Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 97%

 1012079340 Xt7.1-IMAGE:6996089.5 - 28 ESTs
                                                                       .-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                 Xt7.1-IMAGE:6996089.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGTGCGTTGTTGGTCGGATCTCAGGCGTGTCCCAGCCCTCATGCCCATAAAACAATGGCTCCCAGATATGAATGCTGACAGCTCCGTGCGGCCCCTCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGTGAATTTACCTTTTTCCAAGATGTAGAAATTGTTCCTTGTGACAAGGGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGGGGGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTCCACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGT
                                                  Xt7.1-CHK-1008228552                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTGTTGGTCGGATCTCAGGCGTGTCCCAGCCCTCATGCCCATAAAACAATGGCTCCCAGATATGAATGCTGACAGCTCCGTGCGGCCCCTCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGTGAATTTACCTTTTTACAAGATGTAGAAATTGTTCCTTGTGACAAGGGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGGGGGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTCCACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGTTTTTAT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     2     3     3     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     5     5     6     8     9    10    12    10    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    13    13    12    13    14    14    14    14    13    14    14    14    14    14    13    13    13    13    13    13    13    13    12    13    12    13    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    10    12    10    12    10    12    10    12    11    13    11    13    11    13    11    13    12    14    10    13    10    13    10    13    11    13    10    12     9    12    10    14    11    14    12    14    12    14     9    11     9    11     9    11     9    11    10    12    10    12    10    11    10    10    10    10    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    10    11    11    11    11    11    12    10    12     8    12    10    11     8    11     9    11    10    11    10    11    10    11    10    11     9    11    11    11    11    11    11    11     8    11    11    11    11    11    11    11    11    11    11    11    11    11     9    11    11    11    10    11     6     6     6     6     4     4     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T---------C
                                               BLH ATG     276     606                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     276      85                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MPR      57      85                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     276     925                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               CDS MIN     276      85                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI     163       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     276      40                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 5e-018     NP_499573.1 posterior Hox gene Paralog (php-3) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 2e-020     NP_477498.1 fushi tarazu CG2047-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Ci ---- 3e-022     CAD59671.1 putative homeobox protein Hox10 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Bf ==== 8e-029     AAF81909.1 homeodomain-containing protein Hox11 [Branchiostoma floridae] ==========================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---= 7e-029     XP_783352.1 PREDICTED: similar to Homeobox protein Hox-B9 (Hox-2.5) [Strongylocentrotus purpuratus] ==============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = ?? ==== 4e-060     NP_001091264.1 hypothetical protein LOC100037070 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 5e-083     NP_571196.1 homeo box B9a [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 2e-089     AAI06422.1 Unknown (protein for MGC:131095) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 8e-099     NP_076922.1 homeo box B9; homeobox protein Hox-B9; homeo box 2E [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 4e-101     NP_032296.2 homeo box B9 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Gg ==== 4e-103     XP_001233691.1 PREDICTED: similar to HOXB9 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 3e-146     CAJ82382.1 homeo box B9 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:6996089.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAA------------------TGAATG---------------------------TGATGA---------TGA---------------------------TGA---------------------------------------------------------------------------------------------------TGA------TGA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---ATG------------------------------TAA---------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TAG---------------------------------------------TAA---------------------------ATGTAG------------------------------------ATG---------------------------------------TAAATGTAG---------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           Neu  FL                     TNeu067h12.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGTGAATTTACCTTTTTACAAGATGTAGAAATTGTTCCTTGTGACAAGTGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGTGTGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTACACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGTTTTTATTTCCATGGTTATTAAATTAGTGACTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Neu0 FL                     IMAGE:5382211.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FLx                    TNeu068g14.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGACAGGAATGGACACTGCGATTAAATACAATTTAATAAACAGAATTAGAGAGATCTGCAACCAGGGGCTTTGCTTTGCCTGCAGTCGGGGGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGTGAATTTACCTTTTTACAAGATGTAGAAATTGTTCCTTGTGACAAGTGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGTGTGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTACACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGTTTTTATTTCCATGGTTATTAAATTAGTGACTTCAAAAAAAAAAAAAAAAA
  3  -1   0       add Neu0      in                       IMAGE:6992126 AAAAGGCTCGGCATAAGTAGTTATACAGAAAGCAAATGGGATCATAGTGTCAGTAGTGCAGTGTAGGATATAAATATGGCAAATTACTACTTATATATCTGATTATATTATGGGCCAGTCTGTAGGCCTCAGCCACCACTTTAAATCAGTGCTGCACAGGGTACAGGCAATTGTATAAAGTTAAAATAAACAAGCAGACATAGTGCTAGTAGTGCAGAACATGCATATACATGCTGCAGGGCTGGGCACTGTACAATGGTCTGTAACTGGTGACAATTTGTGGTTACCATTTCATACTAGTGCAGAGAAATAAACCAGGGTCATAGGGACACTAGCAGTTTGGCACAATGTGAGTAAATAGTGTTACTGGGTAGGGGAAGGGCAGTTAAATAAAATGAGTGTAAGGTATCAATCAGCAGTGCCTCCTAGGAAATGATTGGCACCATATACATCTGGCAATATCTGCCATTATATGGGGGCATTGCCTGGGAATAAGAATAGAATAGAAGAATAGAAGCACAATTCCAGATACAGGGGGCATAAAATATCCACATCCAATATCCACCTAATTGGTGTCTGTTATTTTGCATATAGTCAGTGTAGGGAAAGGGGCCACTAACTATAAATATACTGTTTATAATCCGTACTGTACAAGCCAGACTGTACGCAGCCGCCATGCTATGGCAGCGAGAGGCACCGTTCTGCTAAATTGCGCACTGATTTGCGCACACGGCCAATTGCGCACAGCTGAATGAGAGACTGCTGCGCCCTCCAAGCTGTTGCACCCAGACCCCCCCTGTGCAGATTGTCTTGTGGCTTCACTAAAGGCACCAGAAGCTGCACAGAAAATAGTGTCACCCAGTTTCAAATGTTGGCTGAGGAGTGCGTTGTTTGGTCGGATCTCAGGCGTGTCCCA
  5  -1   2       bld Neu0      in                       IMAGE:6992126                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGAGACTGTTGCGCCTTCCCAAGCTTGTTGCACCCCAGACCCCCTTGTGCCAGATTGTCTTGTGGCTTCACTAAAAGGCACCAGAGCCTGCACAGAAATAGGTGTCACCCAAGTTTCAAATTGTTGGCTGAGGAGTGCGTTGTTGGTCGGATCTCAGGCGTGTCCCAGCCCTCATGCCCATAAAACAATGGCTCCCAGATATGAATGCTGACAGCTCCGTGCGGCCCCTCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGATCCCGA
  5   1   2   14  bld Gas6 5g3  in                         ANBT1585.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGTGCGTTGTTGGTCGGATCTCAGGCGTGTCCCAGCCCTCATGCCCATAAAACAATGGCTCCCAGATATGAATGCTGACAGCTCCGTGCGGCCCCTCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGNCAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGG
  5   1   2       bld Gas8 5g3  in                          st97o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAATGCTGACAGCTCCGTGCGGCCCCTCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTG
  5   1   2       bld 1030 5g                         IMAGE:7025777.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTTCCGGACAATAAACTGTGTGAAGGGAAGCGGGGACAAAGACAGGACACATCCAAAGCAACCCCCTCAGCCAACTTGGGTTACATGGCCCGCCCTCCTTCCAGGAAAGGAAAAGGTGGCCCCCTACACCCAAAATACCAAGAACCCCTGGGAAACTGGGGAGAAAAGGGAATTT
  5   1   2      seed Tad5      in                         XZT11798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGCGTCGCGGAGCGTGGGCGGAGCGTGGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAAATGAGATGAAGAAACTA
  5   1   2       bld Gas8 5g                                st2o18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCC
  5   1   2       bld TbA       in                   TTbA037c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCTCACTCACCTGTCAGCCCATGTGCATCGAGTTGGCTAGCAATTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAATATGATGCCCTAGAATGGCCATTTCTGGGACTCTCATTAATTATTTTGCTTGGAGTCAATAATAACCCCTGAGAGTGAGGATGCTCCGGCAGCCTAATTCTCTGGACAGTACCCCATCCCCCGGCCAGCATCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCATTCCCAAAGCTCCTGTATTCAGCAGCGTCCT
  5   1   2       bld Neu  FL   in                  TNeu067h12.p1caSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAGGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTGTGGGGAGTGCCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTGCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAAGCAAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGC
  5   1   2       bld Neu0 FL   in                    IMAGE:5382211.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCT
  5   1   2       bld Gas8 5g3  in                          st36n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAG
  5   1   2       bld Gas8 5x3  out                         st17f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCAGCCCAAGTGCACCGAGTTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATT
  5   1   2       bld Gas8 5g3  in                         st103g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCC
  5   1   2       bld Gas8                                 st104g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTATTTTGTGGAGTCAATAATAANCCCTGACAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGC
  5   1   2       bld Neu0                               IMAGE:6996089                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCANAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGGGTTTATTTTGTTTTTCCTTATACAGAAACTGACTGCACAAAAGGTGGGCACTTTACCTTTGCATGATCCC
  5   1   2       bld Gas8      in                          st54c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAGCAAGGCTATTTACCCACATAAAGACTGCAGCCTACCAAGACACATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATAT
  3   1   2       bld Gas8      out                         st17e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTT
  5   1   2       bld Neu  FLx  in                   TNeu068g14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACAGGAATGGACACTGCGATTAAATACAATTTAATAAACAGAATTAGAGAGATCTGCAACCAGGGGCTTTGCTTTGCCTGCAGTCGGGGGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTACCCACATAAAGACTGCAG
  3   1   2       bld Gas8 5g3  in                         st103g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAAGAGAAGATGCCCATGAAAGGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTGC
  3   1   2       bld Gas8      in                          st54c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGGACNAAGACAGGACACATCAAAGCAACCCNTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTNTCAAGCACAAGGCTAGGGCTGCTTTTAAGCAAGGCTATTTACCCACATAAAGACTGCAGCCTACCAAGACACATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTNTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTT
  3   1   2       bld Gas8 5g3  in                          st36n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGNCAANGNCNGGCNCATCAAAGCAACCCNTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTNTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCTACCAAGACACATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATNTNTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACNGAGAAGAGGTTAAATAGAAGCNCAAGAAACGCCCTCGCTT
  3   1   2       bld Gas8 5g3  in                          st97o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAGCCAACTGGTTACATGCCCGCTCNTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTGC
  3   1   2       bld Gas6 5g3  in                         ANBT1585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAA
  3   1   2       add Tad5      in                         XZT11798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTGCCAGTTTATTGCACTTGAGGGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAACCTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCTCTTGCTCTTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTGTCAAGCACAAGGCTAGGGTTGCTTTTAAACAAGTCTATTTTCCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATGCCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAA
  3   1   2       bld Neu0 FL   in                    IMAGE:5382211.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       add Neu  FL   in                    TNeu067h12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTCCCTTGCATGATCCTTTCAAGCACAAGGTTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATTTCGCCCCCCCATCCCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCTTCCCACCCGCATTTTTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATATTGAGCTTGAATATAAAACGTTTGAGAGAGCCAGAGAAGGGGTTAAATAGAAGCCCAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGGGAATTTCCCTTTTTCCAAGATGTAGAAATTGTTCCTTGTGACAAGGGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGGGGGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTCCACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGTTTTTATTTCCCAGGGTTATTAAATTAGTGACTTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Neu  FLx  in                    TNeu068g14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACANTATCGCCACCNACATACCATAAATNCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGTGAATTTACCTTTTTACAAGATGTAGAAATTGTTCCTTGTGACAAGTGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGTGTGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTACACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGNTTTTTATTTNCCATGGTTATTAAATTAGTGATTCAAAAAAAAAAAAAAAAA
  3   1   2       add TbA       in                    TTbA037c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGGCATATATATATTTCTTCCCAACCGCATGTCTTATTAAAGGGCTTTGAAACCAGCTAGACTCCCATCTTTATACTGAGCTGGAATCTAAAACGTTTGCGTGAGACTGAGAAGCGGTTAAATAGAGGCACAAGAAACGCCCTCCCTTTGCGGAATTAGTTTTGTGGACACCAAGGGCTAAAAAAAAAATGTAAAAAAAAAAGGTTTGTTGGTGGTGTTTTGTTTCAGACGAGGGCGGGAAAAAGGGAAAGTATCCCTAGAAGTGGATATCTATAATTTATTGTGAATTTACCTTTTTACAAGAGGTAGAAATAGTTCCCTTCGACAAGCGGAAGTATATTTGGTCTGTTCCGTGTGGAAGACTTTATACAAGAAATCTCTGTGCGTATAAAGGTGGTTTGTATTGTTTTTCAAGGTATTTAGTCTTTTTTCAGAGTTTACAGTTGCGGGGGGGGAGTTCTTGATGGTTTTATTTGCCGCGGTTATGAAATTCGGACCTCAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)