Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAM2973.5                            8 END     1           6       12                Unknown (protein for MGC:146152) [Xenopus tropicalis]
     2   2.0    0Xt7.1-CAAM1191.5                            7 END     3          20       50                Unknown (protein for MGC:146152) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 72%

 1012078996 Xt7.1-CABI4881.3 - 15 ESTs
                                                                       .-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABI4881.3                                                                                                                                                                                                                                                                                                                                                                GCACTTGTACAGACGCACCACCTGCAGTGTTAGAATTCTCTGTTCAGATAGTCACAATTTTGTTGCTGATTACTGCAGTCACAATTGGGGCGCCTACTAAATGGAGCATAACCTGGCACTATAGTTTGTTGGTCAGGGCGAATCTCAGTTTCTTAGTTTTGAGCAGTATGTCACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCTAAATCA
                                                  Xt7.1-CHK-1008232686                                                                                                                                                                                                                                                                                                                                                                      GTACAGACGCACCACCTGCAGTGTTAGAATTCTCTGTTCAGATAGTCACAATTTTGTTGCTGATTACTGCAGTCACAATTGGGGCGCCTACTAAATGGAGCATAACCTGGCACTATAGTTTGTTGGTCAGGGCGAATCTCAGTTTCTTAGTTTTGAGCAGTATGTCACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     7     7     7     7     7     7     7     7     9     9    11    11    11    11    11    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    13    13    13    13    13    13    13    13    12    12    12    12    12    12    13    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    10    13    10    13    10    13    10    13    10    13    11    13    10    13     9    12     9    12     9    12     9    12     9    12     6    11     6    11     6    10     9    10     6    10     6     9
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------G-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -----G--G---
                                               ORF LNG     481       5                                                                                                                                                                                                                                                                                                                                                                
                                                      Xt7.1-CABI4881.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAAATG------------------TAG---------------------------------------------------------------------------------------ATG---TAA---------------------------------------------------------------------------TAA------------ATG---------------------ATGTAG---------------------------------------------------------------------TAG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------TAG------------------TAA---------------------------------------------------------TAA---------TAG------------------------------------------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                       ]
  5   1   2   13  bld Ski1 5g3  in                         CABJ7485.5p TTACAAGGTTTCATCCAAATGCAAATGAAAAAATCTAAAACCAAATGCAAAATCCCACCTTTCCTTGCTGCCCAATGTGACCTCTTTCTGACTAGTCCACCTAGGGTTCATTTGAGGTTCTTACACTGACACATACAGTAAGAGAAAACCTTTTAAATGAAGTTTAGGCTAATGCCACACACCGTGGTGGCTGTTTGGAGTTGAAGAAACTGCCCCATGTGACATTAGACCAAGTTCCCAATTTTAAGTAAAATACAAGATGTTTGTCTTTGCAAGGTGAGCGGAGAAGTTAGTGACTAGTCTGTAACTATGTTGGGCTGTTTTACACCACAACTCGAGCTCCAGCTCTATGCACTTGTACAGACGCACCACCTGCAGTGTTAGAATTCTCTGTTCAGATAGTCACAATTTTGTTGCTGATTACTGCAGTCACAATTGGGGCGCCTACTAAATGGAGCATAACCTGGCACTATAGTTTGTTGGTCAGGGCGAATCTCAGTTTCTTAGTTTTGAGCAGTATGTCACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCC
  5   1   2       bld Egg  5g                        TEgg082c08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                GCACTTGTACAGACGCACCACCTGCAGTGTTAGAATTCTCTGTTCAGATAGTCACAATTTTGTTGCTGATTACTGCCGTCACAATTGGGGCGCCTACTAAATGGAGCATAACCTGGCACTATAGTTTGCTGGTCAGGGCGAATCTCAGTTTCTTAGTTTTGAGCAGTATGTCACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTA
  5   1   2       bld In63 5x3                        IMAGE:8958662.5p                                                                                                                                                                                                                                                                                                                                                                                                                   TACCCCAGTATATAATAGGATCCCATAAAATTCGAATTCGTCCCACTAAATGGAGCATAACCTGGCACTATAGTTTGTTGGTCAGGGCGAATCTCAGTTTCTTAGTTTTGAGCAGTATGTCACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACCGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACAGCATGTCATTTTGTGCACAACATCCTCACTTACTTAAAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGTTTGGTGTTCAAGGGATAAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTTAGACAGTGTTATCTGAGTCATTTGCATGTCATCTTTTTTGTTCAGCAACAGTTTTAGCATTCAGCTTATTCTTGGTGGCCTAGGGGAC
  5   1   2   10 seed Ovi1 5g3  in                         CABI4881.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................CATCGATTCGCTAAATGGAGCATAACCTGGCACTATAGTTTGTTGGTCAGGGCGAATCTCAGTTTCTTAGTTTTGAGCAGTATGTCACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATT
  3   1   2       bld Int1 5g3  in                        CAAP11197.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATGCCTCTCGCCCTATAGGAG
  5   1   2   10  bld Int1 5g3  in                        CAAP11197.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ACATTCTGGGAATTTCACTCAGCATGTAAAGAGCAAGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTTGTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTTGACATTGGAA
  3   1   2       bld Te3  FL   out                       CAAM13898.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GAGCAAGGGGATGCTATAATGCTTTAATTTCTGTATAACAGTTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTACAGAAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCGGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCTAAATCAATT
  3   1   2       bld Te3  5g3  out                        CAAM2973.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTCCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTGGTGTTCAAGGGATAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAGAAAATAGAAAGAACAATACTCTTAAATCAATT
  3   1   2       bld Ovi1 5g3  in                         CABI4881.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCTTCCATCTTTCCTCAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCTAAATCAATT
  3   1   2       bld Brn3 5g3  out                        CAAK2534.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCGGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCTAAATCAATT
  3   1   2       bld Ski1 5g3  in                         CABJ7485.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CAGCTTGTACAACAGAAGCACGTGGCTTTCCATTTAATTCTGCCATCTTATGTATGTTACAGAATCCCTTTGCATGTAGAAACGGCATGTCATTTTGTGCACAACATCCTCACTTACTTACAATTCCTGCTCCCAGCTGCTGATTGGTTAGACTCGCTCTCCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCTAAATCAAT
  5  -1   2       bld Egg                            TEgg113e14.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCAGCCCCACTCTGTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTGGTGTTCAAGGGATAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAGAAAATAGAAAGAACAATACTCTTAAATCAATTAAAAAAAAAA
  3   1   2       bld Te3  5g3  out                        CAAM1191.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTGTGGTGTACTTTGTCATGTGCTTGCCCTTTAATCCCACAAAATATGTGGGCTGTTGCCTTCTCGCAGGTTAATCGGTACATCTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTGGTGTTCAAGGGATAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAGAAAATAGAAAGAACAATACTCTTAAATCAATT
  5   1   2       bld Neu       in                   TNeu119j19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTAGGCATTTGCTTTTTATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCTAAATCAATT
  3   1   2       bld Neu       in                    TNeu119j19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATATAGGCATAGGCAGCATTACTTTGGGTACAACGCTATCAATGAATGGGTACTAATCACTGAAATAATTATCTCTATTAAGCTAATGGGCACTACAACAAGGAATTCTGTAAATATGTTTAAAAATTCTCTCTCTATGACTTTCTCAATAGCCTGTCTTGGAACATTGCCTGCTGGGCTGCAGGTCGTAGCAGGTTTCTGCGGGGGGGATGCATGTTATTCATTGTATTCATTGGTTGCTTGTTAGATTACTTTTGGCAAATTGTAATCACCTTGTTCCTGTCTCCAGATTGAGGGGTTTCGTGTTCAAGGGGTAGCTTACCTTTAAATTAACTTTTAGTGTGACAGTGTAGACAGTGGTTATCTGAGGTCATTTGCAATTGGTCATCTTTTTGTTCAGCAACAGTTTAGCATTTCAGCTATCTGGTTGCTAGGGCCGATTTACCTTGACAATTGGAAAATGAATAGAAAAGGGGAAAAAAATAGAAAGAACAATACTCTAAATCAATAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)