Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG38780.5                           35 END     1           2        2                FLJ20202 protein [Homo sapiens]
     2   0.0    0Xt7.1-TTpA019h22.3                          3 END     1           2       33                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012078935 Xt7.1-XZG6149.5.5 - 48 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-XZG6149.5.5               GGGCTGATCGCTGGCAATCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008225936                     ATCGCTGGCAATCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTTAAAAAAAAAAA
                                                      consensus depths                    2     2     3     3     3     3     3     3     3     3     3     5     6     6     7     7     8     8     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    12    13    12    13    12    13    13    13    14    14    14    14    14    14    14    14    15    15    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    15    15    16    16    16    16    17    17    17    17    18    18    19    19    18    19    19    19    18    18    18    19    18    19    18    20    19    20    19    20    18    19    13    18     9    18     9    18     8    16     9    16     8    14     8    13     8    12     8    12     8    12     8    11     8    11     8    11     8    11     8    11     8    11     7    10     7    10     7    10     7    10     6     9     6     9     6     9     6     9     6     9     6     9     6     8     6     8     6     8     6     7     6     7     6     7     6     7     7     8     7     8     7     8     8     8     8     8     8     8     8     8     7     7     7     7     5     7     5     6     5     6     5     6     5     6     4     5     4     5     4     5     3     5     3     5     4     6     4     6     4     6     4     8     4     8     4     8     4     8     3     7     3     6     3     6     4     7     5     8     6     9     6     9     6    10     6    10     6    10     6    10     6    11     6    11     7    11     7    11     7    11     7    11     7    12     7    12     8    14     8    14     9    15    10    15    11    17    11    17    12    17    12    17    12    17    13    16    10    16    11    16    11    16    12    18    13    18    15    19    14    19    16    19    18    20    18    20    18    20    18    20    17    19    17    19    17    19    15    18    14    16    14    16    16    16    16    16    16    16    16    16    15    16    15    16    17    19    17    18    16    18    16    18    17    18    17    18    17    17    16    17    15    17    15    17    12    15    10    13     7    13     7    13     7    13     7    13     7    13     6    13     6    13     6    13     6    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    12     8    11     8    11     3     7     3     4
  5   1   2  SIG                                      Xt7.1-ANBT2127.3                          TGGCAATCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATTTTTGACATAAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATAAAAAAAAAAAAAAAA
  5   1   2  SIG                                       Xt7.1-XZG6149.5                                                                                         GGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAATTGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -C----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ---T--------
                                               BLH ATG     867     302               
                                               BLH MIN     864      84               
                                               BLH MPR     711      84               
                                               BLH OVR     867     378               
                                               CDS MIN     867      84               
                                               ORF LNG     867      15               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 1e-008     NP_498403.1 Lethal-756, essential fibroblast growth factor, human 20-like (49.6 kD)(let-756) [Caenorhabditis elegans] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Ci ==== 3e-023     BAC22068.1 fibroblast growth factor 8/17/18 [Ciona intestinalis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Cs ---- 4e-025     BAC55965.1 fibroblast growth factor 8/17/18 isoform 2 [Ciona savignyi] ================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Mm ---- 1e-083     NP_034335.1 fibroblast growth factor 8 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Hs ==== 2e-096     NP_006110.1 fibroblast growth factor 8 isoform B precursor [Homo sapiens] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Dr ==== 3e-098     NP_571356.2 fibroblast growth factor 8 [Danio rerio] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Gg ==== 4e-107     NP_001012785.1 fibroblast growth factor 8 [Gallus gallus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 3e-119     AAO15593.1 fibroblast growth factor-8b [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === ?? ==== 3e-119     NP_001083904.1 fibroblast growth factor-8b [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xt ==== 5e-121     NP_001008163.1 fgf8-prov protein [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-XZG6149.5.5                                          TAG------ATG---------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------TAG------------------------TAG------------------------------------TAA---TAA---------------------------------TAA------------------------------------TGA------------------TGA---------------------------------TGA---------------------ATG------------------TAG------------------TAG---------------------------------------------------------------------------TAA---------------------------------------------------------------------TAA---------------------------------TAAATG------------------------------------------------ATG------TAG------------------------------------------------------------------------------------TGA------------------------------------TGA---TGA------ATG------------------------TAA---------ATG---------------------------------------------ATG------------------------------------------------------------ATGATG------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2  SIG                                      Xt7.1-ANBT2127.3                          TGGCAATCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATTTTTGACATAAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008289080                                TCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATAAAAAAAAAA
  5   1   4      seed HdA       in                   THdA046e12.p1kSP6                          TGGCAATCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGANGGAACTGCNGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACC
  5   1   2       ext Gas6      in                         ANBT2127.5p                                                                                                                                                                                                                                                   CGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGC
  5   1   2       ext Gas       in                   TGas082n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                        TCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGT
  3   1   2       ext Gas6      in                         ANBT2127.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGC
  3   1   2       ext Gas       in                    TGas082n21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAAAAAAAA
  3   1   4      seed HdA       in                    THdA046e12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AACTGGCTGTTTTTTTTATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATTTTTGACATAAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATAAAAAAAAAAAAAAAAAAG
  5   1   2  SIG                                       Xt7.1-XZG6149.5                                                                                         GGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAATTGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAA
                                                  Xt7.1-CHK-1008289078                                                                                               TCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAATTGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAAAAA
  5   1   1           Tad0 FL                     IMAGE:6983047.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCGGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAATTGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       add Gas       in                   TGas115n20.p1kSP6 CAAGAGGAGGGACAGGGCTGATCGCTGGCAATCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACT
  5   1   2       ext Gas8      in                          st77b12.5p               GGGCTGATCGCTGGCAATCACTTCACTTAGTGCTCAATGAGACAGCGGCCAACACACAGACTCACACTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCNANACTCGGCTGCCTGGCC
  5   1   4      seed Gas       in                   TGas101l13.p1cSP6                                                                 CCGGGGCACAGACTCCACTCTCTCAGGCTATCAGGAGGGCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCCTAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCACCTGTATCGCCGGAGGGATTGTACCGATACGCCAAGGGGCTGCTCTCAGGCGCTCCCCATCACTATCATTACTATTAT
  5   1   3        nb Gas       out                  TGas141f07.p1kSP6                                                                  CGGGCAGACTCACACTTCTCTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCC
  5   1   3        nb Gas                            TGas018a08.p1kSP6                                                                                     CTCAGGGCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCT
  5   1   3        nb Gas                            TGas043h08.p1kSP6                                                                                           GCTATCAGGAGGTCTCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGC
  5   1   3        nb Gas7                                  XZG6149.5p                                                                                                         TCTGAGCCGCAGCCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAG
  5   1   3        nb Gas8                                  st41l15.5p                                                                                                                     CCACTCAGCCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCANACTCGGCTGCCTGGCCAAGGGGAT
  5   1   3        nb Gas8                                  st77a14.5p                                                                                                                             CCAGGTTGTTCTATTGGCCGGTGGGATCGCAGCTTGTGCATAGAAGGAGAAAGCCTTACTCATCAACACTTTCATCATCAGCTCTCACACACCAAGCGCTGCCTTCAGCCCAACACAACGTCATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCANACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAG
  5   1   3        nb Gas8      in                          st27c07.5p                                                                                                                                                                                                                                                       ATTTTGGAAGCGAGAGAGCGAGAGAAAGTGATCCTCCCAGGTTGGGAAGTANCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAANC
  5   1   3        nb Gas  5g                        TGas020h03.p1kSP6                                                                                                                                                                                                                                                           CTTTTGGAACGAGAGACGAGAGAAATGATCCTCCCAGTTGGGAAGTAGCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCA
  5   1   2       add Mus1      in                        CABH10171.5p                                                                                                                                                                                                                                                                                                          GCTCGCATTCTTACTCTGACTTTGCGCTCTGACTTTGCGCTCTCTCTCTCTCCTGAGCGCTCAAGCTGACAGCGCTGCGCCTACATCTGCGCCTTGGGACCGGGGGGCCGGCACAGCACTGGGACAATTGTCAGCGCATCTCGGCTGTTTCTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCACTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTAAGTATTGGGGCACCCAGCACCCACATTGCTCCCACTCTGCCCGCACCCTGCTTGCTAACTGGACCTTCTCTTCTATTTTTACAGGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGG
  5   1   0       chi TpA       out                  TTpA019h22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                  CAAGTGTAAAATTATTTTATGCTAATGCAGTTTATGGCATTGTTTTTCTATATTGTGATCATAAATAGAACCAATAAATGCTTTATCACTAGATGTTGGGCCAGGGAGGTAGGAGAGTAAGGTTATTTCTCAATATATATAGTTGTTAAACTGCAAGTCCTAGGAGATACTGGGAGTTGTAGTCTATCAGTTGTAGTCTTATCCCCCACATCTGAGCAGGTTAATGTGAGTTTCTAAACTGAAATGCTTGTCAGTCGTTTCAGATATTTATAAACCTCCAGCCCATTCCGCACTGCTGAGTAGCAATAACAATCCCAATCAATACAATAGCTGGAGAGGGCCTTGCTCAGAAGAGCTTCCAGTCTAGAAATATTTCCTTCTATTTATCAAACTGAATGACTGCTAATGCAGAGTATACAGGCCATAATGAATAGGCCAGGATACATATTTTGTCCTGGTTTCCTTTTGGACAATGCATTTTGCCCACACAATAAACTGTGTTGGCCGTCATTCAGCTGTATTAAGAAGTATAAATATAATAGCTTGTTTTATATATTTCCTAAAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGGTAAGAATACAATTTCATATATTTTTATGTATGATGAGAAGTTTTATATCTGTGTGTACTGCANGGTGGTCCAGGGAGCAGAATGTGTGCAACAGGTGGGACCTACCTGCAGTTTGGAATGAAACATCATATA
  5   1   3        nb Gas6      in                         ANBT2040.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGAGTTTTTTTTCTCACTTGGAGGCAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCATCTGTTTCAGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCAGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAACAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAACCCAGGTAACTGTACAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCACAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGA
  3   1   3        nb Gas6      in                         ANBT2040.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGTGGCAGGGGAGCCGTGTGAGCTCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAAC
  3   1   2       ext Gas8      in                          st77b12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCCGCACCAGCTGTAGCGCCGGAGGGATTGTACCGATACGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTGGAAGCAGAGT
  5   1   3        nb Gas                            TGas043h09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ACGGATTGTGCCGATACCCCAGGGGGCTGCTCTCAGGCTCTGCCCATCACTATCATTACTATTATTGTTATTATCACCATCATTATTTGGGAAGTCTCTGCGTCTGTTTCGGACAACGAGTGCAGCGTGTTTCTACTCACCCCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTC
  5   1   0       chi Gas6 5x3  in                          ANBT965.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CGCCAGGGGGCTGCTCTCAGGCTCTCCCCATCACTATCATTACTATTATTGTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGC
  5   1   2       add Tad0 FL   in                       IMAGE:6983047                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTATTATCAGCATCATTATTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCGGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGNGAGGGGCAAGACTGCGTCTTCTCGGANATGTCCTTGAGAACACTACCAGCTCTGCAAATGTCAGTACGAAGCTGGTACATGCTTCACGAGAGAGCGCCCTAGAAGCTCAGACAGCACATCANGAGTCC
  5   1   3   24   nb Gas6 5g   ?                          ANBT3222.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTTGGGAAGTCGCTGCGTCTGTTTCGGACAAGGAGTGCAGCGTGTTTCTACTCACCCCCCCCGTCTCCCTGGCTGTGGCTCGGTGCCCTCTCTTCCAGACTCGGCTGCCTGGCCAAGGGGATGGGCGGAGGGAACTGCGGGAGCTCCCGGGACTAGGAAACGGCAGCGCTGCACCTTCCCCTGCTACCAGCCGGGCAGCTCATCGGCCGAGCAGCCGCTCCACTGCAATCCGACTCCCTGGGACTATCGGGCAGCCCGACAGGCAGAGGCACCCAGCAGGGCAGGATGAGCTACATCACCTCCATCCTGGGCTATCTGTTACTGCACTTGTTTGTCATCTGCCTACAAGCCCAGGTAACTGTTCAGTCCCCACCTAATTTTACACAGCATGTGAGGGAGCAGAGCCTGGTGACCGACCAACTAAGCCGACGGCTCATCCGAACCTACCAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGANATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCT
  3   1   2       add Gas6 5x3  in                          ANBT965.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAGTTGTACAGTCGGACCAGTGGCAAGCATGTGCAAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCGCATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAACAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACC
  5   1   2       ext Gas8      in                          st44p24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAATCTTGGGGAACAAGAAGATTAACGCCATGGCAGAAGACGGCGACCCACATGCCAAGTTAATCGTGGAAACAGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAANAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTA
  5   1   2       add Gas7                                  XZG6837.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTATCGTGGAAACGATACGTTTGGAAGCAGAGTTCGCATTAAAGGTGCGGAGACTGGTTACTACATCTGCATGAACAAAAAAGGAAAGCTGATTGGGAAGACTAGTGGGAGGGGCAAAGACTGCGTCTTCTCGGAAATTGTCCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACTAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACAGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAATAAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTAAAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACG
  3   1   2       add Mus1      in                        CABH10171.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CGGAAATTGTTCTTGAGAACAACTACACAGCTCTGCAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTGAC
  3   1   2       add Gas       in                    TGas115n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAAAATGTCAAGTACGAAGGCTGGTACATGCTTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAACAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAANCCAACGGACAAATTCATTCTTTGACATAAAAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu007i10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAATGTCAAGTACGAAGGCTGGTACATGGCTTTCACGAGAAGAGGCCGCCCTAGGAAAGGCTCCAAGACAAGGCAACATCAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAATTGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATGTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGC
  5   1   2       ext Gas7      in                         XZG21863.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAGGGAAGTCCACTTCATGAAGAGGTTGCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAATTGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAG
  5   1   3        nb Gas7      in                         XZG21002.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCGAAGGGACACCACACCACAGAACCTCATAAACGTTTTGAGTTTATGAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCA
  3   1   3        nb Gas       ?                     TGas141d07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CATAAACGTTTTGAGTTTATTAATTACCCTTTTAATAGAAGGAGTAAAAGAACTCGATACTCAAGTTCTCGGTAGGACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAACAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACCAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAAAAAAAAAAA
  5   1   2       ext HdA       in                  THdA027g17.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              NAAAAGAACTCGATACTCAAGTTCTCGGTAGGAACACGGTTTCTCACTACGTTCCATAGACTTCAGCAAACAGACTACTCTATTCTAATATAAAATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAAATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAAAAAAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAAAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAAAGCTGCTTTTTCATCGATTCAGTTTCCTTAAGGGAAACGTAAAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAAAATATTAGGTTGTTGTTTTTTTTCAGCCAACAAGGACAAATCATCTTTGACTTAAAAAAAAAAAAGACCTCAAAACTTGCAACTGCTTGACCATGAAATGAAATGCA
  3   1   2       add Tad0 FL   in                       IMAGE:6983047                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGCAACTGATTGTTATTTTATTTAATGACGAATAACAAGAAATCCGGACTGGTGTTTTATATATCTAAATAGAAATATAATAGTTGTTGGGCTCATACAAAAGGAGATTTATTTGTTTATTCATATGAAATATTATTTTTTTTTTCACAAAGAAAAGCTGATGAAATTTCCGGACTTAAAAAAAATTGTGATCTTCATAAAGATTTTAGCCGCCTTTTTTTAAAAAAAAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGTTACTTACAGACAACAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAATCGGAAGAAGAACCTTGAGCAGGGTTCTTCATTATGTGACAAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCGTTGGATTATTTTTAAGAGCTGATTTTTCATCGATTCAGTTTCCCTAATGGAAACCTAGAATGTCCTGGTTGAAACAGGTTTACGTGATGAGCAAGAATATTATGTGGTAGTTTTTTTTCATAGCCAACAAGGACAAATAATCTTTAACATTAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGAAGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTAAACGC
  3   1   4      seed Gas       in                    TGas101l13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATAAGAATAAAAAAGAAATCATGAACTGGCTGTTTTATATATATAAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAACAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGATAAAAAAAAAAAAAAAAAA
  3   1   2       ext HdA       in                   THdA027g17.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAATATACATATATATATTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTTTGCCAACAAGGACAAATCATTTTTGACATAAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAAAAAAAAGC
  3   1   2       ext Gas7      in                         XZG21863.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATATTTTTTTTTGTTTTTACAAAAGATGATCTATTTTTTTATTCCTATGAACTTTTTTTTTTTTTTTTTTAAAGAAAAGCGGATGAAATGTACGGACTTACAAAAAATTGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTGGTTTT
  3   1   3        nb Gas7      in                         XZG21002.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAAATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAAAAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATTTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACCCTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGGGTACATATTAATATTAATGAGGGAAATATTTATTTAAATGGGTATTAAAATTTGTACTGGTTTT
  3  -1   3        nb Gas8      in                          st27c07.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATGTGCTCTTCATATAGATTTTAGTTGTTTTTTTTTAATAACTAGCAAACAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAA
  3  -1   2       ext Gas8      in                          st44p24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTTAGCTTGTTTTTTTTTAATAACTAGCAAACAAATGGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAA
  5   1   3        nb Tbd1      in                         CBXT4798.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAATGTTGTAGGTGAAGGCGGACCTGGGACCAAAAGTGCTACTTACAGACAAAAACACTTAACCAAAAGATAAATAAGGAACCGGTACTGGAAAACGGAAGAAGAACCTCGAGCAGGGTTCTTTTTTATTTGTTCAATTCTCTAAACTCCTTTTGCGGAAGAGTTGGGGTTTTTATTATAAATGCTTTTGATTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAAAAAA
  3   1   3        nb Tbd1      in                         CBXT4798.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAAATGCTTTTGATTATTTTTAAGAGACTGCTTTTTCATCGATTCAGTTTCCCTTAATGGAAACGTAGAATGACCCTGGTTGAAACAGGTTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAAAAAA
  5   1   3        nb Neu                            TNeu070m19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATTTTTAATAGTCTGCTTTTTCATCGATTCATTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCATTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATT
  5   1   3        nb Neu                            TNeu037i13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTNTT
  5   1   2       ext Neu                            TNeu075c16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TATTTTTAAGAGCTGCTTTTTCATCGATTCAGTTTCCTTAATGGAAACGTAGAATGACCTGGTTGAAACAGGTTTCCGTGATGAGCAAGAATATTATGTTGTTGTTTTTTTTCTGCCAACAAGGACAAATCATCTTTGACATAAAAAAAAAAAGACCTCAAGACGTGCAACTGCATGACGATGAAATGAAATGCATCCCAGTGGTAGGAAACAGTTGTAAGAAATAGTGATGAACAGTAATAATATTGTTATTATTTTTAAAAAAAACACTGTACAAATGTCAGTTGTCTGGCAAGACCTTTGTCCTTTTTTTCAAGGATATGTGTACATATTAATATTAATGATGGAAATATTTATTTAAATGTGTATTAAAATTTGTACTAGTATTAAAAAAAAAAATGATGAAAAAAAATACAACTAGAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)