Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAK4624.5                           12 END     8          22       66                MGC84302 protein [Xenopus laevis]
     2   2.0    0Xt7.1-CAAK8548.5                            4 END     1           2       25                MGC84302 protein [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012079040 Xt7.1-CAAK6368.3.5 - 35 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-CAAK6368.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCGCGTCAGGGGCCACCTCCCCAGCAACGGCCCCCACCACAGGGTCAACAGGTCCAAGGTCTAAGTCCTCAACCATCTTCACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATATCTGCC
                                                  Xt7.1-CHK-1008227371                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTCAGGGGCCACCTCCCCAGCAACGGCCCCCACCACAGGGTCAACAGGTCCAAGGTCTAAGTCCTCAACCATCTTCACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     4     2     4     2     4     2     4     2     4     2     4     3     5     3     5     3     5     3     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     4     7     3     6     3     6     3     5     3     5     5     5     5     6     5     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     5     6     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     6     4     6     4     6     4     6     4     6     5     6     4     6     4     6     4     6     4     6     4     5     3     6     2     6     2     6     2     6     2     5     3     6     3     6     3     7     3     7     3     7     3     7     7    10     7    10     9    13     9    13     9    13     9    15     9    16    11    20    11    19    12    20    13    21    12    20    13    21    12    20    13    21    13    21    10    23    15    23    15    24    23    24    14    23    13    23    12    22    12    22    12    23    12    23    13    23    13    23    13    23    19    23    18    23    19    23    19    23    19    23    21    23    21    23    21    23    21    23    20    23    21    23    21    23    21    23    18    21    19    21    18    21    16    20    17    20    17    20    17    20    17    20    15    20    13    21    13    21    13    21    11    20    12    19    11    19    11    19    11    18    11    16     7     7     3     6
  5   1   2  SIG                                      Xt7.1-CAAL6415.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGAGACCAACAGGAGGAGGACAAGCAGCTCATTGCAGATTTGGTTGTGACCCGGATGTCCCAGAACCTGCAGTGCAGCCCATCCCTGAGTCGCCCTACGCACGGCCCCCAGCCTCAGGCGCAGGTTGTTCACTCAAGATCCGCAACTCCCATTCAGCAGCAGCAGCAACAGCCCCAGAGACCCCCACCTCAAGGGGGCCCTCAAGCAGCCCAAGTTCCTGCGCGTCAGGGGCCACCTCCCCAGCAACGGCCCCCACCACAGGGTCAACAGGTCCAAGGTCTAAGTCCTCAACCATCTTCACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATAATATATCCTATAGCTTAGAGTACTCACCTGATGGG------------------------------------------------------------------------------------CCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAAT
  5   1   2  SIG                                      Xt7.1-CAAK6368.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTATTATTCTTCTCCTTCTCTTCCTTCTGCTTCTCCTCCTTCCTCTACTTTTCCTTCTTCTCCTTCTCCTTTTTTCTTGCTTCTTCTACTTTTCCTTATTATTCTTCTCCTTCTCCTTTCTTCTTCTCCTTCTCCTCCTTCTTCTTCTGTCCAAACATCTTGTCCCACTCCTTCCAACCCCTCCATCTTGTATCTTCCCTACTACCCCCCCACTCCCCAACTCATTACCCTCCTCCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATATCTGCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CACTCCTTCCAACCCCTCCATCTTGTATCTTCCCTACTACCCCCCCAC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             T-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -----------C
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------G----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -------T--T-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ------C-----
                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Bf ---- 2e-007     ABG36939.1 fibril collagen [Branchiostoma floridae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                          PROTEIN --- Sc ---- 1e-010     NP_014101.1 Involved in localizing cell growth with respect to the septin ring; Cla4p[Saccharomyces cerevisiae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PREDICTED - Xt ---- 1e-012     AAH88491.1 Hypothetical LOC496804 [Xenopus tropicalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 5e-016     XP_001231455.1 PREDICTED: similar to aczonin [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Ce ---- 4e-017     NP_508738.1 predicted CDS, prion-like Q/N-rich domain protein PQN-15, Prion-like Q/N-richdomain protein (pqn-15) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 4e-020     NP_730163.1 CG4877-PA, isoform A [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 2e-021     XP_782654.2 PREDICTED: similar to Cpsf6 protein, partial [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 5e-039     NP_038708.2 synapsin I [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 7e-043     XP_699270.1 PREDICTED: similar to Synapsin-1 (Synapsin I) [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 3e-044     NP_008881.2 synapsin I isoform Ia [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 2e-107     AAH81169.1 MGC84302 protein [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 2e-107     NP_001087750.1 MGC84302 protein [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-CAAK6368.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------ATG---------------------------------------ATG---------------------------------------ATG---------------------------ATG------------------------------------------------------------------------TGATAG---------------------------------------------------------------------------------------------------TAG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------ATG------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ]
  5   1   2  SIG                                      Xt7.1-CAAL6415.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGAGACCAACAGGAGGAGGACAAGCAGCTCATTGCAGATTTGGTTGTGACCCGGATGTCCCAGAACCTGCAGTGCAGCCCATCCCTGAGTCGCCCTACGCACGGCCCCCAGCCTCAGGCGCAGGTTGTTCACTCAAGATCCGCAACTCCCATTCAGCAGCAGCAGCAACAGCCCCAGAGACCCCCACCTCAAGGGGGCCCTCAAGCAGCCCAAGTTCCTGCGCGTCAGGGGCCACCTCCCCAGCAACGGCCCCCACCACAGGGTCAACAGGTCCAAGGTCTAAGTCCTCAACCATCTTCACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATAATATATCCTATAGCTTAGAGTACTCACCTGATGGG------------------------------------------------------------------------------------CCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAAT
                                                  Xt7.1-CHK-1008292226                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCAACAGGAGGAGGACAAGCAGCTCATTGCAGATTTGGTTGTGACCCGGATGTCCCAGAACCTGCAGTGCAGCCCATCCCTGAGTCGCCCTACGCACGGCCCCCAGCCTCAGGCGCAGGTTGTTCACTCAAGATCCGCAACTCCCATTCAGCAGCAGCAGCAACAGCCCCAGAGACCCCCACCTCAAGGGGGCCCTCAAGCAGCCCAAGTTCCTGCGCGTCAGGGGCCACCTCCCCAGCAACGGCCCCCACCACAGGGTCAACAGGTCCAAGGTCTAAGTCCTCAACCATCTTCACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATAATATATCCTATAGCTTAGAGTACTCACCT------------------------------------------------------------------------------------------------CAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAA
  5   1   4      seed Brn3      in                        CAAK10707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTGGAGACCAACAGGAGGAGGACAAGCAGCTCATTGCAGATTTGGTTGTGACCCGGATGTCCCAGAACCTGCAGTGCAGCCCATCCCTGAGTCGCCCTACGCACGGCCCCCAGCCTCAGGCGCAGGTTGTTCACTCAAGATCCGCAACTCCCATTCAGCAGCAGCAGCAACAGCCCCAGAGACCCCCACCTCAAGGGGGCCCTCAAGCAGCCCAAGTTCCTGCGCGTCAGGGGCCACCTCCCCAGCAACGGCCCCCACCACAGGGTCAACAGGTCCAAGGTCTAAGTCCTCAACCATCTTCACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTC
  5   1   2       ext Brn4      in                         CAAL6415.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACNCCCNTA
  5   1   2       ext Brn3      ?                          CAAK5623.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATAATATATCCTATAGCTTAGAGTACTCACCTGATGGGCAGC
  3   1   4      seed Brn3      in                        CAAK10707.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAACCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   2       ext Brn4      in                         CAAL6415.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTCTCCTTTCCAGGCTGTTTCTTGAGGGTTCTGTCTCTTAGTTTTGGGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  5   1   2  SIG                                      Xt7.1-CAAK6368.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTATTATTCTTCTCCTTCTCTTCCTTCTGCTTCTCCTCCTTCCTCTACTTTTCCTTCTTCTCCTTCTCCTTTTTTCTTGCTTCTTCTACTTTTCCTTATTATTCTTCTCCTTCTCCTTTCTTCTTCTCCTTCTCCTCCTTCTTCTTCTGTCCAAACATCTTGTCCCACTCCTTCCAACCCCTCCATCTTGTATCTTCCCTACTACCCCCCCACTCCCCAACTCATTACCCTCCTCCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATATCTGCCA
                                                  Xt7.1-CHK-1008292228                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATTCTTCTCCTTCTCTTCCTTCTGCTTCTCCTCCTTCCTCTACTTTTCCTTCTTCTCCTTCTCCTTTTTTCTTGCTTCTTCTACTTTTCCTTATTATTCTTCTCCTTCTCCTTTCTTCTTCTCCTTCTCCTCCTTCTTCTTCTGTCCAAACATCTTGTCCCACTCCTTCCAACCCCTCCATCTTGTATCTTCCCTACTACCCCCCCACTCCCCAACTCATTACCCTCCTCCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATAT
  5   1   2       ext Te5       in                          CAAO691.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TCTTCTTCTTCTTCTTCTTCTTCTCCTCCTTCTCTTCCTTCTTCATCTCCTCCTTCCTCTACTTTTCCTTCTCCTCCTTCATTTTTCTTCTTTTACTTTCTTCTTCTTCTACTTTTACTTTCTTCTTCTATTTTTCCTTCTTCTTTTTTCTACTTTTCCTTCTCCCCCTTCTACTCCCTTCTTCTTCTTCTCCTTTTCCTTTCTTCTTGTTCTACTTCTTTCTTTTTCTTTTCCTTTTTATTATTCGTCTCCTTTTCCTTCTTTTTCTTCTCCTCCTTCCTCTACTTTTCCTTCTTCTCCTTCTTTTTTCTTCTTCTTCTACTTTTCCTTTCTTCTTCTTCTCCTTCTTCTTGCTTCTTCTATTTTTCCTTCTTCTTCTTCTTCTCCTTCTTCTTCTTCTTCTCCTACTCCTTCTACTTTTTCTTCTCCTTCTCCTCCTTCTTCTCTCTTCTTCTTCTTCTTTTCCTTTCTTATTCTTCTCCTTTTTTCGTTTTCTACTTTTCCTTATTATTATTCTTCTCCTTCTCTTCCTTCTGCTTCTCCTCCTTCCTCTACTTTTCCTTCTTCTCCTTCTCCTTTTTTCTTGCTTCTTCTACTTTTCCTTATTATTCTTCTCCTTCTCCTTTCTTCTTCTCCTTCTCCTCCTTCTTCTTCTGTCCAAACATCTTGTCCCACTCCTTCCAACCCCTCCATCTTGTATCTTCCCTACTACCCCCCCACT
  5   1   1       add Brn4      in                         CAAL9816.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGCCCAAGTTCCTGCGCGTCAGGGGCCACCTCCCCAGCAACGGCCCCCACCACAGGGTCAACAGGTCCAAGGTCTAAGTCCTCAACCATCTTCACATCCACAAAATCTACCCAGTCCAGGGGCCCAGCAACGCCAAATTCCCCCTCAGCAGCAGCCCCAGCAGGTCCGGCCCCCCCAGCAGCCTTCACCCCGCCAATCCCAATCCCCCCAAAGGCAGCCAAGTCCCCAGGGGCCACAGTCACCTCAAAGGCAACAGCAAGGTCCACCTATGCCAACTGGCCCAAAGCCAATGGGAGTTCAACCTGGTCAACCCCGGCAATCTGGTCCTCCAAGACAGGCCGTGCCCGTAGGACCTCAGCAGAAGCCGGCGCCCCCAGGCAGCCAACAGCCGCCTCAGCAGGGCATCCGCCAACCAATGCAGCAGCAGCAGCCGCCTCTTCAGCAGCGCCAGTCCGTTCCTGGGGCACCGCAACAGCAGCAGCAGCCACAGCGGCCAATGACTCAGCAGCCCCGACCTAACCCCCAAGGACCCGGCCAAGCTTCCTCCCGTCCCGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAATAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAAGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGGCA
  5   1   1       add Tad5                                 XZT13828.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTGTGCATGTCCATCTGCCTGTCTTCTCTGGACCATTCCATCCTCTGTGTTCCATACGGTGGTTTCTCCTTTTCCTCCTTCACCTCCTCCTTCTTCTCCTCTTTCTCCTCCTTCTTCTCCTTCTCTGTCTCCTTCTTCTTCTCCTCATTCTCCTCCTTCTTCTTCTTCTCCTTTTTATTCTCCTTCTCCTCCTTCTACTTCTACTTTTCCTTCTTTTAATTCTTCTCTTTCTTTCTTTTTCTTTGTCTTCTTCTTATCCTTCTCCTTTCTTCTACTTTTCCTTCTCCTCCTTCTTTTCTCTTCTTTTACTTTTCCTTTCTTCTTCTTCTTCTTCTTCCCCTTTTCCTTTCTTCTTCTTCTTTCTTTTTCTACTTTTCCTTCTTATTCTTCTCCTTCATTTTTCTTCTTCTTTTACTTTCTTCTTCTTCTACTTTTACTTTCTTCTTCTTCTACTTTTACTTTTTTCTTCTATTTTTCCTTCTTCTTTCTTCTACTTTTTCTTCTCCTTCTCCTTCTGTCCAAACATCTTGTCCACTCCTTCCAACCCCTCCATCTTGTATCTTCCCTACTACCCCCCCACTCCCCAACTCATTACCCTCCTCCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACACGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGAC
  5   1   2       ext Brn4      in                        CAAL19520.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTTCCTTATTATTATTCTTCTCCTTCTCTTCCTTCTGCTTCTCCTCCTTCCTCTACTTTTCCTTCTTCTCCTTCTCCTTTTTTCTTGCTTCTTCTACTTTTCCTTATTATTCTTCTCCTTCTCCTTTCTTCTTCTCCTTCTCCTCCTTCTTCTTCTGTCCAAACATCTTGTCCCACTCCTTCCAACCCCTCCATCTTGTATCTTCCCTACTACCCCCCCACTCCCCAACTCATTACCCTCCTCCAGTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTG
  5   1   2       add Tbd0      in                       IMAGE:6977656                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTAAGTCCCAGTCCCTCACCAACTCCTTCACCCTTGCAGACATGGCGGCTCCGCGCTCCAACCTTAGCCACGATGAAGCAAAAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCCGTGCTCCCTTTTGCTAGATAGACGGCATTCCCTTTCGGGGCTCAGCACCCCTCATAAATTTTGGTTGGCCAACCGGAACCTTGGGGGTTTCCTTTCTCCCCCCCCCCCCCAGATTCCCCGCCAAAAACCCGGGTTGAATTTTTTC
  5   1   3        nb Brn4      ?                         CAAL22248.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGATGAAGCAACAGCCGAAACGATACGCAACCTGAGGAAATCCTTCGCGAGTCTCTTCTCCGACTAAGGGGGCCGCCGGAAACCTCACTCGTACCCTTTGCCCACTTCATACCCGCCATTAAGCCCCGTGGCTTTTGTGTATAAACTGTTCCCCGACCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGATGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGGCGTGCCGTGCTCCTTTTTGCTAGATAG
  3   1   0       chi Tbd0      in                       IMAGE:6977656                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTGGGGAATAGGATTGGTTGTTATATTGTCGCTGTGATTAAGGTAAGGTATGTTATGATACGGAATGTGGAAGAACAAGGTGGGGGTGTTAATTGGGAACACATAGGTGTGTGTGGCGGAGTTGCTATGGTTGAGGGTGAGGTTGTTTTATATATTTTCAAATGGGTGTCCAGCCCGGTAAAGGGACAATATAAAATAGGGGACATTTGGAGGTCTTAATTCCGTGGAAGCAAAAGGTTGGGCCATCAGTGTGGCCAGGAAAATTTGGCTCGCGAGACGGCCATTTATTGTCGCTCAAGAGGCGCCAAACCCCCCTCAAACCAAAGGTTTTGGTACCAATTGCCCCTGAGGCACGGGTGTCAGGCAATGAACCCCCCCCCAGGAAGGGTGGTGTAATAAGTTGTGTGGGCCCGGCCCTTCCGGTTTAGTTGTGTAATTGGGGGCTCAGTGTTTATAGGTGGAGTAGTGATACGTCTACGTTTATGAGTCTTTTGCCATTGCGTTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGATGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAAGGTTNTGTTGGGGGGTGCGGCGGGGGTGGTGGGCGGGGGGTGGGGTGGCGGGGGCGGTGTGTTGGGGTCGGTCGCGTGGGTGTGTGGGTGTGTG
  5   1   2       ext Brn4      in                         CAAL6714.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCCCTTCCCCCTGACATATATGCACGGCTTCTTCTGCTCCCAAGAGGTAGATATGGAGATGAGGAGGAGGAGTCTCTGCACAATAGACGAGAGAGATATATCTATAAAGAGGAACTATACACACATATATAAATATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGATGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGGCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGG
  5   1   2       ext Tbd1      in                        CBXT18444.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CACATATATAAATATATATATAATATATTCTATAGCTTAGAGTACTCACCTGATGGGCAGCGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCAGCCGCTGCTGTATAGTTGTGTGTGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGATGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCCCCAT
  5   1   3        nb Brn4      ?                         CAAL19099.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGGATGGACATAGGACTACTCCTGGCAGGGTGGGCACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGATGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAAAACGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTC
  5   1   2       ext Brn3      in                         CAAK4940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACAGGTACAGATGGTACAGAAGACCTTATTCACCAGGACCAACCCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGATGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAACGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCC
  3   1   3        nb Brn3 5g3  out                        CAAK6368.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAACCCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGTTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTTTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   3        nb Brn3 5g3  out                        CAAK4624.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACCAACCCCCCCCAATGCTTGTACATTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGTTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   2       ext Brn4      in                        CAAL19520.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTCCCTAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTTTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGCTGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   2       ext Brn3      in                         CAAK4940.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGCACAGTGCAGCATGACCCCCCCCAGCCGTTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTTTACGTTTGTGAGTTTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTTTCTGGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATATCTGCCAAT
  3   1   3        nb Brn3 5g3  out                        CAAK3177.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TAGCACAGTGCAGCATGACCCCCCCCAGCCGCTGCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   3        nb Brn3 5g3  out                         CAAK437.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCTGTATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   3        nb Brn3 5g3  out                        CAAK5090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ATAGTTGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGGGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   4      seed Brn4      in                        CAAL19097.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGTGTGCGCCGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTTTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTACGAAAATGTTATTTGTCCAAAGAAATT
  3   1   3        nb Brn3                                 CAAK8832.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCCCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGGGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGG
  3   1   2       ext Brn4      in                         CAAL6714.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTTTCTTGAGGGTTCTGTCTCTTAGTTTTGGGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   3        nb Brn3      out                        CAAK9009.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCTCCGGTTAGTTGTGTAATTGTGGCTCAGTGTTGATAGTGGAGTAGTGAAACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTCTCATATCGCTAACACTCTCCTTTCCAGGCTGTCTCTTGAGGGTTCTGTCTCTTAGTTTTGGGTTTTGCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATT
  3   1   3        nb Brn3 PIPE out                        CAAK4837.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGTGTTGATAGTGGAGTAGTGATACGTCTACGTTTGTGAGTCTTTTGCCATTGCGCTTTCATATCGCTAACACTTTCCTTTCCAGGCTGTTTCTGGAGGGTTCTGTCTCTTAGTTTTGGGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATATCTGCCAAT
  3   1   3        nb Te3  5g3  out                        CAAM9180.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTTTCCAGGCTGTCTCTGGAGGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAAGTGTGAAACCCCC
  3   1   2       ext Te5       in                          CAAO691.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTTCCAGGCTGTCTCTTGAAGGTTCTGTCTCTTAGTTTTGTGTTTTGCCCCCCCCCCCTATGGTCGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCCGGCGCTCAGCACCCTCATATATTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTCTCCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGTCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGACGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAATATCTGCCAAT
  3   1   3        nb Brn3 5g3  out                        CAAK1522.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GTTCTGTCTCTTAATTTTGGGTTTTGCCCCCCCCCCTATGGTGGTGCCGTGCTCCTTTTTGCTAGATAGACTGCATTCCCTTCGGGGGTTCAGCACCCTTATTTTTTTTGTTGGCAACCGAAGCTTGGGGTTCCCTTTTCCCCCCCCCCAGATTCCCAGCAGAGCGCGGCTGATGTCTCTGTAGTTGGGGAATCTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACTTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTTTTTTTGACTGCCCCCCCCCACTTATTTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGGGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAAAAAATATCTGCCAAT
  3   1   2       add Brn4      in                         CAAL9816.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTCCCTTCGGGGGTTCGGCACCTTTATTTTTTTTGTTGGCAACCGAAGCTGGGGGTTCCTTTTTCCCCCCCCCCCAGTTTCCCAGCAGAGCGCGGCTGATTTTTCTGTAGTTGGGGAATCGGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTCCCGTGTGTGTACCCTCCCGTAGGGTGTACCATTGCGACTGTTGGGGTGCGCCGCGTGTTTCCGTAGGAGGTAGACGTTTTTTTTGACTGTCCCCCCCCACTTATTTTTTCCCCCCCATGGGAATCCCCCCTCCTTTTTGGGAAGGGAAAATGGGGGGGGGAAAAAAAAGGGGGGGGGGACCCTTTGTTTGTAAAGGGGTTTGTGGGAAAATGGGAAACCCCCCCCCTTCAACTTTCCCGCGGGGGTAAGAAAATGTTTTTTGTCCAAGGAAATTAAAAAAAAAAAAAAAATTTCTGCC
  3   1   2       ext Tbd1      in                        CBXT18444.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGGGGAATTTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTATGTAGGACGTAGACGTTTTTTTTGACTTTCCCCCCCCCCACTTATTTGTTCCCCCACATGAGAATCACCCCTCCATTTTTGGAAAGGAAAATGGGGGAGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTAAAAAAAAAAAAATATCTGCCAATAAAAAAAAAAAAAAA
  5   1   2       ext Gas7      ?                          XZG34471.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGGCGCTCCCATTGGATAATTCCGTGTGCCGGTAACCGTGTCGTGCCGTGTGTGTAACCTGCCGTATGGTGTAACATTGCGACTGTTGGCGTGCGCCGCGTGTTTCCGTAGGACGTAGACGTTCTTCTTGACTGCCCCCCCCCACTTATCTATTCCCCCACATGAGAATCACCCCTCCATCTTCGGAAAGGAAAATGGGGGAGGGAAAAAAAAAAGGGGGCGTGAACCTTTGTTTGTAAATGCGTTTGTGTGAAAATGTGAAACCCCACCCCCTCAACCTTCCCGCCGGGGTAAGAAAATGTTATTTGTCCAAAGAAATTaaaaaaaaaaaaaaaatatctgccaataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaataaaaaaaaaaaaaaaaTGGGCG
  5   1   4      seed Brn4      in                        CAAL19097.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGAGGGCCACAAAAGCCTCAAGTGGCTCAGAAGCCGGGCGCCGAGCTGCCCCCACCCCAGCCGCAGCTGAAGTAAGAGCCCTCGCGGTTCCGGGTGGGCCACACAGGTTTCAGCTTCCTATACTTCCTTCTGCATCCCCTTCTTGCATGCTACCTAGAGCAGGTAGATTGGATGGATTTAGTTGTCTCTCCATTGGCCAAGACCTTGGGGGTCCCTATTGGGCACCGGTTAATTGCTTGATGTAGATTTATTCCGAGGCAGCAGCTGCTCCCCGGTTGCCCCATAAGCACAAGGCTTTGCCGGCCAATGTCTTGGTTCCGAGGACGACAATATAAATTCCAGCCTCGAGTCTGACGGAGCTGACGATGATATTTACTGTGAATGCGATGAAACATGCGATCCTGCCTGATGTTGCATGACTTTAACTCTTCATTATTTCTCTTCCCCCTCTTCCTTTTATGTTCTTCCTTTCTCATCCTTCCTTCTATGAAACCACCACGTTTCTGGTTTGCCCCCACCCCTTAACCACTTGCCCTGCTGGCACCTTCACAATTCTGCTGCCATGTGGTTGGATTGTGCATGTCCATCTGCCTGTCTTCTCTGGACCATTCCATCCTCTGTGTTCCATACGGTGGTTTCTCCTTTTCCTCCTTCACCTCCTCCTTCTTCTCCTCTTTCTCCTCCTTCTTCTCCTTCTCTGTCTCCTTCTTCTTCTCCTCATTCTCCTCCTTCTTCTTCTTCTCCTTTTTA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)