Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAJ429.5                             5 END     1           5       20                MGC83599 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 389.0    0Xt7.1-CAAJ18029.5                           2 PI      76        292      969                amyloid beta A4 precursor protein-binding, family A, member 1 [Homo sapiens]

 This cluster: approximate FL confidence score = 0%

 1012079156 Xt7.1-TTpA003d07.5 - 19 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680.....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA003d07.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGGAGATTCACAGACATTAACAGAAGTGGATCTTTTCATATCAACGCAGAGGATTAAAGTTTTAAATGCAGATACCCAGGAAACAATGATGGACCATGCACTACGGACAATCTCTTACATTGCAGACATTGGCAACATTGTTGTTTTAATGGCCCGTCGTCGCATGCCTAGATCAGCCTCCCAGGACTGCATAGAAACAACTCCAGGAGCCCAGGAGGGAAAGAAGCAGTATAAAATGATATGCCATGTATTTGAATCCGAGGATGCACAGCTTATTGCTCAGTCGATTGGCCAGGCTTTCAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAAACTCAGTATTGGAGATCAGATCATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGAGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTAC
                                                  Xt7.1-CHK-1008230867                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCACAGACATTAACAGAAGTGGATCTTTTCATATCAACGCAGAGGATTAAAGTTTTAAATGCAGATACCCAGGAAACAATGATGGACCATGCACTACGGACAATCTCTTACATTGCAGACATTGGCAACATTGTTGTTTTAATGGCCCGTCGTCGCATGCCTAGATCAGCCTCCCAGGACTGCATAGAAACAACTCCAGGAGCCCAGGAGGGAAAGAAGCAGTATAAAATGATATGCCATGTATTTGAATCCGAGGATGCACAGCTTATTGCTCAGTCGATTGGCCAGGCTTTCAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAAACTCAGTATTGGAGATCAGATCATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGAGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTACTTGCAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     7     7     7     7     7     7     8     8     8     8     9     9    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9    10    10    10    10    11    11    12    12    12    13    13    13    15    15    14    15    15    15    15    15    14    14    13    13    12    13    13    13    13    13    14    14    14    14    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    12    13    12    13    12    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12    10    12     9    12    10    12     9    12     9    12     9    12     9    12     8    11     7    10     7    10     7    10     7    10     6     9     6     9     6     9     6     8     6     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ---T--------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 4e-010     AAH76670.1 Syndecan binding protein (syntenin) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 1e-110     NP_001020996.1 abnormal cell LINeage family member (lin-10) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 8e-116     NP_727440.2 CG32677-PA [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-125     XP_780051.2 PREDICTED: similar to adaptor protein X11alpha [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Dr ---- 2e-178     XP_699142.1 PREDICTED: similar to amyloid beta A4 precursor protein-binding, family A, member 2 [Danio rerio] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_413771.2 PREDICTED: similar to Mint2; neuronal munc18-1 binding protein [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_031487.1 amyloid beta (A4) precursor protein-binding, family  A, member 2 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_005494.2 amyloid beta A4 precursor protein-binding, family A, member 2; neuronalmunc18-1-interacting protein 2; X11-like protein;phosphotyrosine-binding/-interacting domain (PTB)-bearing protein;neuron-specific X11L protein; adapter protein X11beta [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 0          AAH84963.1 LOC495441 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 0          NP_001088564.1 hypothetical protein LOC495441 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA003d07.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATG---------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------------ATG------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------ATGATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------ATG---------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------TAA------TAA---------------ATG------TAA---------------TAA---TAA---------------ATG------ATG---TAA---TGA---TGA------------------------------ATG------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------ATG------TAA------------------------------------------------------------------ATG------------ATG---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  5   1   2       bld Ova1      in                         CABE9075.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAAGTTTTGTGGATGTTCCTGGCCCTTGTGAGCCTGAAGACCTAATTGATGGAATTATCTTTGCTGCCAATTTCTTGGGATCCACACAGCTGTTGTCAGAACGCAACCCATCCAAAAACATCAGAATGATGCAGGCCCAAGAAGCTGTCAGCCGTGTTAAGAACTCTGAGGGAGATTCACAGACATTAACAGAAGTGGATCTTTTCATATCAACGCAGAGGATTAAAGTTTTAAATGCAGATACCCAGGAAACAATGATGGACCATGCACTACGGACAATCTCTTACATTGCAGACATTGGCAACATTGTTGTTTTAATGGCCCGTCGTCGCATGCCTAGATCAGCCTCCCAGGACTGCATAGAAACAACTCCAGGAGCCCAGGAGGGAAAGAAGCAGTATAAAATGATATGCCATGTATTTGAATCCGAGGATGCACAGCTTATTGCTCAGTCGATTGGCCAGGCTTTCAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAAACTCAGTATTGGAGATCAGATCATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTTAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGGA
  5   1   2       bld HdA       in                   THdA008k13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CACGCTGTTGTCAGAACGCAACCCATCCAAAAACATCAGAATGATGCAGGCCCAAGAAGCTGTCAGCCGTGTTAAGAGGATGCAAAAGGCTGCTAAAATCAAGAAAAAAGCGAACTCTGAGGGAGATTCACAGACATTAACAGAAGTGGATCTTTTCATATCAACGCAGAGGATTAAAGTTTTAAATGCAGATACCCAGGAAACAATGATGGACCATGCACTACGGACAATCTCTTACATTGCAGACATTGGCAACATTGTTGTTTTAATGGCCCGTCGTCGCATGCCTAGATCAGCCTCCCAGGACTGCATAGAAACAACTCCAGGAGCCCAGGAGGGAAAGAAGCAGTATAAAATGATATGCCATGTATTTGAATCCGAGGATGCACAGCTTATTGCTCAGTCGATTGGCCAGGCTTTCAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCANAGGTGAAATCTTANGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAACTCAGTATT
  5   1   2       bld Tad5      in                         XZT16314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGGGAAAGAAGCAGTATAAAATGATATGCCATGTATTTGAATCCGAGGATGCACAGCTTATTGCTCAGTCGATTGGCCAGGCTTTCAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATTTTAGGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAAACTCAGTATTGGAGATCAGATCATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGNGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGANACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAANACATTTGCAGGCAAGATCAATANATCTGCACTTCA
  3   1   2       bld Ova1      in                         CABE9075.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GGGAAAGAAGCAGTATAAAATGATATGCCATGTATTTGAATCCGAGGATGCACAGCTTATTGCTCAGTCGATTGGCCAGGCTTTCAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAAACTCAGTATTGGAGATCAGATCATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCTCTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAG
  5   1   2       bld Ova1      in                         CABE7294.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCCGAGGATGCACAGCTTATTGCTCAGTCGATTGGCCAGGCTTTCAGTGTAGCCTATCAGGAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATCTTAGGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAAACTCAGTATTGGAGATCAGATCATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTG
  5   1   2       bld Gas                            TGas002m21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTTTCAGTGTAGCCTATCAGNAATTTTTACGAGCAAATGGAATTAATCCAGAAGACCTCAGTCAAAAAGAATACAGTGACATCATCAATACCCAAGAAATGTACAATGATGACCTCATACATTTTTCAAATTCAGCAAACTGTAAAGAGCTGCAAGTGGAAAAGCTCAAAGGTGAAATTTTAGGCGTGGTAATAGTGGAGTCTGGATGGGGATCTATTCTACCCACTGTCATTCTGGCTAATATGATGAATGGAGGGCCAGCGGCACGTTCTGGAAAACTCAGTATTGGAGATCAGATCATGTCCATCAATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATG
  5   1   2       bld HdA       in                   THdA003m18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATCTGTCCATCATGGGACGAGTTTAGTTGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTNAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTAT
  5   1   2      seed TpA       in                   TTpA003d07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CATCATGGGACGAGTTTAGTTNGGTCTTCCTCTAGCAACTTGTCAAGGGATTATTAAGGGCCTTAAGAATCAAACACAATTAAAACTGAACATAGTGAGTTGTCCACCTGTTACTACAGTCCTCATTAAACGACCTGACCTTAAATACCAGCTGGGATTCAGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCAT
  5   1   2       bld Ova1      in                         CABE2985.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTAAATACCAGCTGGGATTCCGTGTACAGAATGGAATAATCTGCAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACAC
  3   1   2       bld Ova1      out                         CABE935.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CAGCCTCATGAGGGGTGGAATAGCAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCTCTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATTTTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATACGATTATTAGCAAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGTGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTACTTGC
  5   1   2       bld HdA       in                  THdA035f03.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAGAGAGGTGGAGTCAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATACGATCATTAGCAAACTAAGAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGTGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAAT
  3   1   2       bld Ova1      in                         CABE2985.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGAGTCGGACACAGAATCATTGAGATCAATGGACAAAGTGTTGTTGCTACTGCCCATGAGAAAATTGTCCAAGCACTATCTAATTCCGTGGGAGAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGAGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTACTTGCAAGCTCTAAC
  3   1   2       bld Ova1      in                         CABE7294.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGATTCACATGAAGACTATGCCAGCAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGAGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTACTTGCAACCTCT
  5   1   2       bld HdA                           THdA015k03.p1kbSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGCAATGTTCAGGCTTCTTACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATACGATCATTAGCAAACTAAGAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGTGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTACTTGCAACCTC
  3   1   2       bld Tad5      in                         XZT16314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TACTGGACAGGAAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATACGATCATTAGCAAACTAAGAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGTGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTC
  3   1   2       bld HdA       in                    THdA035f03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAACACCACTCTACATATAAGAGGAAGCAGCCATTACCATCTGTAAAACATTGGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCAAATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTTTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGAGGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATACGATCATTAGCAAACTAAGAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGTGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTACTTGCAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld HdA       in                   THdA008k13.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGAAGCAGCCATTACCATATGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACTTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGAGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTGTTTGAGATGTTATCAATAAAAGGTATTACTACTGAAAAAAAAAAAAAAAAAAGCGG
  3   1   2       bld TpA       in                    TTpA003d07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAAGCAGCCATTACCATCTGTAAAACATTTGCAGGCAAGATCAATAAATCTGCACGTCAAAGAGACACCGTGCATATATATATTTTTTTTCATTTCAAACAAGGATGCAAGAAATCTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTCTGAGCAAATTCAACATTAACAAAGACAATCTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATATGATCATTAGCAAACTAAAAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGAGCTACATTTCATTTTCTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTATCAATAAAAGGTATTACTACTTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HdA       in                    THdA003m18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAAGGATGCAAGAAATTTCCATGGCCGATTGATACTGCCTTTCTCCCCCTTGCTTTTTGCCAAAGGCGACACCCAGTTTTGAGCAAATTCAACATTAACAAAGACAATTTGTAAATCGCTGAGTAAGACAGTTAAAACTCTTTACACATCATGACGAGTTAAAATGATATTTATTTGTAATGTTAAGTAGTGTTAACGTGTATGTGTAGTATGTTATAATGGTGAGTGTGAGGGTGTGAGCCACGTGATGATGGATTAACAATGGACTTCACCAGAAAAAACAAATCCACTTCATATCAACTTCGGAAACTGCCCTCTTATGATGGTTCCGTAAAACAAAGGCATTGTGTACATTCAATAATTTATAATGTTTTATACGATCATTAGCAAACTAAGAGATATTTAACCTTCTTGTTTTCATGTATTGCTGTATGTAATACCTTCATGGACCACTAAATTGCACACAGAAGTGCTACATTTCATTTTTTATTCATTTGTATTGTACTTTCAAAGCATTCATACATGACATTCTTTGAGATGTTAACAATAAAAGGTATTACTACTTGCAACCTCTAAAAAAAAAAAAAAAAAAAAGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)