATTCTCTAGACCAATGTTTTTAACCAGATCCCAACACAGCCTTTGTAATCAGGAAACCCCAGCTTCTCTTATATTCATATATATATATATATCTATAAAAGCACTGCAGTTTAGTAAATCACTGATTGATTGTCATTTATCCCTTTTCTGCCAGAAGGGCAGATGAATGGACCTCGCTTTCTGGCAACGTTGAGGGTAATTTTTAGTCTGCCTGGGGTATGCAGAATCCAGGGGTAAGACTTGCCCCCACCCACCCAT
  3  -1   2       bld Kid1      in                         CABA6886.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCGCTTGGCTCTACAACACTGAACAAGCTATTCTCATATTCCTAAAACTTTGGCAGTCTTTGTACTTACCTCCCTGCAGGAAATTTCTGTCCACTTAACTCTTTCTAAGCCAGTTTCCATGTTACTATACTGCTGAATGATGCTCCTACATGCAGCATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCTCTCCGTGTTTAATATACTGTAGACTAACAAATATGGATTCTCTAGACCAATGTTTTTAACCAGATCCCAACACAGCCTTTGTAATCAGGAAACCCCAGCTTCTCTTATATTCATATATATATATATATCTATAAAAGCACTGCAGTTTAGTAAATCACTGATTGATTGTCATTTATCCCTTTTCTGCCAGAAGGGCAGATGAATGGACCTCGCTTTCTGGCAACGTTGAGGGTAATTTTTAGTCTGCCTGGGGTATGCAGAATCCAGGGGTAAGACTTGCCCCCACCCACCCAT
  3   1   2       bld Spl2      in                        CBSS9353.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTGAATGATGCTCCTACATGCAGCATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTTGCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCTCTCCGTGTTTAATATACTGTAGACTAACAAATATGGATTCTCTAGACCAATGTTTTTAACCAGATCCCAACACAGCCTTTGTAATCAGGAAACCCCAGCTTCTCTTATATTCATATATATATATATATCTATAAAAGCACTGCAGTTTAGTAAATCACTGATTGATTGTCATTTATCCCTTTTCTGCCAGAAGGGCAGATGAATGGACCTCGCTTTCTGGCAACGTTGAGGGTAATTTTTAGTCTGCCTGGGGTATGCAGAATCCAGGGGTAAGACTTGCCCCCACCCACCCATCCATATCTGTATATCAGAATGAGTTTACAAGAGCTGATAGTTAAGAGTTAAACACTAGCGAGGGGTAGCATTACTAAACAAATCAATGTATTTTATTTTGCCGCATTGTTAACTTGTAAGTCAAATTCCTTTTTCAGCACAGAGTATTTAACCCCTTGGCTGCCAAAAGGGGTTAAAGAAAAAGTACTCCTGTAAAATGCACTTTTTCTGTCTTTCTTAAGCAACGCAGAGTTGTGTATGTATAGAGCGCTCAGCTAAGAGCATTAATAAAGGCAATGGTTTCAAGC
  3   1   2       bld Egg       in                    TEgg051f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATGCAGCATTACAGTAATGCACCTATGTATGTGAAGGCTATGGGTGCCCCCCCATAGGCACAAATGACATTTTTTGTAAATAATCCTGAAGTCTGTATTTAAAAGATTTTTCATATACATGTACAAAAGTGATTTTTTTAAAAGCAATTTTTACTCATGTTTGTACATTAAAAATGGGGTTTTACCCTTCTCTCCGTGTTTAATATACTGTAGACTAACAAATATGGATTCTCTAGACCAATGTTTTTAACCAGATCCCAACACAGCCTTTGTAATCAGGAAACCCCAGCTTCTCTTATATTCATATATATATATATATCTATAAAAGCACTGCAGTTTAGTAAATCACTGATTGATTGTCATTTATCCCTTTTCTGCCAGAAGGGCAGATGAATGGACCTCGCTTTCTGGCAACGTTGAGGGTAATTTTTAGTCTGCCTGGGGTATGCAGAATCCAGGGGTAAGACTTGCCCCCACCCACCCTCCATATCTGTATATCAGAATGAGTTTACAAGAGCTGATAGTTAAGAGTTAAACACTAGCGAGGGGTAGCATTACTAAACAAATCAATGTATTTTATTTTGCCGCATTGTTAACTTGTAAGTCAAATTCCTTTTTCAGCACAGAGTATTTAACCCCTTGGCTGCCAAAAGGGGTTAAAGAAAAAGTACTCCTGTAAAATGCACTTTTTCTGTCTTTCTTAAGCAACGCAGAGTTGTGTATGTATAGAGCGCTCAGCTAAGAGCATTAATAAAGGCAATGGTTTCAAGTAGCTTGATTTCTACTAGTCATTGTTTTTTTTCCTCTCTTGACTGAACATCGCCAATCACTTTTATTCAAGTGTGCTTGTATTGCACTGGAACAGGACACTGAACGGTAAATCTGCTTAATTAAATGCAATGTTGACAAAAAAAAAAAAAAAAAA
  3   1   0       add BrSp      in                    EC0CBA005DB11.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGCAAAAGGGGTTAAAAAAAAAGTACTCCTGTAAAATGCCCTTTTTCTGTCTTTTTTAAACAACCCAAAGTTGTGTATGTATAAAGCGCTCAGCTAAAAGCCTTAATAAAGGCCATGGTTTCCAGTTAAAAAAAAAAAAAAAAAAAA
  5   1   0       add BrSp      in                    EC0CBA005DB11.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGCAAAAGGGGTTAAAGAAAAAGTACTCCTGTAAAATGCACTTTTTCTGTCTTTCTTAAGCAACGCAGAGTTGTGTATGTATAGAGCGCTCAGCTAAGAGCATTAATAAAGGCAATGGTTTCAAGTAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)