Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 71%

 1012079319 Xt7.1-CABD13950.3 - 24 ESTs
                                                                       -540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD13950.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGCCGAGAAGGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGGAGATAGCAGCCATGATTGCCACAGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGGATTCACCATGATACTTTTGCTAGTGGTGGCGAGCATGCCAAGTTTTGCACTAAACACGAAGATATGACTCTGCTTGTGCGGAACCTGGGCTACCCACTGCAGGAGATCACTCCACCAACACTCACGCCCACCCAAGGTGGGCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGGCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGACATAAAA
                                                  Xt7.1-CHK-1008229561                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGAAGGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGGAGATAGCAGCCATGATTGCCACAGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGGATTCACCATGATACTTTTGCTAGTGGTGGCGAGCATGCCAAGTTTTGCACTAAACACGAAGATATGACTCTGCTTGTGCGGAACCTGGGCTACCCACTGCAGGAGATCACTCCACCAACACTCACGCCCACCCAAGGTGGGCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGCCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGACATAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  2     2     4     4     4     5     4     5     4     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     7     8     7     8     7     8     7     9     6     9     7     9     6     8     5     7     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     6     5     6     5     6     4     5     4     5     4     5     4     5     4     5     4     5     9     9     9     9     9     9     9     9     7    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    13    13    13    13    13    13    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10     8     9     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -----------T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     -----C------
                                               BLH ATG      -6     155                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             
                                                                                                                                                                                                                          PROTEIN --- Sc ---- 2e-010     NP_014733.1 Mitochondrially localized type 2C protein phosphatase; contains Mg2+/Mn2+-dependent casein phosphatase activity in vitro but in vivo substrates are unknown [Saccharomyces cerevisiae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Ce ---- 4e-018     NP_510428.1 TAK1 kinase/MOM-4 binding Protein TAP-1, TAB1-like protein (43.5 kD) (tap-1) [Caenorhabditis elegans] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 3e-086     XP_783278.1 PREDICTED: similar to Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 (TAK1-binding protein 1) [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 0          NP_001006240.1 similar to Mitogen-activated protein kinase kinase kinase 7 interacting protein 1 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 0          NP_006107.1 mitogen-activated protein kinase kinase kinase 7 interacting protein 1;TAK1-binding protein 1; transforming growth factor beta-activated kinase-bindingprotein 1 [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 0          NP_079885.2 mitogen-activated protein kinase kinase kinase 7 interacting protein 1;Tak1-binding protein 1; beta activated kinase-1 binding protein-1 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          AAC14009.1 TAB1 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === ?? ==== 0          NP_001081740.1 TAB1 [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          AAI35830.1 Map3k7ip1 protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD13950.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------TAATGA---------------------TGA---------------------------TAA------------------------------------------------------TGA---------------------ATG------------------------------------------------------------------------TAA---------------------------------------ATG---------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------TAG------------------ATG---------------------------TAG---------------------------------------------------------------ATG------TGA---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  0   1   1           Tad5 FLt5                        XZT53095.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGCCGAGAAGGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGGAGATAGCAGCCATGATTGCCACAGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGGATTCACCATGATACTTTTGCTAGTGGTGGCGAGCATGCCAAGTTTTGCACTAAACACGAAGATATGACTCTGCTTGTGCGGAACCTGGGCTACCCACTGCAGGAGATCACTCCACCAACACTCACGCCCACCCAAGGTGGGCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGGCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGACATAAAAAAAAAAAAAAAA
  5   1   2       bld Egg  FL                        TEgg134i09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                              AGCATCCCAAGTGAGCCAGAATGCACGCCAGTCTCTCTTCCCAAATCACCGCTTCCTGCTTCCGCGTTAGGCTCAATCACGTGACCCACGTCTGATTGGCGGCGTCACTCCTAGTGCAAATATGGCTGCGCCGAGAAGGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGT
  5   1   2       bld Tad5 FLt5 in                         XZT53095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGCCGAGAAGGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTTACAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAAC
  5   1   2       bld Brn3 PIPE                            CAAK1378.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCCGAGAAGGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTNCATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCA
  5   1   2       bld Neu0                               IMAGE:6995336                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAATCTTCTGCATAGTGAGCAGCAGAGCTGGACAGATGATCTCCCTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGGCTGCCAGCCATTTAGATGGGTGTCACTGGGATTTTTGGGTTCCTTATNGTCAGGAAGGGAACTTTACCAAAGGCTCCTGGA
  3  -1   2       bld Fat1      in                        CABC11375.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATAGGGCGAGAGGCCTGGACAGATGATCTCCCTCTCTGCACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGGCTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTANCAGGCTCTGGAGTCAGCCCACGGGCCTGGNACAGCCCACCAG
  5   1   2       bld Ski1      in                         CABJ8776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTCTCTGCAACCTTTCTGGGGTTGGATCTGCTTCAAATCAGACTTACAATTCTGAGGGCCTTGGGAAGGAGGAGCACCCATGTGAAGATAACTGGATAAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGGCTGGACAAGCCACCAGGAGAT
  5   1   2       bld Lun1      in                        CABD13950.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGTTCAGGGGTGACAATAATATTTATCTTTATGGAGTGTTCAACGGGTATGAGGGTACCAGAGCCACCAACTTTGTGGGTCAGCGGCTTGCAGCAGAACTCCTTCTGGGGCAGTTGCACCCTGATGTTACAGATGCAGAGGTCCATAAAGTGTTGCTACAGGCATTTGAAGTTGTTGAAAGAAGTTTTCTGGATTCCATTGATGATTCTTTAGCGGAAAAGGCCAGCCTACTGTCCCAGCTTCCAGAGGGTACACTTCACCAGACACTTCCAAGCCAGTACCAAAAGATTGTGGATCGGCTTAACATTCTTGAAAAGGAAATCTATGGGGGTGCCATGGTCATTGTGGTGCTTATTGTGAACAGCAAACTTTATGTTGCAAATGTTGGAACAAACAGAGCACTTTTGTGTAAATCGACAGTAGACGGGCTCCAAGTGACTCAGCTCAATGCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGGCTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGGAGATAGCAGCCATGATTGCCACCGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGG
  3  -1   2       bld Ova1      in                        CABE10218.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GCCGACCACACTACGGAAAATGAAGATGAGATATTCCGTCTTTCTCAACTGGGACTGGACACAACAAAGATTAAACAGGTGGGGGTTATTGGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGGAGATAGCAGCCATGATTGCCACAGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGGATTCACCATGATACTTTTGCTAGTGGTGGCGAGCATGCCAAGTTTTGCACTAAACACGAAGATATGACTCTGCTTGTGCGGAACCTGGGCTACCCACTGCAGGAGATCACTCCACCAACACTCACGCCCACCCAAGGTGGCCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGGACACACAGT
  5   1   2       bld Tbd0                               IMAGE:6978147                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGATGAGGCCAGCAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGGAGATAGCAGCCATGATTGCCACCGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGGATTCACCATGATACTTTTGCTAGTGGTGGCGAGCATGCCAAGTTTTGCACTAAACACGAAGATATGACTCTGCTTGTGCGGAACCTGGGCTACCCACTGCAGGAGATCACTCCACCAACACTCACGCCCACCCAAGGTGGGCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGTGGCCTGTTCCGATCTCGCCCGTCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGGATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATAAGA
  5   1   2       bld Neu       in                   TNeu068g05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAAGTATGCGCAGAATTGGAGACTACAAGGTCAAGTACAGCTTCAATGACATGGAGCTGCTAAGCACAGCCATATCCAAGCCTATTACTGCAGAGCCAGAGATCCATGGCTGCCAGCCATTAGATGGTGTCACTGGATTTTTGGTCCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGGAGATAGCAGCCATGATTGCCACAGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGGATTCACCATGATACTTTTGCTAGTGGTGGCGAGCATGCCAAGTTTTGCACTAAACACGAAGATATGACTCTGCTTGTGCGGAACCTGGCTACCCACTGCAGGAGATCACTCCACCAACACTCACGCCCACCCAAGGTGGGCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCAC
  5   1   2       bld Ovi1      in                         CABI9848.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATCGATTCGCTTATGTCAGAAGGACTTTACAAGGCTCTGGAGTCAGCCCACGGGCCTGGACAAGCCAACCAGATAGCAGCCATGATTGCCACAGAGTTTGCCAAGCAGGTTTCTCTGGATGAAGTGGCACAGGCTGTAGTGGAGAGGGTAAAACGGATTCACCATGATACTTTTGCTAGTGGTGGCGAGCATGCCAAGTTTTGCACTAAACACGAAGATATGACTCTGCTTGTGCGGAACCTGGGCTACCCACTGCAGGAGATCACTCCACCAACACTCACGCCCACCCAAGGTGGGCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGGCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACANAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGGCTACTGCCCCTCACAAA
  5   1   2       bld Int1      in                        CAAP11489.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCACGCCCACCCAAGGTGGCCGTATCTATCCAGTGTCTGTGCCGTATTCCAGTGCTCAGAATACCAGTAAAACAAGTGTTACACTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGCCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGNGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCC
  5   1   2       bld Ova1      in                        CABE12808.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGTCATTGGTGATGCCATCGCAGGGTCCAATGGTGAATGGAACACACAGTAACTCAACGCTGGATGGAACAACGCCAACACTGCAATCTCCAAGTGCTACTCTCCAGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGGCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTG
  5  -1   2       bld Fat1      in                        CABC11375.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGTGGCCTGTTCCGATCTCGCCCGTCGCTCTCTTTGCAGCTAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTAAACTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCGAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAATGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCTTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAA
  3   1   2       bld Lun1      in                        CABD13950.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGTGGCCTGTTCCGATCTCGCCCGTCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTAAACTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCGAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAATGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCTTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGACAT
  3   1   2       bld Ski1      in                         CABJ8776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGCCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTGACATAAAAAAAA
  3   1   2      seed Tad5 FLt5 in                         XZT53095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AGTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGGCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGAC
  3   1   2       bld Int1      in                        CAAP11489.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTCCACCAACACTCACACTCAAAGCAGCAGTTCCAGTTCTGATGGCGGCCTGTTCCGATCTCGCCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATNTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCAC
  3   1   2       bld Ova1      in                        CABE12808.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGTTCCGATCTCGGCCATCGCTCTCTTTGCAGCCAGATGAGGATGGCCGTGTGGAACCCTATGTTGATTTCACAGACTTTTACCGTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTGAC
  3   1   2       bld Ovi1      in                         CABI9848.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTCTTTGGAATGCAGAGCATAATGATCCTGTAGCTCTTCTCACTGCTCAGTGATATGAACATTAATGACTATATTTACCAACATTTCTGTGAAGAACATCACAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTGACAC
  3   1   2       bld Neu       in                   TNeu068g05.q1kT7w                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATATGAACATTAATGACTANTATTTACCAACATTTCTGTGAAGAACATCACAAAGGGGACCCTGAACTCTAAGCTGTCAAACATCTTATTATTTCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACNAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTNAAATAAATAAAATATTTTGACATAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Ova1      in                        CABE10218.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGGGACCCTGAACTCTAAGCTGTCAAACATCTCATATCCCCCTGCCTAGAGAATCCTAGCAACAAAGTGATCTGAACACAGTACTTTCTCGTAAATATGGGGCTAACTGCCCCTCACAAACCAGTGGGACACAGTGGTTATTGTGCTGTTCTCTTGGAAGAACCATGGCCCTAAAATCTCTGGGCCAGTGGTAATCCCTTACCATTACAGTGTATGACACACACAGTTCTTCCTTCGGCAAACGACTGGGGCATTAAAAGACATTGTTTATGTTCCCTGGTACTTTTTTTTATCCCTGTACCATAGGAACACACCTATATACTATATGAAGAGAACCAGCAATTCTATGTTCCTAGAATATTCCTTTCCTTCATTCTTAACTTGCATTTATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGACATAAAG
  3   1   2       bld Tbd1      in                        CBXT11678.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCGTGGGTGTTGTTGCCCGAGAAAAAAGCATTTGTGTTAGAATGAAATAACATATTACCATCCACTCGTATCTATAAATGCAAGTTAAGAATGAAGGAAAGGAATATTCTAGGAACATAGATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGACATAAAAAAAAAAAAAAA
  5   1   2       bld Tbd1      in                        CBXT11678.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATATTACCATCCACTCGTATCTATAAATGCAAGTTAAGAATGAAGGAAAGGAATATTCTAGGAACATAGATAGATACGAGTGGATGGTAATATGTTGTTGCCCGAGAAAAAGCATTTGTGTTAGAATGAAATAACATCCCTTCTCACAGTCAGAGCAAGACCTTTCTTTTGCCTTTGTCTGTGCAGAATGCCTCATTGAGTCCCACTCATATGTATAAATCCTGTGCCCACAGGAAGCTTTATACATCGCACTAAATAAATAAAATATTTTGACATAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)