Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 05 Jun 2020 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

 This cluster: approximate FL confidence score = 97%

 1012079340 Xt7.1-IMAGE:6996089.5 - 28 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       2     2     3     3     2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     5     5     6     8     9    10    12    10    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    12    13    13    13    12    13    14    14    14    14    13    14    14    14    14    14    13    13    13    13    13    13    13    13    12    13    12    13    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    10    12    10    12    10    12    10    12    11    13    11    13    11    13    11    13    12    14    10    13    10    13    10    13    11    13    10    12     9    12    10    14    11    14    12    14    12    14     9    11     9    11     9    11     9    11    10    12    10    12    10    11    10    10    10    10    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    10    11    11    11    11    11    12    10    12     8    12    10    11     8    11     9    11    10    11    10    11    10    11    10    11     9    11    11    11    11    11    11    11     8    11    11    11    11    11    11    11    11    11    11    11    11    11     9    11    11    11    10    11     6     6     6     6     4     4     3     3     3     3     2     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     3     3     2     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -T---------C
                                               BLH ATG     276     606                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MIN     276      85                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH MPR      57      85                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               BLH OVR     276     925                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               CDS MIN     276      85                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               EST CLI     163       8                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                               ORF LNG     276      40                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ce ---- 5e-018     NP_499573.1 posterior Hox gene Paralog (php-3) [Caenorhabditis elegans] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Dm ---- 2e-020     NP_477498.1 fushi tarazu CG2047-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED - Ci ---- 3e-022     CAD59671.1 putative homeobox protein Hox10 [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Bf ==== 8e-029     AAF81909.1 homeodomain-containing protein Hox11 [Branchiostoma floridae] ==========================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---= 7e-029     XP_783352.1 PREDICTED: similar to Homeobox protein Hox-B9 (Hox-2.5) [Strongylocentrotus purpuratus] ==============================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = ?? ==== 4e-060     NP_001091264.1 hypothetical protein LOC100037070 [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dr ==== 5e-083     NP_571196.1 homeo box B9a [Danio rerio] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 2e-089     AAI06422.1 Unknown (protein for MGC:131095) [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 8e-099     NP_076922.1 homeo box B9; homeobox protein Hox-B9; homeo box 2E [Homo sapiens] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 4e-101     NP_032296.2 homeo box B9 [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Gg ==== 4e-103     XP_001233691.1 PREDICTED: similar to HOXB9 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 3e-146     CAJ82382.1 homeo box B9 [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                 Xt7.1-IMAGE:6996089.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAA------------------TGAATG---------------------------TGATGA---------TGA---------------------------TGA---------------------------------------------------------------------------------------------------TGA------TGA---------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---ATG------------------------------TAA---------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TAG---------------------------------------------TAA---------------------------ATGTAG------------------------------------ATG---------------------------------------TAAATGTAG---------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           Neu  FLx                    TNeu068g14.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGACAGGAATGGACACTGCGATTAAATACAATTTAATAAACAGAATTAGAGAGATCTGCAACCAGGGGCTTTGCTTTGCCTGCAGTCGGGGGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGTGAATTTACCTTTTTACAAGATGTAGAAATTGTTCCTTGTGACAAGTGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGTGTGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTACACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGTTTTTATTTCCATGGTTATTAAATTAGTGACTTCAAAAAAAAAAAAAAAAA
  5   1   2   14  bld Gas6 5g3  in                         ANBT1585.5p ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CGAGTGCGTTGTTGGTCGGATCTCAGGCGTGTCCCAGCCCTCATGCCCATAAAACAATGGCTCCCAGATATGAATGCTGACAGCTCCGTGCGGCCCCTCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGNCAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGG
  5   1   2       bld Gas8 5g3  in                          st97o16.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGAATGCTGACAGCTCCGTGCGGCCCCTCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTG
  5   1   2       bld 1030 5g                         IMAGE:7025777.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCCGATTGATGAATAGCCCTCTGACGCTTTATCAGGCACACGGAGAAAGTTTGACCAATCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTTCCGGACAATAAACTGTGTGAAGGGAAGCGGGGACAAAGACAGGACACATCCAAAGCAACCCCCTCAGCCAACTTGGGTTACATGGCCCGCCCTCCTTCCAGGAAAGGAAAAGGTGGCCCCCTACACCCAAAATACCAAGAACCCCTGGGAAACTGGGGAGAAAAGGGAATTT
  5   1   2      seed Tad5      in                         XZT11798.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCGCGTCGCGGAGCGTGGGCGGAGCGTGGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAAATGAGATGAAGAAACTA
  5   1   2       bld Gas8 5g                                st2o18.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TCATTTGCCAGGAGCTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCC
  5   1   2       bld TbA       in                   TTbA037c13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ATCTCACTCACCTGTCAGCCCATGTGCATCGAGTTGGCTAGCAATTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAATATGATGCCCTAGAATGGCCATTTCTGGGACTCTCATTAATTATTTTGCTTGGAGTCAATAATAACCCCTGAGAGTGAGGATGCTCCGGCAGCCTAATTCTCTGGACAGTACCCCATCCCCCGGCCAGCATCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCATTCCCAAAGCTCCTGTATTCAGCAGCGTCCT
  5   1   2       bld Neu  FL   in                  TNeu067h12.p1caSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCTACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAGGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTGTGGGGAGTGCCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTGCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAAGCAAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGC
  5   1   2       bld Neu0 FL   in                    IMAGE:5382211.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTCACACGCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCT
  5   1   2       bld Gas8 5g3  in                          st36n24.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAGCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAG
  5   1   2       bld Gas8 5x3  out                         st17f11.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGCAGCCCAAGTGCACCGAGTTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATT
  5   1   2       bld Gas8 5g3  in                         st103g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCAGCCCAAGTGCACCGAGTTGGCGAGCAAGTTGGGAGAGGGGAGAGCTCCTATATCTTGTTCCCTTCAATGAAGCTGCTGAGTAGGATGCCCGAGAATGGCCATTTCTGGGACTCTCAGTAATTATTTTGTGGAGTCAATAATAAGCCCTGAGAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCC
  5   1   2       bld Gas8                                 st104g12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AATTATTTTGTGGAGTCAATAATAANCCCTGACAGTGAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGC
  5   1   2       bld Neu0                               IMAGE:6996089                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGGAGGCTCCAGCAGCCAAATTCTCTGGACAGTACCCCAGCCCCCGGCCAGCAGCCCATTCAGCTCACTCTGAGCCCTTGGACTTTCCCTCCTGTAGTTTCCAGCCCAAAGCTCCTGTATTCAGCGCGTCCTGGAGCCCTCTGAACCCCCACCCAGCCAGCCCCCTGCCTTCTGTCTACCACCCCTACATCCAGCAGGGCGCCCCCACTCCGGAGGGCAGGTACTTACGGGGCTGGCTGGAGCCGCTGCAAAGAGCAGAGAATGGACCTGGCCAAGGAACTGTGAAGTCTGAGCCGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCANAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGGGTTTATTTTGTTTTTCCTTATACAGAAACTGACTGCACAAAAGGTGGGCACTTTACCTTTGCATGATCCC
  5   1   2       bld Gas8      in                          st54c12.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CGCTGCTGGGGCCCCCGGGGGAGCTGGACAAACTGGGAGCCCAACAGTACAATCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAGCAAGGCTATTTACCCACATAAAGACTGCAGCCTACCAAGACACATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATAT
  3   1   2       bld Gas8      out                         st17e11.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTGGGCTCGCCTGCTGCAAGAGAAGATGCCAATGAAAGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTT
  5   1   2       bld Neu  FLx  in                   TNeu068g14.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGACAGGAATGGACACTGCGATTAAATACAATTTAATAAACAGAATTAGAGAGATCTGCAACCAGGGGCTTTGCTTTGCCTGCAGTCGGGGGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTACCCACATAAAGACTGCAG
  3   1   2       bld Gas8 5g3  in                         st103g12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGCAAGAGAAGATGCCCATGAAAGGGGCCACTTTCCCGGACAATAAACTGTGTGAAGGAAGCGGGGACAAAGACAGGACACATCAAAGCAACCCCTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTGC
  3   1   2       bld Gas8      in                          st54c12.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CGGGGACNAAGACAGGACACATCAAAGCAACCCNTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTNTCAAGCACAAGGCTAGGGCTGCTTTTAAGCAAGGCTATTTACCCACATAAAGACTGCAGCCTACCAAGACACATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTNTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTT
  3   1   2       bld Gas8 5g3  in                          st36n24.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGGNCAANGNCNGGCNCATCAAAGCAACCCNTCAGCCAACTGGTTACATGCCCGCTCCTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTNTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCTACCAAGACACATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATNTNTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACNGAGAAGAGGTTAAATAGAAGCNCAAGAAACGCCCTCGCTT
  3   1   2       bld Gas8 5g3  in                          st97o16.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCAGCCAACTGGTTACATGCCCGCTCNTCCAGGAAGAAGAGGTGCCCCTACACCAAATACCAGACCCTGGAACTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTGC
  3   1   2       bld Gas6 5g3  in                         ANBT1585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGAGAAGGAATTTCTCTTTAACATGTATTTGACAAGGGACAGGAGGCATGAAGTTGCCAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAA
  3   1   2       add Tad5      in                         XZT11798.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGTTGCCAGTTTATTGCACTTGAGGGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAACCTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCTCTTGCTCTTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTGTCAAGCACAAGGCTAGGGTTGCTTTTAAACAAGTCTATTTTCCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATGCCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAA
  3   1   2       bld Neu0 FL   in                    IMAGE:5382211.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGGCTATTGAACCTGAGCGAAAGACAGGTCAAAATCTGGTTCCAGAACCGAAGAATGAAGATGAAGAAACTAAACAAAGATCAGAGCAAAGATTAACCCTTCCCTTCCCCTGCTCCTTATTTATGGTACAATGTGAAGGTCCAGCTGAAGGTTGGGTGCCAGATTAAAGGCCAAGTTAGTACTACGGGGTAGCTGCAGTCCATTACACTTATTCTCATTGTGTTTATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATATCGCCACCACATACCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       add Neu  FL   in                    TNeu067h12.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TATTTTGTTTTTCTTTATACAGAAACTGACTGCACAAAGGTGGCACTTCCCTTGCATGATCCTTTCAAGCACAAGGTTAGGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACATTTCGCCCCCCCATCCCATAAATCAATAATCCCCATAAAGAGGCATATATATATTTCTTCCCACCCGCATTTTTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATATTGAGCTTGAATATAAAACGTTTGAGAGAGCCAGAGAAGGGGTTAAATAGAAGCCCAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGGGAATTTCCCTTTTTCCAAGATGTAGAAATTGTTCCTTGTGACAAGGGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGGGGGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTCCACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGTTTTTATTTCCCAGGGTTATTAAATTAGTGACTTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld Neu  FLx  in                    TNeu068g14.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAAACTGACTGCACAAAGGTGGCACTTACCTTGCATGATCCTCTCAAGCACAAGGCTACGGCTGCTTTTAAACAAGGCTATTTACCCACATAAAGACTGCAGCCAACCAAGACANTATCGCCACCNACATACCATAAATNCAATAATCCCCATAAAGAGGCATATATATATTTCATCCCAACCGCATCTCTTATTAAAGGGCCTTGAAACCAGCAAGACTCCCATTTTTATACTGAGCTTGAATATAAAACGTTTGAGAGAGACAGAGAAGAGGTTAAATAGAAGCACAAGAAACGCCCTCGCTTTGCTGAATTAGTTTTGTAGAAACCAAGGGTTAAAAAAAAAATGTAAAAAAAAAAGATTTTTTTTGTTTGTTTTGTTTTAGAAGAGGGTGGGAAAAAGTGAATGTATCCCTAGAAGTAGATATTTATAATTTATTGTGAATTTACCTTTTTACAAGATGTAGAAATTGTTCCTTGTGACAAGTGACTGTATATTTTGTATGTTCCTGTTGAAGACTTTATACTTGAAATCTCTGTGTGTATAAATGTAGTTTGTATTTTTTTCAAGGTATTTTGTCATTTTACACTGTTTACAGTTGCGGGGGGGGAGTTCATGATGNTTTTTATTTNCCATGGTTATTAAATTAGTGATTCAAAAAAAAAAAAAAAAA
  3   1   2       add TbA       in                    TTbA037c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGGCATATATATATTTCTTCCCAACCGCATGTCTTATTAAAGGGCTTTGAAACCAGCTAGACTCCCATCTTTATACTGAGCTGGAATCTAAAACGTTTGCGTGAGACTGAGAAGCGGTTAAATAGAGGCACAAGAAACGCCCTCCCTTTGCGGAATTAGTTTTGTGGACACCAAGGGCTAAAAAAAAAATGTAAAAAAAAAAGGTTTGTTGGTGGTGTTTTGTTTCAGACGAGGGCGGGAAAAAGGGAAAGTATCCCTAGAAGTGGATATCTATAATTTATTGTGAATTTACCTTTTTACAAGAGGTAGAAATAGTTCCCTTCGACAAGCGGAAGTATATTTGGTCTGTTCCGTGTGGAAGACTTTATACAAGAAATCTCTGTGCGTATAAAGGTGGTTTGTATTGTTTTTCAAGGTATTTAGTCTTTTTTCAGAGTTTACAGTTGCGGGGGGGGAGTTCTTGATGGTTTTATTTGCCGCGGTTATGAAATTCGGACCTCAAAAAAAAAAAAAAAA

In case of problems mail me! (