Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 30 Oct 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas113i05.3                         41 END     13         35       31                (no blast hit)
     2   2.0    0Xt7.1-CAAK11077.3                          32 END     3           8        9                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012078855 Xt7.1-CABK3208.3.5 - 37 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     4     7     8     8     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    13    12    13    12    13    12    13    12    13    12    13    12    14    12    14    12    14    12    14    12    14    12    14    13    15    13    15    13    15    13    15    13    15    15    15    15    15    14    15    14    15    14    15    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13     5    13     5    13     5    13     5    13     6    14     6    14     6    14     8    16     8    16     8    16     8    16     8    16     8    16     9    17     9    16    11    17     8    18     9    18     9    17     9    17     8    16     7    14     6    13     6    14     6    14     7    14     7    14     8    14     8    14     8    13     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    11     6    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     5    10     4     9     4     9     4     8     4     8     4     9     4     9     4    10     4     9     4     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     5     9     6    10     6    11     6     9     6     9     6     9     6     9     6     9     6     9     7    10     8    11     8    11     8    10     7     8     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9    10    10     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     7     7     7     7     7     6     7     5     6     5     6     5     6     5     6     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     4     4     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTGCTTAACTA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------T-T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----------T
                                               BLH ATG     370    1172                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH MIN     370     189                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               BLH OVR     370     604                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                               ORF LNG     370      19                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Ce ---- 2e-011     NP_001022326.1 T08H4.3 [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Bb ---- 7e-020     BAE46385.1 Ets1/2 [Branchiostoma belcheri] -------------------=======================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dm ---- 3e-033     NP_732858.1 pointed CG17077-PC [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Ci ---- 2e-039     BAE06419.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sp ---- 3e-066     NP_999698.1 ets homolog [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 5e-143     NP_001017558.1 v-ets erythroblastosis virus E26 oncogene homolog 1 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 0          NP_035938.2 E26 avian leukemia oncogene 1, 5' domain isoform 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 0          XP_001231221.1 PREDICTED: hypothetical protein [Gallus gallus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 0          NP_005229.1 v-ets erythroblastosis virus E26 oncogene homolog 1; Avian erythroblastosisvirus E26 (v-ets) oncogene homolog-1; v-ets avian erythroblastosis virus E2oncogene homolog 1; v-ets avian erythroblastosis virus E26 oncogene homolog 1;v-ets erythroblastosis virus [Homo sapiens]  ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 0          AAH75161.1 C-ets-1b protein [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          NP_001081621.1 c-ets-1b proto-oncogene [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CABK3208.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------ATGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------ATG---------------------------TAG------------------------------------------------TAG------------------------------------TGAATG---------------------------------------TAA------------------------------------------TAA------------------------------------------------------------------------------------------------------------TAGTAA---------------ATG------------------------------TGA------------------TAA------------------------------------ATG---------------------------------------------------------TAATGA------------------------------------ATG---------TGA---------------------------------TAA------TGA---------TAA---------------------ATGTAG------------------------------------------------------------------------------------TAGTAGTAA---------------------ATG------------------TGA---------------------------------------------------TGA---------------------TGA------------------------------------------------TAA---------ATG---------------TAA---------------------------------------------------------------------------------TGA------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                 ...
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                         ...
  5   1   3   10   nb Thy1 5g3  out                       CBST9929.fwd ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CAAGAAGGCGGCTCACTCCCTGCTCAGAAGGATCGCGGAAGGGAAGGAGTGTAAGCGAAAGGAGAAGGAAAGTGGGACAACACACACCGCTCTATTTGGAAGGAGAAATCATCGTGCGATTTGAGAGTGCGCCGGGCTCTATTGTGTCTGTGCATCTGTGTGTGAGGAGAGCCGCCTTCTCTTGCTAAGGACTCCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCANAACAGTATCAAACTAGTGAAATAACCCCAGCATACTCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCGGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGAACCTGCATCCCATCAGCTC
  5   1   3        nb Egg  5g                        TEgg086k16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCG
  5   1   2       add Spl2      in                        CBSS6717.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTCTATATTAATGGTAATTAATTAATTGATTCCCTTAAATATAAAATCGACATTCCCCACACTTTGGGAACATGTGCCATAAAGATTCCATTACTGTCTGAGATGCCTTAAATTGACTGTATTTATTTAACTCTTTTTAAAAAAAAAAAATCACTGTGCACAGGTGCTTAAATTTTACAATTCTAATACTAATTTTCCATTTGTTCTGGTTAGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGGTAATGTTTTAATTACTCTCTATGCACTGGTGCCCTTTAGGTGCTTCTATACATTCTTAAACTGGATTGTGTCACAAGGTTCCATGGCAACATCAAGGCTGAAACAATTATTTTTTGTTAGCGGCCTTTCATTACATGGGAACGTATGGTTTATTTTTATTTTTTTTGTGCCTATAAGCTAATTCCTTTCTTTTATATATTTTTGGCTGAGAACACTGTCTCATACATGTAGTTCTTTCCTTTATAAAATGCCCCTTCTGTTTACTCCATACTACATTAAC
  3   1   2       add Spl2      in                        CBSS6717.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCCATAAAGATTCCATTACTGTCTGAGATGCCTTAAATTGACTGTATTTATTTAACTCTTTTTAAAAAAAAAAAATCACTGTGCACAGGTGCTTAAATTTTACAATTCTAATACTAATTTTCCATTTGTTCTGGTTAGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGGTAATGTTTTAATTACTCTCTATGCACTGGTGCCCTTTAGGTGCTTCTATACATTCTTAAACTGGATTGTGTCACAAGGTTCCATGGCAACATCAAGGCTGAAACAATTATTTTTTGTTAGCGGCCTTTCATTACATGGGAACGTATGGTTTATTTTTATTTTTTTTGTGCCTATAAGCTAATTCCTTTCTTTTATATATTTTTGGCTGAGAACACTGTCTCATACATGTAGTTCTTTCCTTTATAAAATGCCCCTTCTGTTTACTCCATACTACATTAAAGGAACAGTATACCTTCTTGATCAACACAAGCTGAATGAATAGGGCTTGGGTTGAACATACTTTTCCCTATTGTT
  5   1   2       ext Gas7      out                        XZG50743.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGGAA
  3  -1   2       add Spl1      in                         CABK3612.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTTATATATATATATGGAACACACAGGCAGCATAGAGCAGGCTAAGTGTTCCATATATATATATAAAATAAAAAATTGAAAAAAAGTGTAACAGATGGCACTCCAACAAAGCAAATGTGTTTAGAACTTTTTTTGTTTATTGAGATCTCTGCACACAACGTTTTGGGGGATTCTTTCTCAGGTACTCTCTtgccatactctgcctgcctttccctgcctgtgtgtgccatacacataggcagcttagggcaggcagtacatacagtgacacaatgctgtcactgctcctacagtctgtctgaggtgtgaacaggcgatcagtgtgggggcttacagttggagccAGTTGGACAGCACTGGCCTAAAGAATACTCTGCTAATGGCAGCTTATTTTCTGTCTAGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTG
  5  -1   2       add Spl1      in                         CABK3612.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   cagtgacacaatgctgtcactgctcctacagtctgtctgaggtgtgaacaggcgatcagtgtgggggctACAGTTGGGAGCCAGTTGGACAGCACTGGCCTAAAGAATACTCTGCTAATGGCAGCTTATTTTCTGTCTAGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAACCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAA
  3   1   4      seed Egg  FL   in                    TEgg058a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAATAAAAAAAAAAAAAAAAAA
  3   1   2       ext Gas8 5g3  in                          st11n09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTCATAAAACCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTG
  5   1   3   22   nb Gas7 PIPE                            XZG28466.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCAGCTGAAGGCACTGGCAAGTCAGCCATGAAAGCTGCGCTAGACCTTAAACCGACATTAATCATCAAAACAGAGAAAGAGTATGACGCCTATTCGTGCTCTGATATGGAATGTGCAGATGTTCCCCTGCTGACTCCCAGTAGTAAAGAGATGATGTCTCAAGCTCTTCGTGCCACTTTTAGTGGTTTTACCAAGGAACAACAACGTTTAGGGATACCCATTGATCCCCGAGAATGGACAGACACGCAAGTGAGGGAGTGGGTCTCGTGGGCAGTGAATGAATTTACTCTGAAAGGAGTGGACTTTCAGAAGTTCTGTATGAGCGGAGCAGCATTATGTGGCCTGGGGAAGGAATGTTTTCTAGAATTGGCGCCCGACTTTGTGGGAGATATCTTGTGGGAGCACTTGGAGATCTTACAGAAAGAAGACTCAAAACAGTATCAAACTAGTGAAATAACCCCAGCATACCCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTC
  5   1   2       ext Tad5      out                        XZT55817.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGAATCCAGATACACTTCAGACTACTTCATCAGCTATGGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGNGCTGCGCTATTATTATGACAAANATATAATTCACAAAACAGCAGGAAAGCGATATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTA
  3   1   4      seed Gas  5g3  in                    TGas141h23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGCAATTTAGTAGATGGAAGTTGGCCCTGAAAAAAAAAAAAAAAAA
  5   1   3        nb HeRe                             EC2CAA31CC12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGAATTGAACATGCACAGTGTGTTCCGCCCTCTGAATTCTCTGAACCCAGCTTCATCACAGAGTCATACCAGACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCCTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACG
  5  -1   2       add Spl1      in                         CABK3432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GACCCTGCATCCCATCAGCTCAGAAGAACTCTTGTCTTTGAAATATGAGAATGACTACCCTTTAGCATTGCTGCGTGACCCCCTGCAGCNTGAATCTCAGGGCGACTACTTCACCATTAAACAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGTATGAAGTGGCTTTCTGCTGAGGCTATTTCTCCATACTAAATCTGAAAATCTTGTGCTCATGGGTGTGCATTAGATGTTTTCTCCTAGCATGCACAGGAATTATAGAGAACAACATGTGATTTACGGATCTATGTAAACAGAATTGTGTTGCTACTGTTGCAGCTTCAACAAACTTGTCACTAGTTGTTGCTTAACTACAGCTTTCATAAAGCCAGTTCAAATGCAGATAAATAAAATCTGATGCCTAGCACATTATCCTTCTTCTCTTAAAGCAGAGTAAGATATATAATGTGCTGTTTTGTTGCACCCATTGCCTCCCACTCAGTAGAGTAATTGTGGTAGCTTTTGCAGTTTGTCAAATTGGGTCATGATCTCTCAGCCTGATAAAACCTAAGTTGCTGCAGTGTAGACTTCAAACACTGCTTTAGGTTTTCCGCCTTTCTCCTTTTACACTTTTTCTGTCTAAT
  5   1   2       ext TbA       in                   TTbA067n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAAACAGGAGGTAGTGTCTCCAGAACAACATGTGCCTGGGACGCATCAGTCGTGGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAACCACGACAGCTGTGACCGCCTCCCTCCGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGAT
  5  -1   2       ext Spl1      in                         CABK3208.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGAGGTAGTGTCTCCAGACAACATGTGCCTGGGACGCATCAGTCGTGAAAACTTGGTGGGCAGGAATCATTTGAAAGTATTGAGAGCCACGACAGCTGTGACCGCCTCACTCAGTCCTGGAGCAGCCAGTCCTCATACAACAGCCTTCAACGTGTGCCATCTTATGACAGCTTTGATTCTGAGGACTACCCACCTGCATTGCCGAGCCATAAATCCAAAGGCACTTTTAAAGACTATGTAAGGGACAGAGCTGAGCTCAACAAAGACAAACCTGTCATTCCTGCTGCTGCTCTAGCTGGCTACACAGGAAGTGGACCAATCCAGCTGTGGCAGTTTCTCCTGGAGTTACTGACAGACAAATCGTGCCAGTCCTTTATCAGCTGGACAGGGGACGGCTGGGAATTTAAGCTCTCTGATCCAGATGAGGTTGCAAGACGCTGGGGTAAGAGGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAAACGCG
  5   1   2       ext Gas7      out                        XZG35012.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGAAAAACAAGCCTAAAATGAACTATGAGAAGTTGAGCCGTGGGCTGCGCTATTATTATGACAAAAATATAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCT
  5   1   3        nb Neu       out                  TNeu134m06.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGAAGTTGAGCTTTGGGCTGCGCTATTATTATGACAAACGGTAATTCACAAAACAGCAGGAAAGCGCTATGTCTACCGTTTTGTCTGCGACTTACAAAGTCTTCTGGGATATGTGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAGATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTGTGACAGATTACAAAAAG
  5   1   2       ext Neu       in                   TNeu102p19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGCCTGAGGAACTACACGCCATGCTTGATGTTAAACCAGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTGCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGT
  5   1   3        nb Tad5      out                         XZT5454.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACAATGATGAATAGAATTTAGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGA
  5   1   3        nb Ski1      out                        CABJ9284.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTAGATGGAAGTTTGGACCATAGAAAAAAAAAGACAAACACCTAGAACCCAAGCTCCAATCTTGGCGCCACTTTTCACTCCTGAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGA
  3   1   2       ext TbA       in                    TTbA067n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAATGCGCAAAGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTTACAGATAAAAAAAAAAAAAAAAAGCGCC
  3   1   2       ext Neu       in                    TNeu102p19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGTTGATGTGAAGCTTTCGGGGGGACAAAGGATATAACTGGGAAACGGACACGGCTTCCTTCATGAGTGGGCCTTGGGATAATGTTTGAAGTTGGTTACTCTGCGTTACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACCCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAAAAAAAAAAAAAAA
  5   1   2       ext Spl1      out                        CABK3940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TACCACTGCCAAGGAAAAGCCTGGGCCTTTCCGTACTCTACTTTTTATGCAGAACAGGAAGGAGAGCAATTTGATTGCTTACTTTAGTAACCATTTTATTTCCAGATGTTGTGCCAGTATTTCATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCAGCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTTCCAGGAGTGCAGAACAC
  5   1   2       ext Brn2      out                       CAAJ17065.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CATATATATTTTTTTCTGAAATAATGCATTTTTCGCTTAAGTTCTTGTTTTATGTGTAGCCNATCTTTTTTCAACAGATGCAAACAGATACCAATTGTCTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCCAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCGGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGT
  5   1   2       ext Gas7      out                        XZG51358.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTGACAGATTACAAAAAGGAGGAAGTGTGTTACGAAAACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTGCTTAAACCTTCAGGGATGAAATGTGCAATGAAAGCAGCAAATGTTTCATAAGCTGGCCACTTCAAATGAGTTCA
  5   1   3        nb Neu       out                  TNeu080l04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AACTAATGAAAAGCACACAAAGATTTCATAGGTCCAACAGCAGCTATGAAGATTTTATGACTTCATTTTGCGGAGCCATATCGCTGGAACAATTAATCAGCTTGATTCAAGCAGTAACTGAGCATAGTTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCT
  5   1   3        nb Gas       out                  TGas113i05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTGGCACTGATGTAGATATATAGATGGGTTAAGTGTTCTTCTGTGTCCACGTGGCTGAAGAGATTTTTAGAAGAGCTTCAGCTCTGTCCAGGACACAAATAGTAGTAACCAAATATATTCCTTCTCTGCATGTACCTTCAACTGCTATTTTGAGGGAAACATCTTCAGAACATACTCTCCTCCTTACTTAATTGCAGTGTTTGCTGAGCCACACCTAAATGGTTGCGCTGAAGTCCCGTCCACCATGTTAAAACATTCCCAGAATGTATTTTTTACAGATAAGAGAATTTTATGTGTGTATATATTTTATAAGAAACTTTTTATGAAAAGGTTGTACAGATATATTGTCAGTTGTATGTGTTCTTTTTTTCACATAAGTGCCAAAGAGGAAGTTGATTTACATGAAAACAGGATGGGCAGCCATCGCCTTTCCAGGAGTTGCAGAACACGGATCCCAAACTTTACTTCTCTACTGCTCAGGTAGTGGGTGGTGCGGGAATTGTGGTTGTGCCGGAGCTGGCATGCATAGAGCAATCCAAACCTGAGCTAGGACAATCTTAAAACAGTTGCTTAACCTTCAGGGATGAATGTGCAATGAAAGCAGCAAATGTTTCATAAGCTGG

In case of problems mail me! (