Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 26 Jul 2021 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAO8098.5                            7 END     5          23       83                Unknown (protein for MGC:121722) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012078896 Xt7.1-XZT56379.3 - 21 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     4     3     4     3     4     4     4     4     4     4     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     8     8     9    10     9    10     9    10    10    10     9    10    11    12    11    12    11    12    11    12    11    12    11    12    12    13    11    12    11    12    11    12    11    12    11    12    11    12    12    12    12    12    11    12    11    12    11    12    11    12    11    11    11    11    11    11    10    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    12    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    12    12    12    12    12    12    12    12    12    11    12    12    12    12    12    12    12    12    12    10    10    10    10     9     9     8     8     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN -== Br ==== 4e-008     ABD62780.1 Rx homeobox protein [Branchiostoma lanceolatum] =========================================================================================================
                                                                                                                                                                                                  PROTEIN --- Cs ---- 5e-021     BAB68342.1 Cs-LHX3 [Ciona savignyi] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 1e-024     BAB91364.1 LIM homeodomain protein [Branchiostoma belcheri] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                          PROTEIN --- Ci ---- 2e-028     BAE06535.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================
                                                                                         PROTEIN --- Ce ---- 1e-028     NP_492696.1 abnormal cell LINeage LIN-11, lin-11 protein (45.8 kD) (lin-11) [Caenorhabditiselegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 9e-032     NP_572505.1 CG11354-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                             PROTEIN --- Bf ---- 6e-050     ABD59002.1 LIM-homeodomain protein AmphiLim1/5 [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                    PROTEIN --- Sp ---- 8e-050     NP_999810.1 Lim homeodomain transcription factor 1 [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Dr ---- 4e-118     NP_571291.1 LIM homeobox protein 1 [Danio rerio] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN --- Gg ---- 2e-120     NP_990744.1 domesticus (clone 2.3 kB) lim-1 [Gallus gallus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN --- Hs ---- 3e-126     NP_005559.2 LIM homeobox protein 1 [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 1e-126     NP_032524.1 LIM homeobox protein 1; LIM homeo box protein 1 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                   PROTEIN --- Xl ---- 8e-130     CAA45353.1 homeobox protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN --- Xt ---- 1e-133     AAI35732.1 Unknown (protein for MGC:121722) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN --- ?? ---- 1e-133     NP_001093698.1 LIM homeobox 1 [Xenopus tropicalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT56379.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------ATG---------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------ATG------------------TAG---------------------------------------------------------------------------TGA---TAA------------------TAA------------------------------------------------------------------ATG---TAA---------------------------TAA------------------------------TAA------------------TAG---ATG---------------------------------------TAA---------------------------------------TGATAA---TGA---------TAG------------------------------------TGA---------------TGA------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------TAA---TGA------ATG---ATG------TAA---------------------------------------TAA------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------TGA---------------------TGA------------------------------------------------------------------------------------------------ATG------------------------------------------TAA---------TAG------------------------------------TAA---------------------ATG------------------------------------------ATG------------------------------TAA------------------------------------------------------------ATG------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  3   1   2       bld Te5       out                        CAAO8098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGGGGACCTAGGACCACTATCAAAGCCAAACAGCTGGAGACCCTGAAAGCAGCTTTTGCAGCTACACCAAAACCGACCCGGCACATAAGGGAGCAGCTGGCACAGGAGACTGGTCTCAACATGCGAGTCATCCAGGTCTGGTTCCAGAACCGACGATCCAAAGAGAGAAGAATGAAACAGCTGAGCGCTCTGGGGGCCCGCAGACACGCCTTCTTCCGCAGCCCCCGAAGGATGAGGCCGCTGGTGGACAGGTTAGAGCCGGGGGAACTCATCCCCAATGGACCCTTCTCCTTCTATGGAGATTATCAGAGTGAGTATTATGGCCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTTCCTTCTTCTGGGCCTGCAGGAACTCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGAGGTTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATCTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTGTTTGGTCAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGCAGCAGGTTATGGCAACCATTTGTCACACCCGCCAGAAATGAACGAAACTGCAGTGTGGTAGCCTAAGTTGGACAAAAACAGAAAC
  5   1   2       bld Gas                            TGas028k15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAAANAGAGAAGAATGAAACAGCTGAGCGCTCTGGGGGCCCGCAGACACGCCTTCTTCCGCAGCCCCCGAAGATGAGGCCGCTGGTGGACAGGTTAGAGCCGGGGGAACTCATCCCCAATGGACCCTTCTCCTTCTATGGAGATTATCAGAGTGAGTATTATGGCCCTGGCAGCAACTATGACTTTTTCCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTTCCTTCTTCTGGGCCTGCAGGAACTCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGAGGTTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATCTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTGTTTGGTCAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGCAGCAGGTTATGGCAACCATTTGTCACACCCGCCAGAAATGAACGAAACTGCAGTGTGGTAGCCTAAGTTGGACAAAAACAGAAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCT
  5   1   2       bld Neu       in                   TNeu090k22.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAGAGCCGGGGGAACTCATCCCCAATGGACCCTTCTCCTTCTATGGAGATTATCAGAGTGAGTATTATGGCCCTGGCAGCAACTATGACTTTTTCCACAAGGACCCCCATCATCTCAAGCTCAGACTCCTGTAGATTTGCCATTTGTTCCTTCTTCTGGGCCTGCAGGAACTCCACTTGGTGCAATGGATCACCCAATCCCTGGACACCACCCATCTAGTGACGCTCAGAGGTTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATCTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTGTTTGGTCAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGCAGCAGGTTATGGCAACCATTTGTCACACCCGCCAGAAATGAACGAAACTGCAGTGTGGTAGCCTAAGTTGGACAAAAACAGAAACAAAAAATCAAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAA
  5   1   2       bld Tad5                                 XZT68114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACCCATCTAGTGACGCTCAGAGGTTTACTGACATAATGTCCCACCCACCAGGAGACTCTCCAAGCCCAGAGCCCAATCTACCAGGTTCCATGCACTCTATGTCTGCAGAAGTGTTTGGTCAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGCAGCAGGTTATGGCAACCATTTGTCACACCCGCCAGAAATGAACGAAACTGCAGTGTGGTAGCCTAAGTTGGACAAAAACAGAAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAAATAAAATCCTCATTATGAAGGTCTG
  5   1   2       bld Gas       in                   TGas114o24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAGAAGTGTTTGGTCAAAGTCCCCCCTTTTCTTCTCTATCGGTCAATGGAGCAGCAGGTTATGGCAACCATTTGTCACACCCGCCAGAAATGAACTAAACTGCATTGTGGTAGCCTATGTTGGACAAAAACAGAAACAAAAAATCACAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACATAAAAATCAAACTGGTGACGCTGTAAAGTATAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACCATATAAATCTGCTTTCATTGTACACACAGTACACCTAAATGCTAGTGATAATCTTGAAGGACTCCATAATGAAAAAAATACCTTATATAGAATTGCCT
  3   1   2      seed Tad5 FL   out                        XZT56379.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGGTCAATGGAGCAGCAGGTTATGGCAACCATTTGTCACACCCGCCAGAAATGAACGAAACTGCAGTGTGGTAGCCTAAGTTGGACAAAAACAGAAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTGTTC
  5   1   2       bld Gas7      in                         XZG36164.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGCCAGAAATGAACGAAACTGCAGTGTGGTAGCCTAAGTTGGACAAAAACAGAAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAAACATGAAATANAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTA
  3   1   2       bld Gas8      out                         st13h24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAAATGGACGAAACTGCAGTGTGGTAGCCTAAGTGGNCAAAANCAGAAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCCAGGAGC
  3   1   2       bld Gas7      in                          XZG7203.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAAAACAGAAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTT
  3   1   2       bld BrSp      out                    EC2BBA17AF10.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAACAGAAACAAAAAATCAGAAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGG
  3   1   2       bld Neu       in                    TNeu090k22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTTTCAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                          XZG3455.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAAGGACTGGGTGCAATGGGCTACCATGTCAACGTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCTTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTGTCAAAAAAAAAAAAAAAAGGG
  3   1   2       bld Eye  5g3  out                        CCAX1451.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTTCCTATGAAAATAACGTGGTGTACAGAACTGGTAAATAAAATTATATTCTGTCCTAAAGGTGTGTACAGTTTTGGATGGAAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAAATATTTTCTAAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCCTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTGTTC
  3   1   2       bld Gas       in                    TGas114o24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTAAATAAAATTATATTCTGTCCTAAAGGTGTGTGCAGTTTTGGATGGAAAAAAAATAATTTGCAAGAATATGCCATAATATGGATTCAAAGAAAAAAATATTTTCTGAGATGACAGAAAAATCAAACTGGTGACGCTGTAAAGTAGAGTTTTGTCATGCTAGGGGATGGAAAAGAATAGCTTGGTAGGTGGTACACAGGACACAATATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCTTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGTATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTGTTCAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG36164.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TATAAATCTGCTTTCATTGTACACACAGTACACCTAAGTGCAAGTGATAATCTTGAAGGACTCCATAGGAAAAAAAATACCTTATCAAGAATTGCCTAGAATGTTGAGTCTGTCTAGAATGTTGAGCTTTCTCTTCCTTGGAGAAATGTACTGTAGCCAGACTGTTTTAGCTTCAGACACGCACCTGTATATTCAGGTGCGACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTGTTCAAAAAAAAAAAAAAAATAGGCAAAACACTTTTGAGCAATTAACCAAATGATCCATTCTTCTTCTCAGTTTGGTTTTCTGTGGGTGTAACTGGACAGATTGGGCAAGGCTGTTTTTGGTACAATGTGCTAGTTTGTAAAGGTGTTGTTTACAGAAGGCCGTG
  5   1   2       bld TpA                            TTpA055a04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCGACACGAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTAACAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTGTTCAAAAAAAAAAAAAAAATAGGCAAAACACTTTTGAGCAATTAACCAAATGATCCATTCTTCTTCTCAGTTTGGTTTTCTGTGGGTGTAATTGGACAGATTGGGCAAGGCTGTTTTTGGTACAATGTGCTAGTTTGTAAAGGTGTTGTTTACAGAAGGCCGTGAAAAAGTGAAGAAAAAAAAATATGAGGTGCCAAATATAACTTTAATAGCACAAAAAATACTCCAAGGTGCATTAGCACTGGATACCATAGAGATTGTTCCAAGCGTGTTACACAGTTGCAAATGTTTGCTATACTTTTTAGTCCTGTCGAACATTCATTGACTTGTTAAAGATTTACATAGACCCAAACAGGTTTTATTTTTGTGTCTGTAANGAAATAAAATCCAAAATATTTAAATTTTATGAT
  3   1   2       bld Gas7 5g3  out                        XZG36942.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GACACAACATTTGCCAAAATAACAAAATACAACAATGTAAACCCCTCAGCATCAACTATTCTACCTTCACAAAGCTACTCACACGAAAAAATAAAATCCTCATTATGAAGGTCTGTTGGAAGACCTGGAAGGAGACTTGAAACAAAAAATAGATTCTACCTTCACTATCAATGAAATAAAATGACTATGGAACTATAAGCAGTCAACTGTTTACGTCTGACGTCAAATTCAGGAGCCTAATGTTTTAGTAATAATCCTGTTTTAGAAACCTCTTTGTTCAAAAAAAAAAAAAAAGG
  3   1   2       bld Hrt1      in                         CAAQ2732.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGCTGTTTTTGGTACAATGTGCTAGTTTGTAAAGGTGTTGTTTACAGAAGGCCGTGAAAAAGTGAAGAAAAAAAAATATGAGGTGCCAAATATAACTTTAATAGCACAAAAAATACTCCAAGGTGCATTAGCACTGGATACCATAGAGATTGTTCCAAGCGTGTTACACAGTTGCAAATGTTTGCTATACTTTTTAGTCCTGTCGAACATTCATTGACTTGTTAAAGATTTACATAGACCCAAACAGGTTTTATTTTTGTGTCTGTAAAGAAATAAAATCCAAAATATTTAAATTTTATGATTAAATATGCAGCCCAGAGCTGCTTTTTTCCCCCTTTATATATGAAATTTCTCATACGTCTTTTATTGTTCAAATAAATCCTAAGCTTGTGTGACCTCCAGTGCATATTAGACCATTCACTGTATGAAAGGAAAAACATGTTGACTAATTTGTGAATTTTTAATAAAATAGAAAATTCTGATGTTAAAAAAA
  5   1   2       bld Hrt1      in                         CAAQ2732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAGGCTGTTTTTGGTACAATGTGCTAGTTTGTAAAGGTGTTGTTTACAGAAGGCCGTGAAAAAGTGAAGAAAAAAAAATATGAGGTGCCAAATATAACTTTAATAGCACAAAAAATACTCCAAGGTGCATTAGCACTGGATACCATAGAGATTGTTCCAAGCGTGTTACACAGTTGCAAATGTTTGCTATACTTTTTAGTCCTGTCGAACATTCATTGACTTGTTAAAGATTTACATAGACCCAAACAGGTTTTATTTTTGTGTCTGTAAAGAAATAAAATCCAAAATATTTAAATTTTATGATTAAATATGCAGCCCAGAGCTGCTTTTTTCCCCCTTTATATATGAAATTTCTCATACGTCTTTTATTGTTCAAATAAATCCTAAGCTTGTGTGACCTCCAGTGCATATTAGACCATTCACTGTATGAAAGGAAAAACATGTTGACTAATTTGTGAATTTTTAATAAAATAGAAAATTCTGATGTTTAAAAAAA

In case of problems mail me! (