Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZG63624.5                            5 END     3          18       60                zinc finger protein 64 [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012079438 Xt7.1-CABI13230.3 - 16 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABI13230.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACAGCGCAGCAACTTGACCACCCACATAAAGAAATGTCACGGGGACCAAGTGAAACCCAGAAAGAGCTCTCTGCACAGAAAAGAGGGGGACTCCCCAAGGCATTACACGTCCCGTAAAGGCACCAAGTTGGAGGCTAAGAAAGCATATAATTGTGACCTTTGTGATGCGTCTTTTGTTAGGGAAGACTCCCTGCGGAGTCATAAGAAACAGCACAGTGAGATCATTGCTGCCCAGAAGGCTTCAGGCCTGGACTTTATCCCTTTGGCAACCAGCGCACCGCGTTCCAGTACTATTGCAATAAGGAATATTAAGTTCCCCACTACGATTCTACCCTTTGGGCAGGACGGAGTAAAGCTCATGGGCGACCATCCCCTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCA
                                                  Xt7.1-CHK-1008231951                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAGCAACTTGACCACCCACATAAAGAAATGTCACGGGGACCAAGTGAAACCCAGAAAGAGCTCTCTGCACAGAAAAGAGGGGGACTCCCCAAGGCATTACACGTCCCGTAAAGGCACCAAGTTGGAGGCTAAGAAAGCATATAATTGTGACCTTTGTGATGCGTCTTTTGTTAGGGAAGACTCCCTGCGGAGTCATAAGAAACAGCACAGTGAGATCATTGCTGCCCAGAAGGCTTCAGGCCTGGACTTTATCCCTTTGGCAACCAGCGCACCGCGTTCCAGTACTATTGCAATAAGGAATATTAAGTTCCCCACTACGATTCTACCCTTTGGGCAGGACGGAGTAAAGCTCATGGGCGACCATCCCCTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCTGC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     5     6     6     7     7     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9    10    10    10    10    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    11    13    13    13    11    13    13    13    13    13    12    13    11    12    11    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    13    13    13    13    12    12    11    12    12    12    12    12    12    12     9    11    11    11    10    11     9    10    10    10    10    10     9    10    10    10    10    10    10    10     9    10    10    10    10    10
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --C---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------C----T
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----T--T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----C-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G-G
                                                                       ...PROTEIN --- Mm ---- 6e-014     NP_033590.1 zinc finger protein 64 [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                           PROTEIN --- Hs ---- 9e-034     NP_071371.3 zinc finger protein 64 isoform b; zinc finger protein 338 [Homo sapiens] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 3e-046     NP_001026040.1 zinc finger protein 64 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABI13230.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ATG---------------------------------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------TGA------------------ATG---------ATG------------------------------------------TGA---------------------------------------TAGTAG---------------------ATG---------TAG------------------------------------------------TAG---------------TGA------------------------------------TAG------------------------------TAG------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2       bld Ovi1      in                        CABI13230.5p                                                                                                                                                                                                                                                                                          CATCGATTCGGCTGCCGTACCCTGGATGCAGTTCAGACCGCGTATGGGCTGAAAGATCTGGAGCGCCACTTAAGGACTCACACGGGTGACAAGCCCCACAAATGCCCGACCTGTGATAAAGCCTTTAGCAGGAAGGACAAGCTGAAGACCCACATGCGCTCCCACACGGGGGAGAAACCATTCAAGTGCAAGGAATGCGACTACAGGGCGGCAGACAGCAGCAGCCTATGCAAGCACCAGCGAATACACACTAATGAGCGACCATTTAAATGCCAGATCTGTCCGTATGCTAGCCGCAATTCCAGCCAGCTCACTGTGCACCTACGCTCGCACACAGGTGACGCTCCCTTCCAGTGCATTCTGTGCAACGCTAAATTTAAAATAAACTCTGACTTAAAGAGACACATGCGTGTTCACACGGGGGAGAAACCCTTCCGCTGCGACTTCTGCAACTTTGTCTGTGCCATGAAAGGAAACTTGAAGTCCCACATCCGGATGAAACATAACACAGAGACCACATTCAAGTGCTTGGAGTGCAATTTCCAGTGCGGCAGCAAAGCCGACTTACGGCAACACGTACGCTGCCACCTCCCGGAGCAGCCGGTTAAATGCGCGGATTGCAGCTACTCCTGTTCCAGCAAAGCTGCCCTGAAAGTACACGAGAGGATTCACTCTAAAGACCGTCCCTTTAAATGCAACTTCTGCCAGTTTGATACAAAACAGCGCAGCAACTTGACCACCCACATAAAGAAATGTCACGGGGACCAAGTGAAACCCAGAAAGAGCTCTCTGCACAGAANAGAGGGGGACTCCCCAAGGCATTACACGTCCCGTAAAGGCACCAAGTTGGAGGCTAAGAAAGCATATAATTGTGACCTTTGTGATGCGTCTTTTGTTAGGGAAGACTCCCTGCGGAGTCATA
  5   1   2       bld Brn4      in                         CAAL6794.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             NTTTGATACAAAACAGCGCAGCAACTTGACCACCCACATAAAGAAATGTCACGGGGACCAAGTGAAACCCAGAAAGAGCTCTCTGCACAGAAAAGAGGGGGACTCCCCAAGGCATTACACGTCCCGTAAAGGCACCAAGTTGGAGGCTAAGAAAGCATATAATTGTGACCTTTGTGATGCGTCTTTTGTTAGGGAAGACTCCCTGCGGAGTCATAAGAAACAGCACAGTGAGATCATTGCTGCCCAGAAGGCTTCAGGCCTGGACTTTATCCCTTTGGCAACCAGCGCACCGCGTTCCAGTACTATTGCAATAAGGAATATTAAGTTCCCCACTACGATTCTACCCTTTGGGCAGGACGGAGTAAAGCTCATGGGCGACCATCCCCTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAG
  5   1   2       bld Ova1      in                         CABE4256.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GATGCGTCTTTTGTTAGGGAAGACTCCCTGCGCCCTCATAAGAAACAGCACAGTGAGATCATTGCTGCCCAGAAGGCTTCAGGCCTGGACTTTATCCCTTTGGCAACCAGCGCACCGCGTTCCAGTACTATTGCAATAAGGAATATTAAGTTCCCCACTACGATTCTACCCTTTGGGCAGGACGGAGTAAAGCTCATGGGCGACCATCCCCTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATCATACAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGACGCCGGAGACTATATCCGAATGCAGGAGCCT
  5   1   2       bld Gas7      in                         XZG61622.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCGTCTTTTGTTAGGGAAGACTCCCTGCGGAGTCATAAGAAACAGCACAGTGAGATCATTGCTGCCCAGAAGGCTTCAGGCCTGGACTTTATCCCTTTGGCAACCAGCGCACCGCGTTCCAGTACTATTGCAATAAGGAATATTAAGTTCCCCACTACGATTCTACCCTTTGGGCAGGACGGAGTAAAGCTCATGGGCGACCATCCCCTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTC
  5   1   2       bld Liv1      in                          CAAR954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTTTGGCAACCAGCGCACCGCGTTCCAGTACTATTGCAATAAGGAATATTAAGTTCCCCACTACGATTCTACCCTTTGGGCAGGACGGAGTAAAGCTCATGGGCGACCATCCCCTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAG
  3   1   2      seed Ovi1      in                        CABI13230.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCCTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCTGCTTGT
  3   1   2       bld Gas       ?                     TGas105j18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTAATAGAAGGGGCTACTGCAGAGACCACGTCCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTAATGGAAAATCTGAATAAATTTTGATCAACCCTGCTGTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG61622.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCAGAGACCACGTTCGAGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTTGAGTCAGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCTGCTTGTAAAAAAAAAAAAAAAGG
  3   1   2       bld Brn4      in                         CAAL6794.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGCCTGCTAGAGCTTTAGACAGTATGGCAAAGGTCCAAGACCACATGGCTACCAGCCAGCTCAGACTGTGAGTCAGGGTCAATTTAATAGCATCGCCTTCTGCTGCCCAAAAACTTGCTTTGCCGGATATCGGTAACAATCCCATCCAACACCATCTGGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCTGCT
  3   1   2       bld Lun1      out                       CABD10750.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCCAAAAACTTGCTTTGCCGGATATGGGTAACAATCCCATCCAACCCCATTTGGATGAAAGCGGTACAGACAACGCCCAAGAGACTAACGATGAGGGGTTTATGTCTGCCTCCAGCATCGATGAGGGCTTTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTTTTAGTGATGCAGGAGACTATTTCCGAATGGAGGAGCCTCCCCAGTCGCCTGTTTTTTTTCCGTTTCCCCTTGTTAACACACCCAAACGCAGGTACATTGTTGTCCAGGGGGATCCCCATTTTGTTTTTTTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTCCCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTTTGTATGTAGAAATGCATGAGAAATAGGGGGGTCCAATTTCCAAGGACCGTTAGTGAACTAGTAGGCCCCGCGGCGGATTTTTCCGATGGAAGGGGAGTAGTCCAGAATTTTTTTTTTTAAAACATTTTGTATCCAGGGTAGCTATTTTTAGAATTTCATACACCATTGAGATGGGTATGGGGGTATATATGTATATATAGTTTCATAGAAGGGGGGGTATATAAATGACTTTTTGGGGTAGGGCCAGGTTTGGATCATTTGCTGGAAAATCTGAATAAATTTTGATCAC
  3   1   2       bld Gas7 PIPE out                        XZG63624.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGATGAAAGCGGTACAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTTTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTTTGTTTTTTTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTCCCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTTTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGGGTATATATGTATATATAGTTTCATAGAAGTGGGGGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCTGCTTGT
  5   1   2       bld Gas1      in                     NISC_mq24g06.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGACAACGACCAAGAGACTAACGATGAGGCGTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGC
  3   1   2       bld Ova1      in                         CABE4256.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTATGTCTGCCTCCAGCATCGATGAGTGCTCTGACCTTGATCATCTTCATATAATAAAGGAGGAGCCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGGGGAGCCTCCCCAGTCGCCTGTTTTCTTTCCGTCTCCCCTTGTTAACACACCCAAACGCAGTTACATCGTTGTCCAGGGGGATCCCCATTTTGTTTTTTTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTCCCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGTGTCCAATTTCCAAGGACCGTTAGTGAACTAGTAGGCCCCGCGGCGGATTTTTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTTTAAAACATCTTGTATCCAGGGTAGCTTTTTTTAGAATTTCATCCAGCATTGAGATGTGTATGTGGGTATATATGTATATATAGTTTCATAGAAGGGGGGGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATTTGCTGGAAAATCTGAATAAATTTTGATCACCCTGCTTGTaaaaaaaaaaaaaaaaaaaaaccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld Liv1      in                          CAAR954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCCGTAGAAGTGACAATTGTTAGTGATGCAGGAGACTATATCCGAATGGGGGGGCCTCCCCAGTCGCCTGTTTTTTTTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGGGGATCCCCATTTTGTTTTTTTGTGTCCAGCAGACTCCATACCAGACTGACCCTTTATACCCATTCCCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCCCCGCGGCGGATTTTTCCGATGGAAGTGGGGTAGTCCAGAATTTTTTTTTTTAAAACATCTTGTATACAGGGTAGCTTTTTTTAGAATTTCATACAGCATTGAGAGGGGTATGGGGGTATATATGTATATATAGTTTCATAGAAGGGGGGGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCCGCTTGTaaaaaaaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2       bld Neu                            TNeu102a19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGGAGGAGCCTCACCAGTCGCCTGTTTTCTCTCCGTCTCCCCTTGTTAACACACCCAAACGCAGCTACATCGTTGTCCAGGAGGATCCACATTCTGCTCTTCTGTGTCCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCTGCTTGTG
  3   1   2       bld Gas1      in                     NISC_mq24g06.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCAGCAGACTCCATACCAGACTGACACTTTATACCCATTACCATGAATACTAAAATGTTCCTTTGCCTTGGCATACAGCTGTCTGTATGTAGAAATGCATGAGAAATAGCGGCGTCCAATTTACAAGGACCGTTAGTGAACTAGTAGGCACCGCGGCGGATTATTCCGATGGAAGTGGAGTAGTCCAGAATTTTTTTTTCTAAAACATCTTGTATACAGGGTAGCTATTATTAGAATTTCATACAGCATTGAGATGTGTATGTGTGTATATATGTATATATAGTTTCATAGAAGTGTGTGTATATAAATGACTTTTTGGTGTAGGGCCAGGTTTGGATCATCTGCTGGAAAATCTGAATAAATTTTGATCAACCTGCTTGTAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)