Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-THdA038i23.5                         49 END     1           1        2                LOC496066 protein [Xenopus laevis]
     2   2.0    0Xt7.1-TTbA039f10.3                         37 END     1           1        2                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 412.0    0Xt7.1-TEgg122c02.5                          2 PI      86       2273     2623                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012078953 Xt7.1-XZG8774.5.5 - 61 ESTs
                                                                       ..-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-XZG8774.5.5                                                               GAGAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAG------------------------------------------------------------------------------------------------------------CACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTTTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGTAGCATTGACACCCCAGACTTGCAACACACAACAGCAGAGGTGTCAGAGTTATATATATATCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAAAATAAATAAAACGTCCACAGATAGGGGCATGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTT
                                                  Xt7.1-CHK-1008224939                                                                     GGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTG------------------------------------------------------------------------------------------------------------------------TGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTTTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGxxxxxxTAGCATxxxCxxCCCAGACxTxxAACACACAACAGCAGAGGTGTCAGAxxTxxxTATATATxTxxxCTGGAGGCTTTGxxxTxxxxxTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAxxxxxAxxxxxxCGTCCACAGATAGGGGCATGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATA
                                                      consensus depths                                                                    3     3     6     6     6     9     6     9     7    12     8    12     8    13     8    13     8    14     8    14     9    15     9    15     9    15     9    15     9    15     9    15     9    15     8    15     9    15     9    15     9    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    15    16    16    16    16    15    16    16    16    16    16    15    16    15    16    15    16    15    16    15    16    15    16    17    18    17    18    17    18    17    18    17    18    17    18    17    18    14    14    15    15    15    15    15    15    15    15    15    15    14    14    14    14    14    14    13    14    13    14    12    13    11    12    11    12    11    12    11    13    12    14    12    14    12    14    11    13    11    13    11    13    10    13    10    12    12    14    10    11     9    11     9    11     9    11     9    11     9    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    12    11    12    11    12    11    12    11    12    11    12    10    11     9    10     7    10     8    11     9    12     9    12     9    12     9    12     9    12     9    12    11    14    11    14    11    15    12    16    12    16    13    17    13    17    13    17    13    17    12    16    13    18    11    17    12    17    11    16    11    17    11    17    11    16    13    17    14    19    14    19    14    19    14    19    13    17    12    15    10    16    10    16    10    16     9    15     9    15     9    17     9    17     9    17     9    17     9    17     8    17     8    15     9    16     9    16     9    16     8    16     9    16     8    16     8    16     9    16     9    16     9    16     9    17     9    17     9    17     9    17    11    17    10    17     9    17     9    16     9    17     9    17     9    17     9    17     9    15     9    15     9    16     9    16     9    16     9    16     9    16     9    16     9    14     9    14     9    15     9    15     9    15     8    14     7    13     7    12     7    12     4    10     0     6     0     5     0     5     0     5     0     5     0     5     0     5     0     5     0     5     2     5     2     4     2     4     2     4     2     4     3     5     3     5     3     6     4     7     4     6     4     8     4     8     4     8     4     8     4     9     4     9     4     9     4     9     6    11     6    11     7    12     7    12     7    12     7    12     7    12     7    12     7    12     7    12     7    12     7    12     7    12     6    11     6    11     6    12     6    12     6    12     5    11     5    11     5    11     6    12     6    12     4    12     6    12     6    12     6    12     6    12     6    13     6    13     6    13     6    12     5    12     6    12     6    12     6    12     4    12     3    12     3    12     3    12     3    12     4    12     3    12     3    12     3    11     3    11     3    10     3     9     4     8     3     5     3     5     2     4     2     3     2     3
  5   1   2  SIG                                       Xt7.1-XZG8774.5                                                               GAGAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAG
  5   1   2  SIG                                      Xt7.1-XZG12840.5                                                                                                            TGACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGTAAGCTTATCCTTATCTTAAAAATGAAGTAATTATTAAGATTAGCTTTAATTGGGGTAAAAGTTCATACAAAAATAATAGCATATCAGTAGAACTACACGTCACTGCTAGCAAAGCTGGTGGCATGAAAGGGAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCCAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACACCATCATGTGCTTTGAAAGTACAAATTTTACCTGTCGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTT------------------------TTTCAAACAAACGTTATTATTGCTAAGTTTGACTGGAACACAATGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTGCGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCCTATTTAAGGAGGAAGAAAACACCCCAAGTGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCAC
  5   1   2  SIG                                       Xt7.1-st41h05.5                                                                                                              ACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGCGGACAGTGGAGCGATATGTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAAATTGATATTTGCTGC
  5   1   2  SIG                                    Xt7.1-TNeu053m04.3                                                                                                                                             ATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGG------------------------GCCTCTGCCCTCTCGCCATACCATTGCCTGTCACTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTCCCTCCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTCTTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCAAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATTCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTTTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAA
  5   1   2  SIG                                      Xt7.1-XZG58060.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGCTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGGTACCTGTGTGACTT------------------------TAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATATTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATCCCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATGGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCGGGGGCCACATTAGCATTGACACTTTTGCCTTCAAACACACAACAGCAGAGGTGTCAGTTCTTCCTACTGTTTTTCCCGGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCGGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAA
                                                                   VAR                                                                                                               CTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCA
                                                                   VAR                                                                                                                                                                                                                                                                                                               ACCGGACCCTCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAGGACCAAGCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACTGAGCTACACGTCTGTTGTGTG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTATTAACTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGTTGCCCCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTTATAATAAAGGGTATTCTCTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCTTCCTACTGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGCAGACATGGG
                                                                   SNP                                                                                                                                                                                                                                                                                                                           ---TA-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                       -----C------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                   ----A----G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                           -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                       -----------A
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                   ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                               ---------A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                           -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ------A-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------C-
                                               BLH ATG     272    1744                                                               
                                               BLH MIN     272     198                                                               
                                               BLH MPR      89     198                                                               
                                               BLH OVR     272     508                                                               
                                               CDS MIN     272     198                                                               
                                               EST CLI       0       7                                                               
                                               ORF LNG     272      32                                                               
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Bb ==== 2e-054     AAF19839.1 secreted protein Wnt7 [Branchiostoma belcheri] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dm ---- 3e-057     NP_476810.1 Wnt oncogene analog 2 CG1916-PA [Drosophila melanogaster] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---= 3e-067     NP_493668.1 C. elegans WNT family member precursor (42.0 kD) (wnt-1) [Caenorhabditiselegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 5e-071     AAD52655.1 Wnt-5 protein precursor [Ciona intestinalis] ------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                              PREDICTED - Sp ---- 4e-077     XP_779946.1 PREDICTED: similar to wingless-related MMTV integration site 5A isoform 1 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 6e-115     AAF80555.1 Wnt11 [Branchiostoma floridae] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Hs ---- 4e-138     NP_004617.2 wingless-type MMTV integration site family, member 11 precursor [Homo sapiens] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Mm ---- 2e-139     NP_033545.1 wingless-related MMTV integration site 11 [Mus musculus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Gg ---- 3e-142     NP_990115.1 Wnt-11 protein [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dr ---- 6e-147     NP_571031.1 wingless-type MMTV integration site family, member 11 [Danio rerio] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xl ==== 0          AAH84745.1 Wnt-11 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === ?? ==== 0          NP_001084327.1 maternal protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN === Xt ==== 0          AAH81341.1 Wnt11-prov protein [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-XZG8774.5.5                                                                          TGA---------------------TGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------------------------------------------TAA------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG---------------TGA------------------------------TGA---------------------------------------------------------------------TGA---TAG------TGA------------------TAA---------------TGA------------------ATG------------------------ATG------------------------------------------------------------TAA---------------------------------TGA---------------------ATG------------------------------------------------TAG---------------------------------------------------------------TAA------ATG---------------------------------------TGA------------------TAA------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------TAATGA---------------------TGATGA------------------------------ATG---------------------------------------------------TGA------------------------------------------------------------------------------------------------------------------------ATG---------------------------------TAA---------------TAA---TGA---------------------------------------------TGA------------------TAA---------------------TAGTGA---------------------------------------TAG------------TAG---TGA------------------------------------------------------------------------TGA---------------------------ATGTAA---------------------------------------------------------------------------------------------------------------------------------------------ATG------TAG---------------------------------TAA---------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                               [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2  SIG                                       Xt7.1-XZG8774.5                                                               GAGAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAG
                                                  Xt7.1-CHK-1008286190                                                                     GGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTG
  5   1   1           Neu0 FL                     IMAGE:6994196.FL-MGC                                                                 GAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTACTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAATTCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAATGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTAGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAATTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAACTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Egg  5g                        TEgg143g09.p1kSP6 ATCCAGTGATGTCACCAGGGGTATAAATGCCAGAGGCAGCAAGAACAAAGGCAGAATGAGAAGAGAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCA
  5   1   4   12 seed Gas7 5g3  in                         XZG59518.5p ..............................................................GAGAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACGGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACCACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCA
  5   1   3        nb Neu0 FL                            IMAGE:6994196                                                                 GAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTACTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAATTCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGGAGGGACCCAGGCCCACTAAAATGGATTAATCTTACACCAACAATGGCAGTTTTGGCAGAACCAGGTC
  5   1   3        nb TpA  5g                        TTpA015o02.p1kSP6                                                                  AAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAAGCAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACNAACACGCAGTTGGCAGACAGGTACTTATGGACT
  5   1   3        nb Neu  5g                        TNeu144l17.p1cSP6                                                                        ACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCGGCCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTGGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGGAAACCCTTCACAGGAATGGGGCGCATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTGACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCATTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGATCGGACACTGTCGCTTGCTGGATGGTTTATTCCCTGAACAGTCTCATCTCTGCAAAATGAATCTTGAGCTGATGCAAAGTGTTGTGAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCGCTTCATTAGAGAATGCACCAAACTTCACCCCTGACTTGA
  5   1   3   22   nb Gas7 5g                               XZG8774.5p ...............................................................................GCCTCCTGTGGCCCTGCCTGACTACTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAATTCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATAAATCTACACAACAATGCAGTTGGCA
  5   1   3        nb Gas1 5x3  out                      IMAGE:6989602                                                                                                                                                                                CAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCNCATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAGTGCAGTGCCATGGTGTGTCTGGATNTGCTCAGTGAAGACCTGTGGAGGNNCTCAGATT
  5   1   0       chi Gas7                                 XZG23210.5p                                                                                                                                                                                                                                                          GCTGTGTGCTTCCATTCATTAACAGCCCCTACCATTCTAATGGAAAATAAGCATGACTTTGCATGGCAACGTTTTTGTGCAGCTTGTACCTTCCTCAGATTTCCTTTATGTCTATAGAAACAATAACTCTGCAGTACTATAGCAAAAGCTGCATCTTTATTGTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACA
  5   1   3        nb Egg                            TEgg125k24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAAT
  5   1   2       ext Egg                            TEgg131k19.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATAT
  5   1   0       chi Gas7      in                         XZG32944.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCAATTAGGCAGTGTCTGTCTTCAGTCTGACCCATTTATCTCCCTGATGTCTCGCCTCTGCACCAAGCTGATGAAAGACACTGAAAACTTATCCCCAAACGAGCAAATGTTGGTGGGGGGGATCTGAGAAATAGGACTTTAGGTATCCCAAGGATGGTGAATATTCAAAGTGAATATTATCTAAACCAAAAGCTGCTATTGAATGAAATAATTACTGAGTAATAATAGCAATAGTAACTTAAAACTAGCTTAAACTTCTGCTACCTGCAGGAATTATGTATTCTCCTTCCTTGTTACTACATGGGTGGCAGATCTTCTAATACCTTGCAGCTGTGAGCACTCTTTCTTGGTTCTCAATATACCTCTGTGTATCGGCTAACAACCTAACCAGATGCATTTTTTCTCCCATAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTATACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTT
  5   1   3        nb Egg                           TEgg142k21.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCGGGGCCTTAAATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGT
  5   1   3        nb Egg                            TEgg102a24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGACAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTAT
  5   1   2       ext Neu                            TNeu022h18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTNTAAACTTCTCTTCTGGATTAAAGCTANGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAG
  5   1   3        nb Egg                            TEgg133p16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTG
  5   1   2       add Tad5      in                         XZT31642.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGTAAGATTATCCTTATATTAAAAATGAAGTAATTATTAATATTGGTGTTAATTGGGGTAAAAGTTCTATTGTGTTTTCTTACAAAAGTAATAGCATATCTGTAGAACTACAAGTCACTGCTAGCAAAAATGGTGGCATGGAAGGGATGATGGCATATCATCTATTAACATTGCATGTTGCCTTGGTCTCATTGCCCATCAAGTGCTCTGAAGTTACAAATTTTACCTGTCATAGAAATGTCATCAACTATTGCCCTGTATATTTTTATGGATGTCTGGAGTCAATTAGGCAGTGTCTGTCTTCAGTCTGACCCATTTATCTCCCTGATGTCTCGCCTCTGCACCAAGCTGATGAAAGACACTGAAAACTTATCCCCAAACGAGCAAATGTTGGTGGGGGGGATCTGAGAAATAGGACTTTAGGTATCCCAAGGATGGTGAATATTCAAAGTGAATATTATCTAAACCAAAAGCTGCTATTGAAATGAATAATTACTGNNAGTATATAGCAATAGTAAC
  5   1   2       ext Egg       in                   TEgg023e10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCCGGGAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAG
  5   1   2       ext Neu       in                   TNeu069l07.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGGGCATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACT
  5   1   2       ext Gas       in                   TGas097a01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAATGAACTTTTATATTGACTGGA
  3   1   2       ext Gas       in                    TGas097a01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCA
  3   1   2       ext Neu       in                    TNeu069l07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAAAAAAAAAAAAAAAAAAA
  3   1   2       add Tad5      in                         XZT31642.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAGCAAAAAAAAAAAAAAAGG
  3   1   2       add Gas7      in                         XZG32944.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTGGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAGCAC
  3   1   3        nb Gas8      out                         st17n11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCTNTTCAGGNTGAAGTTTGATAGCCCGTAACNACNANGGNTTTNTTGCCNGGTCNAGGNACCCNAGNGNTACCTNTGGNGNCTGAAAATAGNCTGGGNGNCNNGTAATAATATGTATTTAACTAGCNGCCCCNGNCTGAACNTATTTNTTAATNCNCNTGNCCCTCCCNTCNGGCNTTTGCCNTATGNTGCCNAACTTTGGNGCGGTTAGTTTTCNGGGGCCNGTTAAAGAAGCCNGCNANGNGACNTAACNTTTTTNTTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATT
  3   1   2       ext Egg       in                    TEgg023e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAGCACAAAAAAAAAAAAAAAAAA
  3   1   4      seed Gas7 5g3  in                         XZG59518.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTGTTGGGTGGCGGGGTAAAAAGGTTTTACCTTTCCAATGTTGGCCTTGAAAAATCCCCCAAAAATTTTCGGCTAAAAACCCAAACCCCCTTAATGGGGCCTCCGGAAAGGTGGCATGGAACCCAAATTTTTTGGGGGCCCATATGGAAAAAAAAAAAGGGGCCGGTAAAAAGGGCTTTTTAATACCCCCTAGGGAGATTTAGAAGATTTCCCCCTCATCCTCGTTTTGGAAAAGTAGCGGGGGCCCCATTAGCATTGACCCTTTTGCCCTAAAACCCAAAACGGGGGGGGGGTCGGTTTTTCCTACTTTTTTCCCCGGGGGGTTTGAAAAGGAGTTTTTACCCCCTGGGGGGGTTTTTCCAGGAAAAAAAATCTTAACCAGGGCAGACAGGGGGGCCCCCAAATAGGGCCAGGGGGGGGGGGGGGGCATTTGCCCCCCCCCAGACTTGCCCTTTATAAAAAAGGGTATTCCCTTGTTATATATATATATATATATATATAGGTACCCATTTTTTTTGTTTGGTTCGGTTTGGAAAAGGGGCCCATTTCTTGGGATTCCCTTTAAATAAATAAAAAAATAAATCCAAAAAAAAACC
  5   1   2  SIG                                      Xt7.1-XZG12840.5                                                                                                            TGACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGTAAGCTTATCCTTATCTTAAAAATGAAGTAATTATTAAGATTAGCTTTAATTGGGGTAAAAGTTCATACAAAAATAATAGCATATCAGTAGAACTACACGTCACTGCTAGCAAAGCTGGTGGCATGAAAGGGAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCCAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACACCATCATGTGCTTTGAAAGTACAAATTTTACCTGTCGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTT------------------------TTTCAAACAAACGTTATTATTGCTAAGTTTGACTGGAACACAATGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTGCGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCCTATTTAAGGAGGAAGAAAACACCCCAAGTGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCAC
                                                  Xt7.1-CHK-1008286186                                                                                                                  CTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGTAAGCTTATCCTTATCTTAAAAATGAAGTAATTATTAAGATTAGCTTTAATTGGGGTAAAAGTTCATACAAAAATAATAGCATATCAGTAGAACTACACGTCACTGCTAGCAAAGCTGGTGGCATGAxAxGxAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCCAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAxCxxxxTGTGCTTTGAAAGTACAAATTTTACxxGxxGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCT------------------------TTTTTTTTTCAAACAAACGTTATTATTGCTAAGTTTGACTGGAACACAATGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTGCGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCCTATTTAAGGAGGAAGAAAACACCCCAAGTGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATA
  5   1   2       ext Egg  5g                        TEgg080n13.p1kSP6                                                                                 CTCTGTCTGCCTCCTGTGGCCACTGCCTGACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGT
  5   1   2   22  ext Gas7 PIPE                            XZG12840.5p ...................................................................................GTCTGCCTCCTGTGGCCACTGCCTGACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTC
  5   1   3        nb Gas8 5x3  out                         st17o11.5p                                                                                                         GCCTGACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGANGTGCCCGGAA
  5   1   3        nb Egg  5g                        TEgg113o08.p1kSP6                                                                                                                                                         CTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGAT
  5   1   4      seed Tbd0      in                       IMAGE:6978046                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCCAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCCTCTATGGTTCTGGCAAACAGTCCTTCCCCTGGCAGTGGGGAAAAGCAAAAACTGGGGAC
  5   1   1       add Gas7      in                         XZG47047.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAATGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTAGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGTAAGCTTATCCTTATCTTAAAAATGAAGTAATTATTAAGATTAGCTTTAATTGGGGTAAAAGTTCATACAAAAATAATAGCATATCAGTAGAACTACACGTCACTGCTAGCAAAGCTGGTGGCATGAAAGGGATGATGGCATTTCAGGTCTGCAACAGCTTTGTGCTACAGGGTATATTTAATCTATTAACATTGCATGTTGCCTTGGTCTCATTGCCCATCATGTGCTTTGAAAGTACAAATTTTACCTGTCATAGAAATGTCATCAACTATTGCCCTGATTATTTTCATGGATTTCTGGAGTCAATTAGGCAGTGTCTGTCTTCAGTCTGACCCATTTATCTCCCTGATGTCTAGCCTCTG
  5   1   2       ext Gas7      in                          XZG4619.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCAT
  3  -1   2       ext TpA       out                   TTpA015o04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTTTTTTTTCAAACAAACGTTATTATTGCTAAGTTTGACTGGAACACAATGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTGCGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCCTATTTAAGGAGGAAGAAAACACCCCAAGTGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCACGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAATAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAAT
  3   1   4      seed Tbd0      in                       IMAGE:6978046                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGATTTGGAATGGGAAAGTGGCCTATCCAGGGTAGGGCCCCCCTATACATTCCCTGTTGCCCAGGCAGTTACTGCACCTGCTTCTCTTGTTGCTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCNCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACAT
  3   1   2       ext Gas7      in                          XZG4619.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTGGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACTTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAAGGGTATTCTCTTGTTATATATATATATGTATACATTTTTTTTTGTTTTGTTCTGTTTGGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATCCAAAAAAAAAAAAAAAAN
  3   1   3        nb Gas0                                 dad53e05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATGTATACATTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACAATCTGTGATTACTTTAAAAAAA
  5   1   2  SIG                                       Xt7.1-st41h05.5                                                                                                              ACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCT------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------GAGCGGACAGTGGAGCGATATGTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAAATTGATATTTGCTGC
                                                  Xt7.1-CHK-1008286196                                                                                                                    GCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ACAGTGGAGCGATATGTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAAATTGATATT
  0   1   1           Neu  FL                     TNeu076g04.FL-Sanger                                                                                                                                   ACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCTCTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAGACCATCGTAGAGCGCTGTCAGTGCAAGTACTACTGGTGCTGCTATGTCATGTGTAAGAAATGTGAGCGGACAGTGGAGCGATATGTCTGCAAGTAAAGCCATAATGAACTCCTCACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGCTGCAAAAAAAAAAAAAAAAAA
  5   1   4      seed Gas8 5g3  in                          st41h05.5p                                                                                                              ACTGCTGCCTTCTGCACTGAGACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTACGCTCTGGCCTCTGCCACTATCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGG
  5   1   3        nb Neu  FL   in                   TNeu076g04.p1cSP6                                                                                                                                   ACTTCACAGGACACATCCTATACTGAACTCCCCAGTGCACTAGTTTATCACAGAAATCTTTTACGATTGCATCGCACGACTTTCACTACAGAGATCACGATTACCCTATTAGAAAGAAAGGAAAACCCATCACAGGAATTCTGCACATCCAGTACCTTCACTTTTTCTTTGCACCGGACCCTCTTTTTACCCCCTGCACTACCAATGGCTCTAATCCGTCACTGTGTCACCCTACTACTCATCTTGTGCTGCTCCAGGCTCTGTGGCGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGAACACTGTCGTTTGCTGGATGGTTTATCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACATTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAG
  5   1   2       ext Gas       in                   TGas068c02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AATGTGAGCGGACAGTGGAGCGATATGTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGACTCA
  3   1   3        nb Neu  FL   in                    TNeu076g04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTCTTCAGGCTGAAGTCTGATAGCCAGTAACAACAATGGATTTATTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAATAGACTGGGTGACATGTAATAATATGTATTTAACTAGCAGCACCAGACTGAACATATTTATTAATACACATGACCCTCCCATCAGGCATTTGCCATATGCTGCCAAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAATTGATATTTGC
  3   1   4      seed Gas8 5g3  in                          st41h05.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCTCATCAATATATGGGCCCTGAGTGGCTTCCAGAAACTCAAGTACGAAATATGTATAGTTTCCCCTTCTGATATGGAACTGCCAAGCCATCCTNTTCAGGCTGAAGTTTGATAGCCNGTAACAACAATGGATTTATTGCCNGGTCAAGGAACCCAAGTGATACCTNTGGNGACTGAAAATAGNCTGGGNGACATGTAATAATATGTATTTAACTAGCAGCNCCNGNCTGAACATATTTATTAATACNCNTGACCCTCCCNTCAGGCNTTTGCCATATGCTGCCNAACTTTGGAGCGGTTAGTTTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACTGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTNTTATCTGNAAAGTCTGAATTTNAGACATNGAGACATAAAGTCTTAGAAAATAGT
  3   1   2       ext Gas       in                    TGas068c02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTTCAGGGGCCTGTTAAAGAAGCCAGCAATGTGACATAACTTTTTTCTTTTTTTTTTTCCTTTCTTTTCAAAATGAACTTTTAATATTGACTGGAAAATGAGGCACAGATTACTCACTGGAAATCTGAATCTGGGACTTAGGACTCATTAGGATTTCGGTTACCACTTGCTAAAAGTCGCCCACGGTATATGTGGGTATGTATGTATATGTGTATAACGGGATATGACGTTCAGAATTTTCTGGACCTTTTTTATCTGTAAAGTCTGAATTTTAGACATTGAGACATAAAGTCTTAGAAAATAGTTTTTTTTTAATATTTGTAAATGTTCTATTTTTTTAATAAAAATTGATATTTGCTGCAGCACAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                    Xt7.1-TNeu053m04.3                                                                                                                                             ATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGG------------------------GCCTCTGCCCTCTCGCCATACCATTGCCTGTCACTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTCCCTCCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTCTTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCAAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATTCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTTTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAA
                                                  Xt7.1-CHK-1008286180                                                                                                                                                   ATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGC------------GCTCTGGCCTCTGCCCTCTCGCCATACCATTGCCTGTCACTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTCCCTCCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTCTTTTxxAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCAxxxAAxTTGAATCTGATGTGTGTGTGTGTGxxxxxAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATxCxTTxGTTTGGCATAGATTTCACTTTCAAxxxAxAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTTTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATACAA
  0   1   1           Gas  FL                     TGas144p20.FL-Sanger                                                                                          CCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTGCCACCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCCTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGCTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATACAAAAAAAAAAAAAAAAAA
  5   1   2       ext Gas  5g3  in                   TGas077m06.p1kSP6                                                               GAGAAAGGCACTGACTGCCTCCTGTGGCCACTGCCTGACTTCTGACTGCTACCTACTGCACTTTACAGGACATTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAG
  5   1   4      seed Gas  FL   in                   TGas144p20.p1kSP6                                                                                                         CTGACTGCTACCTACTGCACTTACAGGACTTTTCCTATACAGATCTCTACTACCAGCGCACTAGTCCATCACAGAAATCTTTTTTTACAATCACGTCGAACAACTTTCACTGCAGAGATCGCGATTACCCTCTTGGAAAAAGGGAAAACCCTTCACAGGAATCCCGCACATCCAGAACCTTCACTCTTTTTATTTTTTGCACCAGACCTTTTTATCCCCCTGCACTAGCAATGGCTCAGATCCATCACTGTGTCACCCTGCTACTCATCTTGTGCTGCTCCGGGCTCTGTGGTGCCATCCAGTGGCTTGGTCTCACTGTGAATGGCAGCCGGGTGGCCTGGAATGAGAGCGGACACTGTCGCTTGCTGGATGGTTTAGTCCCTGAACAGTCTCAGCTCTGCAAAAGGAATCTTGAGCTGATGCAAAGTGTTGTTAATGCTGCCAAACAGGCCAAGCTGACATGCCAAATGACCTTCTCTGACATGCGCTGGAACTGCTCTTCAGTAGAGAATGCACCAAACTTCACCCCTGACTTGAGCAAAGGTACCAGGGAATCTGCCTTTGTTTATGCTCTGGCCTCTGCCACTCTCAGCCATACCATTGCTCGTGCTTGTGCCTCAGGGGAGCTGCC
  3  -1   1       add Neu       in                    TNeu053m04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCTCTGGCCTCTGCCCTCTCGCCATACCATTGCCTGTCACTTGTGCCTCAGGGGAGCTGCCCACATGCTCTTGTGGTCCCTCCCCAGCTGAGGTGCCCGGAACAGGCTTCCGATGGGGAGGATGTGGGGACAACCTCCATTATGGCCTTAACATGGGCTCTGCTTTCGTTGATGCTCCAATGAAGTCAAGCAAGTCAGGAGGGACCCAGGCCACTAAAATGATTAATCTACACAACAACGCAGTTGGCAGACAGGTACTTATGGACTCACTGGAGACAAAGTGCAAGTGCCATGGTGTGTCTGGATCTTGCTCAGTGAAGACCTGTTGGAAGGGCCTCCAGGATCTTCCCCATATTGCTAATGAGCTGAAATCTAAGTACCTTGGTGCCACCAAAGTCATTCACAGACAGACTGGCACTCGGAGGCAGCTCGTTCCCAGGGAGCTAGACATCAGGCCAGTGAGAGAGTCTGAGCTGGTGTACCTGGTTAGTTCCCCTGACTACTGCGCAAAGAATCCCAAATTGGGCTCATATGGAACACAAGACAGGGTGTGCAACAAGACCTCCGTTGGGAGCGACAGCTGTAACCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGAT
  5   1   2       ext Gas7      in                          XZG3794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCTAATGTGCTGCGGGCGCGGATACAACGCATACACGGAAACCATTGTGGAGCGCTGTCAGTGCAAGTACTACTACTGCTGCTATGTCGTATGTAAGAAATGTGAGCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATTCTTTTGTTTGGCATAGATTTCACTTTCAAAGCAAAC
  3   1   2       ext Gas  5g3  in                    TGas077m06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGGTTTTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTTTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTTTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTTAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1       add Gas7      in                         XZG28695.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCGGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGCTACACTGATGATG
  5   1   2       add Tad5                                 XZT56426.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CGGACGCGTGGGCGGACGCGTGGGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGA
  5   1   2       ext Gas7      in                         XZG24114.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGTTACACTGATGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAACTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTT
  3   1   4      seed Gas  FL   in                    TGas144p20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTTTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTTTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGGGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATACAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG28695.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATAGGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATAC
  3   1   2       ext Gas7      in                         XZG24114.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTGCAACACATACTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAACTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTTTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATACAAATAAAAGCTGAAAAAAAAAAAAAAAAGG
  3   1   2       add Gas7      in                         XZG47047.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCTGCAACACATATTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAACTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACTTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAAT
  3   1   2       ext Gas7      in                          XZG3794.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTGGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCAGGGGCCACATTAGCATTGACACTTCTGCCTTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATC
  5  -1   2       add Neu       in                   TNeu053m04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCCCCCCCAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATACAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-XZG58060.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGCTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGGTACCTGTGTGACTT------------------------TAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATATTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATCCCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATGGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCGGGGGCCACATTAGCATTGACACTTTTGCCTTCAAACACACAACAGCAGAGGTGTCAGTTCTTCCTACTGTTTTTCCCGGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCGGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAA
                                                  Xt7.1-CHK-1008286194                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGCTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGGTACCTGTG------------------------AGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATATTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATCCCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATGGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCGGGGGCCACATTAGCATTGACACTTTTGCCTTCAAACACACAACAGCAGAGGTGTCAGTTCTTCCTACTGTTTTTCCCGGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCGGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAA
  5   1   4      seed Gas7      in                         XZG63945.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGGACAGTGGAGCGGTATGTCTGCAAGTAAAGACATAATGAACTCCACACTGTACACTACTAAAGCACTGACAGCCCTCTATGGTTCTGCAAACAGTCCTTCCCTGGCAGTGGGAGAGGCAGAGCTGGGACTTTAAACTTCTCTTCTGGATTAAAGCTAGGGGAAGCCAAATGCAGCTGGTCTGATCTGCTTGCCCATCAATATATGGGCCCAGAGTGGCTTCCAGAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTT
  5   1   2       ext Gas7      in                         XZG58060.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAAACTCAAGGACCAAGCACGACTGAGCCTTCTGATATGGAACTGCCAAGCCATCCTCTTTAAGCTGAATCTGGATTTGTTGCCAGGTCAAGGAACCCAAGTGATACCTCTGGTGACTGAAAAAAGACTGGTTGACATGTAATAATATGTATTTAATTGGCATCAACAGACTGAACATATTTATTAATACACATGACCCTCCTATTATAATTTGGGGTTATTCTGTTTCAGGGGCCAGGTTAAGAAGCCAGCAATGTGACTTGCAACTTTTTTTCAACTTTTTTTTTCTTTTCAAAACAAACGTTATTATTGCTAAGTTTGACTGGAACATAAGGCACAGAAATTTGAATCTGATGTGTGTGTGTGTGTGTAAAGGAATTCAGTGTTCACTTGGTTGACACCAAGGGAATATAGGACATTTTCTAGCTGGTAAATGTCTGGTCAAAATATGGCTGTTGTCCTGACCCATGTCATCATGTTAGTGTTCTGCCATCCTTTGTTTGGCATAGATTTCACTTTCAAAGCAAACAGTTAATTGAAAACTCATATTTAAGGAGGAAGAAAACACCCCAAGCGGCCTCTGATTTGAATGGGAAGTGCCTATCAGGGTAGGGCCCCTATACATTCCTGTTGCCCAGCAGTTACTGCACCTGCTTCTCCTGTTGCTACACTGATGATGAAGAGCCACAATGTCTTATAATGAACCAATATCATTGTCTCCCCCTGATGAAATGGAGTTAACATATCTGCCTGTGGATTAATGTTTTTAAGATCTCCAATCAGTGCTGGGAGTAGTATATTTAATAGATTCCATTGAGGACAGTTGGGTACCTGTGTGACTTTTCCC
  3   1   2       ext Gas7      in                         XZG58060.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATATTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATCCCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATGGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTTTGACAAGTAGCGGGGGCCACATTAGCATTGACACTTTTGCCTTCAAACACACAACAGCAGAGGTGTCAGTTCTTCCTACTGTTTTTCCCGGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCGGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAATAAATCC
  3   1   4      seed Gas7      in                         XZG63945.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGTTGGTAACCTGTGTGACTTTTCCCATAGAGAACAAGGAAATCTGTTATCTTCCTGCAACACATATTGAGCTACACGTCTGTTGTGTGGCAGGGTATAAATGTATTAACTTTCCAATGTTTGACTTGAAAAATACCACAAAAAATTTCAGCTAAAAAACCAAAACCACTTAATTGTGACTACTGAAATGTTGCATAGTAGCCAAATTATTTTGTGGTCCATATTGAAGAAAAAATACGTGCCTGTAACAATGGCTTTTTAATAGCCCCTAGTGAGATTTAGCAGATTTCCCCCTCATCCTCGCTTCTGACAAGTAGCAGGGGCCACATTAGCATTGACACCTCTGCCCTCAAACACACAACAGCAGAGGTGTCAGATCTTCCTACTGTTCTTCCCTGGAGGCTTTGAAATGAGATTTTAGCCACTTGAGCTGTATTTACATGTAAATAAATCCTAATCAAGGCAGACATGGGCGTCCACAGATAGGGGCATGGGGGGGGGGGGTGCAGTTGCCCCCACCCAGACTTGCACTTTATAATAAAGGGTATTCTCTTGTTATATATATATATATATATATATATGTATACATTTTTTTTGTTTTGTTCTGTTTTGTATATGAGCACATTTCTTGTGATTACCTTTAAATAAATAAAAAAAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)