Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012079270 Xt7.1-CABJ6098.3 - 28 ESTs
                                                                       ....0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABJ6098.3     GACCGGAGACCCGGAAGTAAAGTGTTTCTACCTGGCGTCTGTGAGTACTCAAGCTGAGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTT
                                                  Xt7.1-CHK-1008228510           AGACCCGGAAGTAAAGTGTTTCTACCTGGCGTCTGTGAGTACTCAAGCTGAGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTC
                                                      consensus depths          2     2     3     3     4     4     4     4     4     4     5     5     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     8     6     8     6     8     6     8     8     8     8     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     6     6     6     6     6     6     6     7     6     7     6     7     7     8     7     8     8     9     7     9     7     9     7     9     7     9     6     9     6     9     6     9     5     8     5     8     5     8     6     8     6     8     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     8     9     7     8     7     8     7     8     7     8     8     9     8     9     7     9     7     9     7     9     7     9     6     8     7     9     7     9     6     8     6     8     6     8     6     8     6     8     6     7     6     7     6     7     6     7     6     6     6     6     6     6     6     6     6     6     7     7     9     9     9     9     9     9    10    10    10    10    10    10    11    11    11    11    12    12    12    12    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     7     8     7     7     7     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------T---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------T---
                                               BLH ATG     144    1133     
                                               BLH MIN     144     146     
                                               BLH MPR     144     146     
                                               BLH OVR     144     521     
                                               CDS MIN     144     146     
                                               ORF LNG     144      86     
                                                                                                                                                                                                                           PREDICTED - Sp ---- 5e-028     XP_001204081.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Dr ---- 5e-045     NP_956508.1 similar to ubiquitin associated protein 1 [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN === Mm ==== 2e-118     NP_075794.2 ubiquitin-associated protein 1 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN === Hs ==== 2e-153     NP_057609.2 ubiquitin associated protein [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PREDICTED = Gg ==== 2e-161     XP_429204.2 PREDICTED: similar to UBAP1 [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN === Xl ==== 0          AAH80999.1 MGC81147 protein [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN === ?? ==== 0          NP_001087614.1 MGC81147 protein [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                           PROTEIN === Xt ==== 0          AAH75356.1 Ubiquitin associated protein 1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABJ6098.3                                                           TGA------------------------------------------------------------------------------------TAGATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------ATG------ATG---------------------------------------------------------------------------------------------------ATG---ATG------------------------------------------ATG---------------ATG---------------------------------------------------------------------------ATG------------------TGA---------------------------------------------------------------------------TGA---------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------TGA------------------------------------------------------------ATG------------------TAG------------TAATAA---------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------ATG------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                     [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   1           AbdN FL                     IMAGE:7005712.FL-MGC                          GTGTTTCTACCTGGCGTCTGTGAGTACTCAAGCTGAGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Egg  FL                     TEgg043p10.FL-Sanger                                                                         CTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas1 5g3  in                       IMAGE:6989738 GCGGGACCGGAGACCCGGAAGTAAAGTGTTTCTACCTGGCGTCTGTGAGTACTCAAGCTGAGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCNTANGAGGGCAAGGAGNCCGACTTTACTCCTCAGCACAGAGGAGGAGTCTCGCTCCCTCAAGCAGAGACTTGACCTTAGCTCTCCAGCCATGCTC
  5   1   2   24  bld Te4  5g                              CAAN6187.5p ....GACCGGAGACCCGGAAGTAAAGTGTTTCTACCTGGCGTCTGTGAGTACTCAAGCTGAGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGGACCTTAAGCTCCTTCCCCAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTAT
  5   1   2   24  bld Brn4 5g   ?                          CAAL7830.5p ......CCGGAGACCCGGAAGTAAAGTGTTTCTACCTGGCGTCTGTGAGTACTCAAGCTGAGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCNATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCC
  5   1   2       bld AbdN FL                            IMAGE:7005712                          GTGTTTCTACCTGGCGTCTGTGAGTACTCAAGCTGAGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAAGAGGGCAAGGAGCCGACCTTTTACTCCTCAGGCACAGAGGAGGAGGTCTCCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTTCCAAAGCCAATGGGCTTCATCACTCTGCCGCATTTAGAAACTGTGGAAATTATCCCCCCGGTCTTTCCAAAGTGGTCCCTTGGGGCCCCTTCAGCCAGGTCGGGT
  5   1   2       bld Egg  5g                        TEgg107p03.p1kSP6                                                            CGGGGCGGAAACCCTCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCGACCCTGCTGACTT
  5   1   2       bld Egg  5g                        TEgg102f07.p1kSP6                                                                       TCCCCGCCACCGTGAGAAGCTCAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTGTACGAAGTCGGCTTCTGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCGTTTGGTATCGGAGACTAGTTTCTGGTGGCCGATAACGTTGGGCTGCCTATTGGCTTCAGTGTGCCGGACGTTTCCTCAGCTTGTGAGGGAGAGCATCTTATGATTTCTTACTGGAGACGAGGACTCTTTCGTGGGTACAAGACATTAAAGAGATCACAGCTGCCCACAAGGAGGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGAC
  5   1   2       bld Egg  FL   in                   TEgg043p10.p1kSP6                                                                          TCCCCGCCACCGGAGAACCGGAGGAGGCAGAGGCTGCGCAGGGGGCTTCGGACAAGTTCTTACACAGTACTCTAGATGGCTTCTAAGAAGTCGGCTTCAGACTTGCACGGGCCCTGTAGCTATTTAGAAGACGTCCCATTTAAGATCGGAGACAAGTTTCGGGTGCCGGATAAAGTTGGGCTGCCTATTGGCTTCTGTGTGCCGGACGTTTCCCAGCTTGTGAGGGAAGCTCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAA
  5  -1   2       bld Te3                                  CAAM5551.5p                                                                                                                                                                                                                                                            GTGATGAGAATGCAAGGTTTTCCTGCTCATTAATCTCTTTCCCTTTACCTCGGCAGTATGATTTCTTACTGGAGAAGAAGACCATTCAGTGGGCAGAAGAAATTAAAGAGATCAAAGCTGCCCAAAAGGAAGCCGAGCTAAAGGCCAGGGCAGCTCTTTCCCAGGAAAGTGTGGAAGCAGCCGGCGGCAATGCAAAGAACAAAAGTGCCCCCTCCGCAATCAACCCTTTCCTTGCTGCCCTGCAGCACAATAACATCCTCACCCCGACTCCAGCCAGCGACAGCGCCACCAAGCATAAAGCCCTGAGCCCCCCTCATATCAAAGCAGACTTCAACCCTGCTGACTTCGAATGCGAAGAGGACCCGTTTGATAAATTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACGCAACGGCGC
  5   1   2       bld Ovi1      in                        CABI12257.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGAGTTAAAAACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGT
  5   1   2       bld Gas7                                 XZG10273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AACCATTGACGACAAAGAGGAGTTAAAGAGCATCCTTAATATTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTTTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGGTCAGA
  5   1   2       bld In63                            IMAGE:8959688.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTAAAATATTTCACATCCGGCCGATGCCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAGCAGGGGCAGACGTGAGCAGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAGGATTCGATTCGATCTTGTGAGAGCTATGGAATGTACATGTCGAGAAAGACGCGATTCTCAGTATGACAGTAAGATGGTCGACGAGGACTAAGAGGTCTCTGTGTGCATACACGA
  5   1   2       bld Egg       in                   TEgg072f06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGGCGGGCGATTCCTCTAAGGAGGGCAAGGAGCCGACCTTTAACTCCTCAGGCACAGAGGAGGAGGTCTCGGCTCCCCTCAAAGCAGAAGACTTGGACCTTAAGCTCCTTCCCAAGCCCAATGGCTTCATCACTCTGCCGCATTTAGAAAACTGTGAAATTATCCCCCCGTCTTCCAAAGTGTCCCTTGCGCCCATCAGCACAGTCAGCAATATCAAGTCCCTCTCCTTCCCCAAACTGGACTCGGACGAAGGGGAGCAGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGG
  5   1   2       bld Gas8      in                         st111d09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGAACGTAGGGAAATTCACTAGCACTTTTCATAGCACTACCTGTCTACCCAACGGCGCCTTCCTCGATTCTCTGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTAAAGTCGGGGCTTCTGCCCGTTGCTCGCTGTTACACCAGTCCGGCACTTACTGTTTGTTTAGGGAAGGGTATTTTGCCCACAGAACATTCCTTCCTGATAGATTTTATTGGTAAATACAGCTGGAAGCTGCCCTATTGTCCCCAGGCTTATTTATTATTGGGTAAATCTGTCAACAGCAACAAATATGTAGTTAGTTGCACCGG
  5   1   2       bld Ovi1      in                         CABI6132.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATCGATTCGGTCGGCTTCTTCTCCCCATAAACCCAGCGAAATGAATGGACACCATATGCCAGGCCACTCTTCCTTACACGCCGACAGTTTGGCACAGCCTGCCATGTCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCANGCTGGGCAGGG
  5   1   2       bld Ski1      in                         CABJ6098.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCTTCTCCCTCAGCCACACACACACTGCCAGCGGGCACGGAAGAAAAACCAAGGACGTCTCCAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGNGCGGCATTTCCTGTTTTTGCTTTGCAGTGAATTATG
  5   1   2       bld Ski1      in                          CABJ866.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAATAATGACGCCAAGACGACAGCTCCGCACGTGGCTGTATTGAGAGTGGCCAACAGCAAGCGCACGGGGGTGCCGGGCTACCAGGAGCTGCTGGCGGCGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTTGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGGATCCTTA
  5   1   2       bld Met5      in                         CACX1168.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CGCTTTCCGGCAGTGAGCGGCAGTGCGTGGAGACCATTGTGGGCATGGGGTACTCCTACGAGCGCGTCATGAGAGCCATGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTTTCCGAAACCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTC
  3   1   2       bld Egg       in                    TEgg072f06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGCAGAAGCAGGGGCAGAACGTGGAGCAGGTGCTGGAGTATCTGTTCATCCAGGCACAGCTGTGTGAGAAGGGTTTCGATCCGACCCTGGTGGAGGAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTTTCCGAAACCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  FL   in                    TEgg043p10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGCTATGGAGATGTACCAGTGTTCAGAGGAGAAGACAGCGGAATTTCTCCAGTTAATGAGCAAGTTTAAGGAAATGGGGTTCGAACAGAAGGACATTAAAGAGGTTCTCTTGTTGCATAACAACGACCAGAACAAAGCCTTGGAGGAGTTAATGGCGCGGGCCGGGGCCAGCTGAACCCCTCTGGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCCCAAGCTGGAACCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGCCCTTTCGGCTGAAACTGTCC
  3   1   2       bld Ski1      in                         CABJ6098.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCAGAACGTTCCGCGTATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTTC
  3   1   2      seed Ovi1      in                        CABI12257.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TATGGATACTACGAATGCTATTTGGATGTCTACTTGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTTGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTTC
  3   1   2       bld Gas1 5g3  in                       IMAGE:6989738                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             NGATACTACGAATGCTANTTGGATGTCTACTNGGAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATGAGGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTGCCTACAAAGGGAC
  3   1   2       bld Ovi1      in                         CABI6132.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAACCAGCTCTTTGTGAGCAAATCCACAAGCCCAGCCCATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTCTCCGAAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTTGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTTC
  3   1   2       bld Met5      in                         CACX1168.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATTGAGGAACGTGTGTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTTTCCGAAACCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTTC
  3   1   2       bld Gas8      in                         st111d09.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTATGATACATAGCCCCTCCCGCCGGAAAATCCATGGAAGAAGTGCCCTTTTGTTTCCGAAACCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTCGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTGAT
  3   1   2       bld Ski1      in                          CABJ866.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAGCCTTCAGGCTGGGCAGGGAGAGCGGGTTCCATAACAGAACTTCATATGCACGACCCAAGGGGCGGCATTTCCTGTTTTTGCTTTGCAGTGGATTATGGGAAACCACAAGCTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTTGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAACTACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTTC
  3   1   2       bld Brn3      in                         CAAK4440.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTTGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCAAACTTC
  5   1   2       bld Brn3      in                         CAAK4440.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTGGAAGCCTTATACATAGGGGCCTATTGAGTGAAGCTGCTTTCTGTGCTTGTACCGGAACCTTGACCGTTCTGACCAGACGGCCTTTAGTGCAATGGATTCTTATTTTAGGTATTAGTGCTACACTGGTTAATAAAGTACTCGGGCAGCATAGCGTCAGACTAACTCCTGGCTCCTCCCTCTCGTTTATTTGGTTCCCGATACCCTGACAGCAGGGGGCACTGGGAAAGCTGGGGGTCTTTTTGGAGTCTTTAAATATTTGCTAAGTTATTTGTTAAAGAGCTTTATCTGTTCTCTACATTATACCGACGCCCCTTTATTTAAGGAGATATACAAATAAATATGGATTGGCCTTTCGGCTGAAACTGTCCGGCCAATGGCGTTTCTCCAAGCACTTTCATATTGCCACGGTGTGTTATTACTTCACCCTGTTTCTCTGAGGGGGTTTCTATCCAGTGTTCCATGGAATCATTGTTCCCAGAGAGTGTAACCTGTTGTACATTGGTGCAAAACCCCACCTGTAAATCCCTTTGCTAAATACTTTGATTTGCCTACAAAGGGGACTAATAAACCGCTCANACTTCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)