Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas113i05.3                         41 END     13         35       31                (no blast hit)
     2   2.0    0Xt7.1-CAAK11077.3                          32 END     3           8        9                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012078855 Xt7.1-CABK3208.3.5 - 37 ESTs
                                                                       -590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CABK3208.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTGAGCAGTGTGCGAATTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCAGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTG
                                                  Xt7.1-CHK-1008227127                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTGTGCGAATTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCAGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATAxxxAxxxxxxxxATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAxxxxxxAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACxxxxxGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTGCTTAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     4     7     8     8     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    13    12    13    12    13    12    13    12    13    12    13    12    14    12    14    12    14    12    14    12    14    12    14    13    15    13    15    13    15    13    15    13    15    15    15    15    15    14    15    14    15    14    15    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13     5    13     5    13     5    13     5    13     6    14     6    14     6    14     8    16     8    16     8    16     8    16     8    16     8    16     9    17     9    16    11    17     8    18     9    18     9    17     9    17     8    16     7    14     6    13     6    14     6    14     7    14     7    14     8    14     8    14     8    13     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     4     9     4     9     4     8     4     8     4     9     4     9     4    10     4     9     4     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     6    10     6    11     6     9     6     9     6     9     6     9     6     9     6     9     7    10     8    11     8    11     8    10     7     8     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9    10    10     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     7     7     7     7     7     6     7     5     6     5     6     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
  5   1   2  SIG                                    Xt7.1-TTbA065p11.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGATGTGCTGAAGGTTTGTGAGCAGTGTGCGAGTTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABK3208.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAGGATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTGCTTAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGCTTAACTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------T-T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------T
                                               BLH ATG     370    1172                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN     370     189                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR     370     604                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG     370      19                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-011     NP_001022326.1 T08H4.3 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bb ---- 7e-020     BAE46385.1 Ets1/2 [Branchiostoma belcheri] -------------------=======================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 3e-033     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 2e-039     BAE06419.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sp ---- 3e-066     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 5e-143     NP_001017558.1 v-ets erythroblastosis virus E26 oncogene homolog 1 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_035938.2 E26 avian leukemia oncogene 1, 5' domain isoform 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 0          XP_001231221.1 PREDICTED: hypothetical protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_005229.1 v-ets erythroblastosis virus E26 oncogene homolog 1; Avian erythroblastosisvirus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1;v-ets erythroblastosis virus [Homo sapiens]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAH75161.1 C-ets-1b protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          NP_001081621.1 c-ets-1b proto-oncogene [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK3208.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------ATG---------------------------TAG------------------------------------------------TAG------------------------------------TGAATG---------------------------------------TAA------------------------------------------TAA------------------------------------------------------------------------------------------------------------TAGTAA---------------ATG------------------------------TGA------------------TAA------------------------------------ATG---------------------------------------------------------TAATGA------------------------------------ATG---------TGA---------------------------------TAA------TGA---------TAA---------------------ATGTAG------------------------------------------------------------------------------------TAGTAGTAA---------------------ATG------------------TGA---------------------------------------------------TGA---------------------TGA------------------------------------------------TAA---------ATG---------------TAA---------------------------------------------------------------------------------TGA------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   2  SIG                                    Xt7.1-TTbA065p11.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGATGTGCTGAAGGTTTGTGAGCAGTGTGCGAGTTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008291774                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCTGAAGGTTTGTGAGCAGTGTGCGAGTTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGxGxxxxGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAAA
  0   1   1           Egg  FL                     TEgg058a01.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGCCGATGTGCTGAAGGTTTGTGAGCAGTGTGCGAGTTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCACTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAAAAAAAAAAAAAA
  5   1   4      seed Egg  FL   in                   TEgg058a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCGATGTGCTGAAGGTTTGTGAGCAGTGTGCGAGTTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCACTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAAATTACTCTG
  5   1   2       ext Gas8 5g3  in                          st11n09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTTTGTGAGCAGTGTGCGAGTTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCAGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAACTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCT
  5   1   3   10   nb Thy1 5g3  out                       CBST9929.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGAAGGCGGCTCACTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCANAACAGTATCAAACTAGTGAAATAACCCCAGCATACTCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCGGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGAACCTGCATCCCATCAGCTC
  5   1   3        nb TbA  5g3  out                  TTbA065p11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGCGGCTCAGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGANATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTT
  5   1   3        nb TbA  5g3  out                  TTbA065p12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGCGGCTCAGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTAC
  5   1   3        nb Egg  5g                        TEgg086k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCG
  5   1   2       add Spl2      in                        CBSS6717.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTATATTAATGGTAATTAATTAATTGATTCCCTTAAATATAAAATCGACATTCCCCACACTTTGGGAACATGTGCCATAAAGATTCCATTACTGTCTGAGATGCCTTAAATTGACTGTATTTATTTAACTCTTTTTAAAAAAAAAAAATCACTGTGCACAGGTGCTTAAATTTTACAATTCTAATACTAATTTTCCATTTGTTCTGGTTAGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGGTAATGTTTTAATTACTCTCTATGCACTGGTGCCCTTTAGGTGCTTCTATACATTCTTAAACTGGATTGTGTCACAAGGTTCCATGGCAACATCAAGGCTGAAACAATTATTTTTTGTTAGCGGCCTTTCATTACATGGGAACGTATGGTTTATTTTTATTTTTTTTGTGCCTATAAGCTAATTCCTTTCTTTTATATATTTTTGGCTGAGAACACTGTCTCATACATGTAGTTCTTTCCTTTATAAAATGCCCCTTCTGTTTACTCCATACTACATTAAC
  3   1   2       add Spl2      in                        CBSS6717.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCATAAAGATTCCATTACTGTCTGAGATGCCTTAAATTGACTGTATTTATTTAACTCTTTTTAAAAAAAAAAAATCACTGTGCACAGGTGCTTAAATTTTACAATTCTAATACTAATTTTCCATTTGTTCTGGTTAGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGGTAATGTTTTAATTACTCTCTATGCACTGGTGCCCTTTAGGTGCTTCTATACATTCTTAAACTGGATTGTGTCACAAGGTTCCATGGCAACATCAAGGCTGAAACAATTATTTTTTGTTAGCGGCCTTTCATTACATGGGAACGTATGGTTTATTTTTATTTTTTTTGTGCCTATAAGCTAATTCCTTTCTTTTATATATTTTTGGCTGAGAACACTGTCTCATACATGTAGTTCTTTCCTTTATAAAATGCCCCTTCTGTTTACTCCATACTACATTAAAGGAACAGTATACCTTCTTGATCAACACAAGCTGAATGAATAGGGCTTGGGTTGAACATACTTTTCCCTATTGTT
  5   1   2       ext Gas7      out                        XZG50743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGGAA
  3  -1   2       add Spl1      in                         CABK3612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTTATATATATATATGGAACACACAGGCAGCATAGAGCAGGCTAAGTGTTCCATATATATATATAAAATAAAAAATTGAAAAAAAGTGTAACAGATGGCACTCCAACAAAGCAAATGTGTTTAGAACTTTTTTTGTTTATTGAGATCTCTGCACACAACGTTTTGGGGGATTCTTTCTCAGGTACTCTCTtgccatactctgcctgcctttccctgcctgtgtgtgccatacacataggcagcttagggcaggcagtacatacagtgacacaatgctgtcactgctcctacagtctgtctgaggtgtgaacaggcgatcagtgtgggggcttacagttggagccAGTTGGACAGCACTGGCCTAAAGAATACTCTGCTAATGGCAGCTTATTTTCTGTCTAGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTG
  5  -1   2       add Spl1      in                         CABK3612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   cagtgacacaatgctgtcactgctcctacagtctgtctgaggtgtgaacaggcgatcagtgtgggggctACAGTTGGGAGCCAGTTGGACAGCACTGGCCTAAAGAATACTCTGCTAATGGCAGCTTATTTTCTGTCTAGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAACCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAA
  3   1   4      seed Egg  FL   in                    TEgg058a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas8 5g3  in                          st11n09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTCATAAAACCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTG
  5   1   2  SIG                                      Xt7.1-CABK3208.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAGGATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTGCTTAA
                                                  Xt7.1-CHK-1008291776                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTT
  5   1   4      seed Gas  5g3  in                   TGas141h23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGCTGAAGGTTTGTGAGCAGTGTGCGAATTTCGCTGGGCTCCCATTCGCTCTACACAAAGTCAGCCCCCGGCTGCTGTCACAGCTCCAGCCCACCCCTCCCTCATCCCAGCTCCTCTCACAGGCGGCACAGACTCAAGCTCAGAAATAACAAAAGCCCGGCAAGAAGGCGGCTCAGCTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGGGGAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACCAAGTGAGGAGTGGGTCTCGTGGGCAGTGAATGATTTACTC
  5   1   3        nb TbA  5g3  out                  TTbA043g03.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAGAAGGCGGCTCACTCCTCTGCTCAGAACGATTGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAATGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACGGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTATGGATACCCATTGATCCCCGAGAATGGACAGACACTCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTACAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGANATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACT
  5   1   3   14   nb Brn2 5g3  out                       CAAJ17002.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACTCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGNAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTC
  3  -1   2       add Spl1      in                         CABK3432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTATAGGGCGAGAGGCGGAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGA
  3  -1   2       ext Spl1      in                         CABK3208.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGAAACACCACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTGGGTGGGCAGGAATCATTTGAAAGTATTGAG
  5   1   3   22   nb Gas7 PIPE                            XZG28466.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTC
  5   1   2       ext Tad5      out                        XZT55817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGNGCTGCGCTATTATTATGACAAANATATAATTCACAAAACAGCAGGAAAGCGATATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTA
  3   1   4      seed Gas  5g3  in                    TGas141h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGCAATTTAGTAGATGGAAGTTGGCCCTGAAAAAAAAAAAAAAAAA
  5   1   3        nb HeRe                             EC2CAA31CC12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACG
  5  -1   2       add Spl1      in                         CABK3432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCNTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAAT
  5   1   2       ext TbA       in                   TTbA067n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAAACAGGAGGTAGTGTCTCCAGAACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAACCACGACAGCTGTGACCGCCTCCCTCCGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGAT
  5  -1   2       ext Spl1      in                         CABK3208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAAACGCG
  5   1   2       ext Gas7      out                        XZG35012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCT
  5   1   3        nb Neu       out                  TNeu134m06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGAAGTTGAGCTTTGGGCTGCGCTATTATTATGACAAACGGTAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAGATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTGTGACAGATTACAAAAAG
  5   1   2       ext Neu       in                   TNeu102p19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTGCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGT
  5   1   3        nb Tad5      out                         XZT5454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGA
  5   1   3        nb Ski1      out                        CABJ9284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGA
  3   1   2       ext TbA       in                    TTbA067n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTTACAGATAAAAAAAAAAAAAAAAAGCGCC
  3   1   2       ext Neu       in                    TNeu102p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Spl1      out                        CABK3940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACTCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTTCCAGGAGTGCAGAACAC
  5   1   2       ext Brn2      out                       CAAJ17065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCNATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCCAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCGGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGT
  5   1   2       ext Gas7      out                        XZG51358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTGCTTAAACCTTCAGGGATGAAATGTGCAATGAAAGCAGCAAATGTTTCATAAGCTGGCCACTTCAAATGAGTTCA
  5   1   3        nb Neu       out                  TNeu080l04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCT
  5   1   3        nb Gas       out                  TGas113i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTGCTTAACCTTCAGGGATGAATGTGCAATGAAAGCAGCAAATGTTTCATAAGCTGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)