Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TNeu057l10.3                         40 END     1           3        2                F-box only protein 22 [Xenopus tropicalis]
     2   2.0    0Xt7.1-CABK10046.5                           5 END     1           3       20                (no blast hit)
     3   2.0    0Xt7.1-CAAO1987.5                            4 END     4          14      100                LTBP-1S protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012079022 Xt7.1-CAAO7645.3 - 28 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO7645.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTGGAAAAGAAATATGCAAAAATGGCTACTGCCTGAACACAGAGTCCAGTTATGAGTGCTACTGTAAGCAAGGCACATATTATGATCCTGTTAAGCTGCAGTGTATCGATAATAATGAATGTGAAGACCCAAGCAGTTGTATTGATGGTCAGTGCATAAACAACGAGGGATCTTACAGCTGCTTCTGCACACACCCCATGATTCTCGATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTCAATAATTAAAATGATATATAAATATACATTTAGTTTGTATAGGGAGCAACAAGTACACACAAAAACACACATTTC
                                                  Xt7.1-CHK-1008228661                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGAAATATGCAAAAATGGCTACTGCCTGAACACAGAGTCCAGTTATGAGTGCTACTGTAAGCAAGGCACATATTATGATCCTGTTAAGCTGCAGTGTATCGATAATAATGAATGTGAAGACCCAAGCAGTTGTATTGATGGTCAGTGCATAAACAACGAGGGATCTTACAGCTGCTTCTGCACACACCCCATGATTCTCGATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTCAATAATTAAAATGATATATAAATATACATTTAGTTTGTATAGGGAGCAACAAGTACACACAAAAACACACATTTCCGCAGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     6     6     6     6     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     8     8     8    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    12    14    13    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    16    15    16    15    16    14    15    14    15    15    16     6     7     7     8     6     8     6     8     7     9     7     9     7     9     7     9     6     9     7     9     7     9     8    10     7    10     7    10     7    11     7    11     7    11     8    11     8    11     8    11     8    11     8    10     8    10     8    10     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8    10     8    10    10    11     7    11     7    11     8    11     8    11     9    12     9    12     9    12     9    11     9    11     9    11     9    11     9    10     9    10     9    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     6     6     4     6     3     5     3     5     3     4     3     3     2     3
                                                                                                                                                                                                                                                                                                                                PREDICTED - Bf ---- 4e-012     CAC19873.1 putative notch receptor protein [Branchiostoma floridae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 3e-014     NP_498670.1 EGF-like domain EB module [Caenorhabditis elegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Xt ---- 2e-014     AAH63920.1 Hypothetical protein MGC76198 [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 1e-016     NP_726551.2 CG31999-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 1e-017     ABJ09595.1 gamma-carboxyglutamic acid protein 4 [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 4e-033     XP_784696.2 PREDICTED: similar to fibrillin [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-073     NP_038617.1 latent transforming growth factor beta binding protein 2 [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 2e-098     XP_692368.1 PREDICTED: similar to LanC (bacterial lantibiotic synthetase component C)-like 1 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 2e-134     NP_000618.2 latent transforming growth factor beta binding protein 1 isoform LTBP-1S [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 3e-136     NP_996841.1 latent transforming growth factor beta binding protein 1 isoform b; latent TGFbeta binding protein [Mus musculus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 3e-139     XP_419510.2 PREDICTED: similar to latent transforming growth factor beta binding protein 1 isoform LTBP-1L [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-173     AAN76497.1 LTBP-1S protein [Xenopus laevis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO7645.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------TAA------------------------------TGA---------------TAA---TGA---------TGA------------------------TAG------TGA---------------------------------------------------------------------------------------------------------TAA---------------------------------------------ATG------------------------------------------------------------TAA------------ATG---------------------ATG---------------------------------------------------------------------------------------------------TAG---------------TAA---------------------------------------TGA------------------------------------------------------------------------------------------------------------------ATG------------------------TAG---------------------------------TAA---------------------------------TAA------------------------------TAA------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       bld Hrt1      in                         CAAQ4694.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGGACTCCTTCGATGGGCAAGGGTGTGTGGATGTGAACGAGTGTGAGATGCTGAGCGGAGTTTGTGGGGAGGCCCGATGCGAAAACGTGGAAGGCTCATTCCTCTGTCTGTGTACTGATGAAAGCCAGGAATATGACCCTATGACAGGGCATTGCCGAAACCATAATTTGCACGGCATCAACTCCTTTGGAGACAGCAACACTGATAGTTTGCTTAATGCTTTCAGTCCCAGTGTTACCCATAATACAGATGAAAATGATGAGGATCAAAAGGACTGCTACTATAATATCATTGGGGACGACTTCTGTCAGAATGTGCTGGCTGCCAATGTTAGCAAGCAAGAATGTTGTTGTACATTAGGAGCCGGATGGGGAGACAATTGTGAGATCTACCCTTGCCCAGTCATAGGTTCTGATGAGTTTACAGAGATGTGTCCAGGAGGAAAAGGCTATATCCCATCAAAGGAGTCCATGTATGAGGGCAATGATTTATCTTATCAAGATGCTGATGAGTGTATGTTGTTTGGAAAAGAAATATGCAAAAATGGCTACTGCCTGAACACAGAGTCCAGTTATGAGTGCTACTGTAAGCAAGGCACATATTATGATCCTGTTAAGCTGCAGTGTATCGATAATAATGAATGTGAAGACCCAAGCAGTTGTATTGATGGTCAGTGCATAAACAACGAGGGATCTTACAGCTGCTTCTGCACACACCCCATGATTCTCGATGAATCA
  3   1   2       bld Te5       out                        CAAO1987.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGATGCTGATGAGTGTATGTGTTTGGAAAAGAAATATGCAAAAATGGCTACTGCCTGAACACAGAGTCCAGTTATGAGTGCTACTGTAAGCAAGGCACATATTATGATCCTGTTAAGCTGCAGTGTATCGATAATAATGAATGTGAAGACCCAAGCAGTTGTATTGATGGTCAGTGCATAAACAACGAGGGATCTTACAGCTGCTTCTGCACACACCCCATGATTCTCGATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGT
  3   1   2       bld Hrt1      in                         CAAQ4694.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCAAAAATGGCTACTGCCTGAACACAGAGTCCAGTTATGAGTGCTACTGTAAGCAAGGCACATATTATGATCCTGTTAAGCTGCAGTGTATCGATAATAATGAATGTGAAGACNCAAGCAGTTGTATTGATGGTCAGTGCATAAACAACGAGGGATCTTACAGCTGCTTCTGCACACACCCCATGATTCTCGATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAGCCTCTCGC
  3   1   2      seed Te3  5g3  out                        CAAM7041.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TACTGCCTGAACACAGAGTCCAGTTATGAGTGCTACTGTAAGCAAGGCACATATTATGATCCTGTTAAGCTGCAGTGTATCGATAATAATGAATGTGAAGACCCAAGCAGTTGTATTGATGGTCAGTGCATAAACAACGAGGGATCTTACAGCTGCTTCTGCACACACCCCATGATTCTCGATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGT
  3   1   2       bld Te3       out                        CAAM5371.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGCAGTTGTATTGATGGTCAGTGCATAAACAACGAGGGATCTTACAGCTGCTTCTGCACACACCNCATGATTCTCGATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGT
  3   1   2       bld Tail      out                        CBSW5946.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTACAGCTGCTTCTGCACACACCCCATGATTCTCGATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAACCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAA
  5   1   2       bld AbdN                               IMAGE:7023589                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGAATCAGGAAAAAGGTGTATCCAGCCAAAACCAGTGGATACAAGTGAACCGACTGAAGAAACAGATGTTTACCAAGACTTCTGCTGGCAAGAGCTCAGTGAGGAATTTGTGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAGATCAGCTACCTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTTAACTTGATGGGTTTTTATGGAAATTGCATTTGAGCGAAACCAAGTATTTAGAAAACCTGTGATGGTTTGGGCCTACTCCTCCACCAGTTTTCCGAAATTTATTTACCGAAACCAAAGCGGGAACTTGGTTTTTCTTCC
  3   1   2       bld Egg       in                    TEgg062b02.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCAGTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAA
  5   1   2       bld Egg       in                   TEgg062b02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTGTAGCCAGCCTTTGGTTGGAAGACGTACTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGT
  3   1   2       bld Brn3      in                        CAAK11093.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACGTCTTCCAACCAAAGGCTGGCTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAG
  5   1   2       bld Brn3      in                        CAAK11093.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TACGTCTTCCAACCAAAGGCTGGCTACTTATACAGAATGTTGCTGCTTATTCGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAA
  3   1   2       bld Te5       out                        CAAO7645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CGGAGAAGCATGGGGAATGCAATGTGCTCTTTGCCCTACCAAAGACTCAGAGGACTATGCAGAACTTTGTAACCTTCAGTACAGAAGGCCATATGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGAC
  5   1   2       bld Egg                            TEgg110f04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TGGACATGATGCACTTATAGACCCTTACACATCTCACGATTCCGGTCCATACGAGATTCCAGAACGTTATAGCTATGAAGAGCTACAGGCTGAAGAGTGTGGCATCTTAAATGGATGTGAAAATGGAAGATGTGTCAGAGTACAAGAAGGCTATACATGTGACTGCTATTGGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAACGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGGATGGGGACTGTGTATGTTACTTGAG
  5   1   2       bld Kid1      in                         CABA8140.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAAGAAGGCTATACATGTGACTGCTTTGATGGATACCATTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCT
  3   1   2       bld Eye       out                        CCAX9681.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGCCTATACATGTGACTGCTTTGATGGATACCATTTTGGATATGGCAAAAATGACTTGTGTTGATGTCAATGAATGTAATGAGCTAAACAGCAAGATGTCTCTTTGCAAGAACGCCAAGTGTATTAACACAGAAGGCTCCTACAAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTA
  5  -1   2       bld Neu       out                  TNeu057l10.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAGTGTGTATGTCTACCGGGCTACAAACCATCTGCAAAGCCCAACTATTGCACAGCACTGAACTCGGACAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAAAAGCGGCCGCGTCGACACTA
  5   1   2       bld Egg       in                   TEgg052c09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTGGATTGAATTGTATCTGCCATGAGGGAGATTTTATTAAAAACAGAACTCGGGCAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAAACGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCT
  3   1   2       bld Mus1      out                       CABH10524.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAAAGATGACAGTGAACTGGAGTAAAAAAAAAAAAAAAGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTCAAAAAAAAAAAGCCTCTCG
  3   1   2       bld Kid1      in                         CABA8140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TAAAAAAAAAAAAAAAGAATCAGCTACCTTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTC
  5   1   2       bld Limb      in                        CBSU5888.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGGAGTAAAAAAAAAAAAAAACGAATCAGCTACCTCTTTTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATG
  5   1   2       bld Hrt1                                 CAAQ6861.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTCAGCCCATATACTCTGCACTGTATAAAGGAATGGGGACTGTGTATGTTACTTGAGATGAAGATGGAACAGAAATTAAACTTGATGGTTTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTCAATAATTAAATGATATATAAATATACATTTAGTTTGTATAGGGAGCAACAAGT
  3   1   2       bld Egg       in                    TEgg052c09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGAGATGAGATGGGAACAGAAATTAAACTTGATGGTTTTATGAAATGCATTTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCCTCAAAAAAAAAAAAAAAAA
  5   1   2       bld Hrt1      out                       CAAQ12356.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTATGAAATTGCATTGAGCGAACCAGGATTTAGAGACTGTGATGGTTGGCCTACTCCTCACCAGTTTCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTCAATAATTAAAATGATATATAAATATACATTTAGTTTGTATAGGGAGCAACAAGTACACACAAAAACACACATTTCCACAGCGTTGTCCTTAGTAGGTAGAGCTTTGGCATTGGTTAAAAATATGTATGTACAGTATGTATTTGATGCATATTAA
  5   1   2       bld In63                            IMAGE:8961878.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CATTTCTAATTATTGAGGATTCCCTTATTAACAAATTCGTCCCGAATTATTACAGACCAAACGGACATGTTTTCTCTATGGGAAAAAACCCCAGAACCCAAGTGTATTGTCTGATTTTGCATAAATTTGTTGGAGAAATGACAGAGTGTTTTTTGTTATTTTAAACCGAATGTTACTATTTTCTACTATTGCTTTATTTACTTGGCATTTTAATAATGGCTGGAGCATCCTGTAACACTTGTTGACAATGCATCACGTTGGATCCTATTATATGACAGACCTGTCAAGAGGACAATATTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTCAATAATTAAAATGATATATAAATATACATTTAGTTTGTATAGGGAGCAACAAGTACACACAAAACACACATTTCCACAGCGTTGTCCTTAGTAGGTAGAGCTTTGGCATTGGTTAAAAATATGTATGTACAGTATGTATTTGATGCATATTAAACACGACTAGTGTATTTAAAGAACATCAGGGGTAATGAAATTGATATCAGAAGGTATTAAAGCTATTTTATTTGACCTTATTTGAATTTGTTTTTATGGGTA
  3   1   2       bld TbA                             TTbA013h22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GACAGACCTGTCAAGAGGACAATCTTTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTATACAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTCCATAAATCTGTGTTTGTCCTGGGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTAGGCCGAAAAAAAGCAGCAAATGTTTTTTAACTTTTCTTTCGTCTAGTAGTGCACTAAAATCCTTTCAGATTTTCCTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTGTTGTAGGTGTAATTAGACATATAAACCCCCCTGCCCACGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTGGTTTTTTAACATATTATAGCTGTCTATTATAAACCTCAATAATTAAAATGATATATAAATATCCATTTAGTTTTTATAGGGAGCAACAAGTACACACAAAAACACACATTTCCGCAGCGTTGTCTTTAGTAGGTAGAGCTTTGGTATTGGTTAAAAAATATGTATGTCCAGTATGTATTTGATGCATATTAAACACGACTAGTGTATTTAGTGAACATCAGGGGGTAAATTGGACTTTTGATATCAGAAATGTAATTAAAGGCTAATTTTATTTGACCTAAAAAAAAAAAAAAAAAAAGCG
  5   1   2       bld Limb                                CBSU4698.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTTTTTTTTGCCAATGTTTTCTAGGGCCATTTTCTAAGAACTTCTCACACGGTTATACTATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTCAATAATTAAAATGATATATAAAAAAAAAAAAAAAAAAAGACAAAAAAAAAAAAACGG
  3   1   2       bld Limb      in                        CBSU5888.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATACTTTTGGAAATATAGGTCAGTGACTTTTTATAAATCTGTGTCTGTCCTGTGGAGCAGGCAACCTTTTGTTTTTGATTCCTATCTTGGCTGAAAAAATGCAGCAAATGTTTTTTAACCTTTCTTTTGTCTTGTACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCCC
  5   1   2       bld TbA                            TTbA035g15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTGCACTTAAATCCTTTCAGACTTTACTTGCCAAGTTTCAGAGCTGCTGGAGAGAAATGTTAACCCCTTCTTGTACGTGTAATTAGACATATAAACCCCCCTGCCCATGTTTTTATGTGTAAATTGATTATGAAAAAGATCTTGTTTTTGTTTCTTAACATATTAAAGCTGTATATTATAAACCTC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)