Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012078907 Xt7.1-CABA11260.5 - 15 ESTs
                                                                       .........-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABA11260.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCAAAGCACTTGTAGTGTTTACTGGAATCTTTCTGGCGGTTTACTTTTATTCAGCAGGAGATGTGTTTGAACCAGCTATGCTTAAGGGCAAGAGAGTAATAGTCACAGGAGCAAGTTCGGGAATTGGAGAGCAGATGGCGTATCACCTGGCCAAGATGGGGTCTCATATCCTTATCACTGCAAGGACAGAAGAGAAACTTAAGAAGGTGGTTGCGCAGTGCACACATCTGGGAGCTGCCTCTGCTCATTACATTGCCGGCAGCATGGATACCATGACATTTGCAAAGCTGGTAGTGCACAAAGCTGAGAATCTATTTGGTGGGTTGGATATGCTTATCCTGAATCATATTGGTCACACATACTTTGGTTACTTTGATGGCAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTGAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCCGTCAACCACATTGTTATATAACTATGTTCTAAATAAAAATGTATCC
                                                  Xt7.1-CHK-1008232599                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCACTTGTAGTGTTTACTGGAATCTTTCTGGCGGTTTACTTTTATTCAGCAGGAGATGTGTTTGAACCAGCTATGCTTAAGGGCAAGAGAGTAATAGTCACAGGAGCAAGTTCGGGAATTGGAGAGCAGATGGCGTATCACCTGGCCAAGATGGGGTCTCATATCCTTATCACTGCAAGGACAGAAGAGAAACTTAAGAAGGTGGTTGCGCAGTGCACACATCTGGGAGCTGCCTCTGCTCATTACATTGCCGGCAGCATGGATACCATGACATTTGCAAAGCTGGTAGTGCACAAAGCTGAGAATCTATTTGGTGGGTTGGATATGCTTATCCTGAATCATATTGGTCACACATACTTTGGTTACTTTGATGGCAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTGAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCCGTCAACCACATTGTTATATAACTATGTTCTAAATAAAAAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9    10    10    10    10    11    11    11    11    12    12    13    13    13    13    14    14    14    14    14    14    13    14    13    13    12    12    11    11    11    11    11    11    10    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    11    11    10    11    11    11    11    11    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     3     5
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Bf ---- 4e-013     AAG44847.1 microsomal retinol dehydrogenase 1 [Branchiostoma floridae] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Sc ---- 2e-012     NP_013953.1 NADP(+)-dependent dehydrogenase; acts on serine, L-allo-threonine, and other3-hydroxy acids; Ymr226cp [Saccharomyces cerevisiae] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Br ---= 2e-014     AAG44849.1 microsomal retinol dehydrogenase [Branchiostoma lanceolatum] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ci ---- 1e-014     BAD08526.1 17-beta hydroxysteroid dehydrogenase [Ciona intestinalis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ==== 5e-015     NP_001021764.1 Y47G6A.21 [Caenorhabditis elegans] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ==== 4e-019     NP_730972.2 CG31549-PA [Drosophila melanogaster] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Bb ---- 2e-024     ABK54273.1 Dhrs7 [Branchiostoma belcheri] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PREDICTED = Sp ==== 3e-045     XP_001197619.1 PREDICTED: similar to 11-beta-hydroxysteroid dehydrogenase type 3, partial [Strongylocentrotus purpuratus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN === Dr ==== 2e-045     NP_956617.1 hydroxysteroid (11-beta) dehydrogenase 3 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xt ---- 7e-068     AAI35284.1 Unknown (protein for IMAGE:7602521) [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Mm ---- 9e-086     NP_001038216.1 hydroxysteroid 11-beta dehydrogenase 1 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Hs ==== 5e-092     NP_005516.1 11-beta-hydroxysteroid dehydrogenase 1 [Homo sapiens] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PREDICTED - Gg ==== 7e-099     XP_417988.2 PREDICTED: similar to MGC64545 protein [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = Xl ==== 1e-154     AAH54291.1 Unknown (protein for MGC:64545) [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED = ?? ==== 1e-154     NP_001079807.1 hypothetical protein LOC379497 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABA11260.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------TAG---ATG---------------------------ATG------------------------------------------------------TAA---------------------------------------------TAG---------------------------TAA------------------ATG---------------------------------------------------------------------------------------------------------------TGA------------------------------------------TGA------------------------------TAA---------------------------------TGA------------------------TAGTAA------------------------------------------ATG---TAA------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld Abd0                               IMAGE:7017481                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCACTATGGCTTTGCTCAAAGCACTTGTAGTGTTTACTGGAATCTTTCTGGCGGTTTACTTTTATTCAGCAGGAGATGTGTTTGAACCAGCTATGCTTAAGGGCAAGAGAGTAATAGTCACAGGAGCAAGTTCGGGAATTGGAGAGCAGATGGCGTATCACCTGGCCAAGATGGGGTCTCATATCCTTATCACTGCAAGGACAGAAGAGAAACTTAAGAAGGTGGTTGCGCAGTGCACACATCTGGGAGCTGCCTCTGCTCATTACATTGCCGGCAGCATGGATACCATGACATTTGCAAAGCTGGTAGTGCACAAAGCTGAGAATCTATTTGGTGGGTTGGATATGCTTATCCTGAATCATATTGGTCACACATACTTTGGTTACTTTGATGGCAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAACTGTGTCAGGTGTA
  5   1   2       bld Te1                                  CBWN8061.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTCAAAGCACTTGTAGTGTTTACTGGAATCTTTCTGGCGGTTTACTTTTATTCAGCAGGAGATGTGTTTGAACCAGCTATGCTTAAGAGCAAGAGAGTAATAGTCACAGGAGCAAGTTCGGGAATTGGAGAGCAGATGGCGTATCACCTGGCCAAGATGGGGTCTCATATCCTTATCACTGCAAGGACAGAAGAGAAACTTAAGAAGGTGGTTGCGCAGTGCACACATCTGGGAGCTGCCTCTGCTCATTACATTGCCGGCAGCATGGATAACATGACATTTGCAAAGCTGGTAGTGCACAAAGCTGAGAATCTATTTGGTGGGTTGGATATGCTTATCCTGAATCATATTGGTCACACATACTTTGGTTACTTTGATGGCAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAG
  5   1   2       bld Liv1      in                        CAAR12984.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTGGAATCTTTCTGGCGGTTTACTTTTATTCAGCAGGAGATGTGTTTGAACCAGCTATGCTTAAGGGCAAGAGAGTAATAGTCACAGGAGCAAGTTCGGGAATTGGAGAGCAGATGGCGTATCACCTGGCCAAGATGGGGTCTCATATCCTTATCACTGCAAGGACAGAAGAGAAACTTAAGAAGGTGGTTGCGCAGTGCACACATCTGGGAGCTGCCTCTGCTCATTACATTGCCGGCAGCATGGATACCATGACATTTGCAAAGCTGGTAGTGCACAAAGCTGAGAATCTATTTGGTGGGTTGGATATGCTTATCCTGAATCATATTGGTCACACATACTTTGGTTACTTTGATGGCAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGNGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTA
  5   1   2       bld Int1      in                        CAAP10137.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTTATTCAGCAGGAGATGTGTTTGAACCAGCTATGCTTAAGGGCAAGAGAGTAATAGTCACAGGAGCAAGTTCGGGAATTGGAGAGCAGATGGCGTATCACCTGGCCAAGATGGGGTCTCATATCCTTATCACTGCAAGGACAGAAGAGAAACTTAAGAAGGTGGTTGCGCAGTGCACACATCTGGGAGCTGCCTCTGCTCATTACATTGCCGGCAGCATGGATACCATGACATTTGCAAAGCTGGTAGTGCACAAAGCTGAGAATCTATTTGGTGGGTTGGATATGCTTATCCTGAATCATATTGGTCACACATACTTTGGTTACTTTGATGGCAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAAGTGTAATCCA
  5   1   2       bld Kid1                                 CABA7019.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACCTGGCCAAGATGGGGTCTCATATCCTTATCACTGCAAGGACAGAAGAGAAACTTAAGAAGGTGGTTGCGCAGTGCACACATCTGGGAGCTGCCTCTGCTCATTACATTGCCGGCAGCATGGATACCATGACATTTGCAAAGCTGGTAGTGCACAAAGCTGAGAATCTATTTGGTGGGTTGGATATGCTTATCCTGAATCATATTGGTCACACATACTTTGGTTACTTTGATGGCAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCNAGAGGTTTAAAAAAAAATCAGCAGAAGCAAACACTATGGGCTGATTAAACAATGCATAGTG
  5   1   2      seed Kid1      in                        CABA11260.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAACATTGACCATGTAAGAGATCTATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTA
  5   1   2       bld Ovi1      in                         CABI5198.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTAGAGATCAATGTCTTGAGTTACGCTACCATGACAGTAGCAGCTCTTCCGATGCTGAAAAAAAGCAATGGGAACGTTGTGGTTGTCTCATCAGTTGCAGGTAAAATTGGACTCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTC
  3   1   2       bld Kid1      in                        CABA11260.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTGTCTCATCAGTTGCAGGTAAAATTGACTCCCCTCTAACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTGAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCCGTCAACCACATTGTTATATAACTATGTTCTAAA
  3   1   2       bld Ovi1      in                         CABI5198.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTGTGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTGAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCCGTCAACCACATTGTTATATAACTATGTTCTAAATAAAAATGTATCCAACTG
  5   1   2       bld Tad5      in                         XZT12499.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCCATACTCCACTACTAAATTTGCACTGGATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTCCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCGCTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAACTTTCAAAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCACACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTGCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCAAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTAAGGTGGGGGACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCTGTCAACCACATTGTTATATAACTATGTTCTAAATAAAAATGTATC
  5   1   2       bld Lun1      in                         CABD6786.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGGATTTTTCAGCTCATTGCGAATGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCNTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATC
  3   1   2       bld Lun1      in                         CABD6786.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGGAGTTTATCCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTGAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCCGTCAACCACATTGTTATATAACTATGTTCTAAATAAAAATGTATCCAACT
  3   1   2       bld Int1      in                        CAAP10137.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAGCAAAACATTGATGTTTCCATTACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTGAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCCGTCAACCACATTGTTATATAACTATGTTCTAAATAAACCTCTCGCCCTATAGGA
  3   1   2       bld Liv1      in                        CAAR12984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACACTATGTATAATCAGCTATATAGACACAGACAGTGCTCTAAAAACTGTGTCAGGTGTAATCCAGCAACCAGCAGCTCCCAAAGAAGAGTGTGCACTGGAAATCATAAAAGGGGGAGCTCTGCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCACTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAATTTTCAGAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCGCACTGGCACTGATTTACCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTCCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCTAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTGAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCCGTCAACCACATTGTTATATAACTATGTTCTAAATAAAAATGATCCAACG
  3   1   2       bld Tad5      in                         XZT12499.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCTCTCCGAAAAAGAGAAGTCTACTATCAATATCATGCTACCAAGATCCCGCTTCTTCTTAGAGATTGGGCCCCAGAATTATTACAGTCTCTTCTCCTTAAGAATTATAACATGGACAACTTTCAAAGGAAAGAAGTTTAGTTCATGCACAAAAAAGTAACTCACACACTGGAAATGTGGAAAAGATCTGTTAGGACACATAGCACACTGGCACTGATTTCCCAAGAGGTTTAAAAAAATCAAGCAAGAAGCAAACACTATGGGCTGATTAAACATGCATAGGTGATAAATTGCACCAGTGCAGTTGCATAAAGCAACCACTGTTTAGCAATGCAGAACAAACACAGAGGAACTGAGGCACTGTGTGAAACACTAAAGAGCATTGCATCTTTTCTATGGACATTGTCTCTCTTTAGTAAATGGTTGTTAAATTGTATAATCTCGTGAGCACTGTCAAACCCATGTACCTCTTTATCTCCTGTGTCCCATTGAGACTTTCTATCCCACTGTTTCTTTTCTTTTTAACCTTCACATAAGTGGGTGCATCTGAGCCCACACTAAGGTGGGGAACCAGCCTATAGCAGTTAGTAACTGTCAGCAAATCAGCCCTGTCAACCACATTGTTATATAACTATGTTCTAAATAAAAATGTATCCAACTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)