Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABD12212.3.5                        61 END     1           5        1                triple functional domain (PTPRF interacting) [Homo sapiens]
     2   2.0    0Xt7.1-CAAR6826.5                            4 END     3          17       75                LOC495509 protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     3 187.0    0Xt7.1-CAAO5551.3                            5 PI      85       1360     1517                (no blast hit)
     4 185.0    0Xt7.1-EC2CAA16AD02.5                        2 PI      75       1280     1513                (no blast hit)

         CS%  VC Transcript                               Size Type    Value     Low High         Identified Blast Description.
     5  22.0    0(repeat)                                    0 REP     82        976     1237                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012079439 Xt7.1-CAAR10095.3 - 17 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAR10095.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATGGAGTTTATGCAATTGCTAGATGTTGCATTTGGCCAAAAGCTGTCTGTCACATTAATTCTACCACACCTGAAGATGGAGAAGAGCCATCCACTGTAAGCTGCTCAAATGAGGACCACATTTTAACTGGGTGCAGCTCTCATCATGGGTCTGGACATTTGAGTGACTTTGTAAGGCCCATACACAGGGCTGGCAATGAAGGCTCGGCTTGTGTTGGGAAAAGTGAGGTCACTTCCCATGCTCTGTGCTGCCATGCACCAGACATTGCCTGCAAAGTGAAAGAATATTCTCCCGTGGGCTTTATGGACAAGGTGACTGTTTCATGCGATGAAGGCTGGACGCTGACTGGCTGCAATGCATACTCCCGCAGTTCCAATACTCTGGGAGCATATTCTATTGATGACACCTGCGTTGTGTCAAACCCTAAAGGTGGAAAAGGAGCTGCCGCCATAGCTATCTGCTGCCAGAACAAACACACTGAAAACAAACAAAACACAAACTACCGGTGAATTATACCAATATAACCTTCTGACTTGTGAAGCTTTGAACTATTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAGAAAAAAAAAAAAAAAGCTTCCCTTTCTGCAAAAGACCCTAATATATAGTGCACAGATATTTATAAACATGGCCCTTTTCAGTGGCATATCTTATAGGTCACGGTATCTAGAGCAGGAAACAAGAATGACAATTGCTAAAAAGAACAAACTTTGATTAGGGCAACATGACCCTTAAAGGACATGTAAACCCTTCACAAAAAATGTAACCAGTGAACAGCCTCTTTGAAATCTTTAAATACTTGCCACTGTTGTTGTTCAGAGGTTAATAGTAAGGCTGCAGCATCCCCTTAATCACTTTGGATTCCTTCTGCTCTAACCCACTTGGCCCCTCCCTTAAGAATTAACTTTGGCTGTTGGCTACTGGGCATGCTCAGTTCTTCTCAACTCAGGTTACCAAACACACCCTTCAGTCTAACAGCCAATGAAGAGATTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAAGATGTATAAGTTACTGAAGATGTGTCAGAGGGAAAATGGCCACTGGGTGAAAGCTGCTATATGTTTTAGGAAAGTGTGATGGTGCTGGTAAACAGAGTGGATATATGCAGTATAAAGGATGTAGTGTGGGAGATGTGCCCAACTTATATACATGGTAAGAAAATGTAGGGTTTACATGTCCTTTAACTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTTGAATAA
                                                  Xt7.1-CHK-1008231741                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTTATGCAATTGCTAGATGTTGCATTTGGCCAAAAGCTGTCTGTCACATTAATTCTACCACACCTGAAGATGGAGAAGAGCCATCCACTGTAAGCTGCTCAAATGAGGACCACATTTTAACTGGGTGCAGCTCTCATCATGGGTCTGGACATTTGAGTGACTTTGTAAGGCCCATACACAGGGCTGGCAATGAAGGCTCGGCTTGTGTTGGGAAAAGTGAGGTCACTTCCCATGCTCTGTGCTGCCATGCACCAGACATTGCCTGCAAAGTGAAAGAATATTCTCCCGTGGGCTTTATGGACAAGGTGACTGTTTCATGCGATGAAGGCTGGACGCTGACTGGCTGCAATGCATACTCCCGCAGTTCCAATACTCTGGGAGCATATTCTATTGATGACACCTGCGTTGTGTCAAACCCTAAAGGTGGAAAAGGAGCTGCCGCCATAGCTATCTGCTGCCAGAACAAACACACTGAAAACAAACAAAACACAAACTACCGGTGAATTATACCAATATAACCTTCTGACTTGTGAAGCTTTGAACTATTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAGAAAAAAAAAAAAAAAGCTTCCCTTTCTGCAAAAGACCCTAATATATAGTGCACAGATATTTATAAACATGGCCCTTTTCAGTGGCATATCTTATAGGTCACGGTATCTAGAGCAGGAAACAAGAATGACAATTGCTAAAAAGAACAAACTTTGATTAGGGCAACATGACCCTTAAAGGACATGTAAACCCTTCACAAAAAATGTAACCAGTGAACAGCCTCTTTGAAATCTTTAAATACTTGCCACTGTTGTTGTTCAGAGGTTAATAGTAAGGCTGCAGCATCCCCTTAATCACTTTGGATTCCTTCTGCTCTAACCCACTTGGCCCCTCCCTTAAGAATTAACTTTGGCTGTTGGCTACTGGGCATGCTCAGTTCTTCTCAACTCAGGTTACCAAACACACCCTTCAGTCTAACAGCCAATGAAGAGATTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAAGATGTATAAGTTACTGAAGATGTGTCAGAGGGAAAATGGCCACTGGGTGAAAGCTGCTATATGTTTTAGGAAAGTGTGATGGTGCTGGTAAACAGAGTGGATATATGCAGTATAAAGGATGTAGTGTGGGAGATGTGCCCAACTTATATACATGGTAAGAAAATGTAGGGTTTACATGTCCTTTAACTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTTGAATAAAACATA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     3     2     3     2     3     2     3     2     4     2     4     2     4     3     4     3     4     3     4     3     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     6     6     6     6     6     6     4     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     5     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     5     6     8     9     8     9     9    10     9    10    10    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     6     6     4     6
      1                                                DETECTED REPEAT                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              
                                                                       ...PROTEIN --- Mm ---- 6e-034     NP_705793.1 proprotein convertase subtilisin/kexin type 9; neural apoptosis regulatedconvertase 1; convertase subtilisin [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 9e-038     NP_777596.2 proprotein convertase subtilisin/kexin type 9 preproprotein; neural apoptosisregulated convertase 1; hypercholesterolemia, autosomal dominant 3 [Homosapiens] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 9e-094     AAH85208.1 LOC495509 protein [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - ?? ---- 9e-094     NP_001088613.1 hypothetical protein LOC495509 [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAR10095.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------TAA------------TGA------------------------------------------------------------TGA---------------ATG---------TAG---------------------------------------------------------------------------------------------TAG---------------------------------------------TAGTAA------------------TAA------------------------------------------TAA---------------------TAA------------------------------------------TAG---------------TGA---------------------------TAG------ATG---------------------------------ATGTAA---------------------------------------------------------TAATAGTAA---------------------------------------------------------------------TAA------------------------------------------------------------------------------TGA---------------------------TAA------------------------------------------------------------------------TAA---------------------------------------------------ATG---TAG---------ATG---------------------------------------------------ATG---------------------------ATGTAG---------------TAA------TAAATGTGA---------------------------------------------------------------TAG---------TGA---------TAA---TAG---------------------------------TAA------TAGTAA---------------------------------------------------------------ATG------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  3   1   2       bld Int1 PIPE out                       CAAP11688.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AGAGGAAGAGGTGGAAGGAAGACGTGTATTGCGCACAATGCATTTGGGGGAGATGGAGTTTATGCAATTGCTAGATGTTGCATTTGGCCAAAAGCTGTCTGTCACATTAATTCTACCACACCTGAAGATGGAGAAGAGCCATCCACTGTAAGCTGCTCAAATGAGGACCACATTTTAACTGGGTGCAGCTCTCATCATGGGTCTGGACATTTGAGTGACTTTGTAAGGCCCATACACAGGGCTGGCAATGAAGGCTCGGCTTGTGTTGGGAAAAGTGAGGTCACTTCCCATGCTCTGTGCTGCCATGCACCAGACATTGCCTGCAAAGTGAAAGAATATTCTCCCGTGGGCTTTATGGACAAGGTGACTGTTTCATGCGATGAAGGCTGGACGCTGACTGGCTGCAATGCATACTCCCGCAGTTCCAATACTCTGGGAGCATATTCTATTGATGACACCTGCGTTGTGTCAAACCCTAAAGGTGGAAAAGGAGCTGCCGCCATAGCTATCTGCTGCCAGAACAAACACACTGAAAACAAACAAAACACAAACTACCGGTGAATTATACCAATATAACCTTCTGACTTGTGAAGCTTTGAACTATTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTG
  3   1   2       bld Gas       out                   TGas113n20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACAGGCCCAGCATCTGCCAGTGTGGGGCTACACGGAGTGGATATTAATGCAAAAAATAATGCAGTGGATATTGATGTATACTATTGATGCAAAAATGCATGCTATACCCTCGGCATAGCAGTAATGGAATGTTGTTGAACAGGGTGCAGCTCTCATCATGGGTCTGGACATTTGAGTGACTTTGTAAGGCCCATACACAGGGCTGGCAATGAAGGCTCGGCTTGTGTTGGAAAAAGTGAGGTCACTTCCCATGCTCTGTGCTGCCATGCACCAGACATTGCCTGCAAAGTGAAAGAATATTCTCCCGTGGGCTTTATGGACAAGGTGACTGTTTCATGCGATGAAGGCTGGACGCTGACTGGCTGCAATGCATACTCCCGCAGTTCCAATACTCTGGGAGCATATTCTATTGATGACACCTGCGTTGTGTCAAACCCTAAAGGTGGAAAAGGAGCTGCCGCCATAGCTATCTGCTGCCAGAACAAACACACTGAAAACAAACAAAACACAAACTACCGGTGAATTATACCAATATAACCTTCTGACTTGTGAAGCTTTGAACTTTTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTCTACTAATATAAACATATCTCTTACTTATAGCCAAATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Liv1 5g3  out                        CAAR6826.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGATGGAGTTTATGCAATTGCTAGATGTTGCATTTGGCCAAAAGCTGTCTGTCACATTAATTCTACCACACCTGAAGATGGAGAAGAGCCATCCACTGTAAGCTGCTCAAATGAGGACCACATTTTAACTGGGTGCAGCTCTCATCATGGGTCTGGACATTTGAGTGACTTTGTAAGGCCCATACACAGGGCTGGCAATGAAGGCTCGGCTTGTGTTGGGAAAAGTGAGGTCACTTCCCATGCTCTGTGCTGCCATGCACCAGACATTGCCTGCAAAGTGAAAGAATATTCTCCCGTGGGCTTTATGGACAAGGTGACTGTTTCATGCGATGAAGGCTGGACGCTGACTGGCTGCAATGCATACTCCCGCAGTTCCAATACTCTGGGAGCATATTCTATTGATGACACCTGCGTTGTGTCAAACCCTAAAGGTGGAAAAGGAGCTGCCGCCATAGCTATCTGCTGCCAGAACAAACACACTGAAAACAAACAAAACACAAACTACCGGTGAATTATACCAATATAACCTTCTGACTTGTGAAGCTTTGAACTATTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAG
  5  -1   2       bld Abd0                               IMAGE:7002635                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GCTGTCTGTCACATAATTCTACCACACCTGAAGATGAGAAGAGCCATCCACTGTAAGCTGCTCAAATGAGGACCACATTTTAACTGGGTGCAGCTCTCATCATGGGTCTGGACATTTGAGTGACTTTGTAAGGCCCATACACAGGGCTGGCAATGAAGGCTCGGCTTGTGTTGGGAAAAGTGAGGTCACTTCCCATGCTCTGTGCTGCCATGCACCAGACATTGCCTGCAAAGTGAAAGAATATTCTCCCGTGGGCTTTATGGACAAGGTGACTGTTTCATGCGATGAAGGCTGGACGCTGACTGGCTGCAATGCATACTCCCGCAGTTCCAATACTCTGGGAGCATATTCTATTGATGACACCTGCGTTGTGTCAAACCCTAAAGGTGGAAAAGGAGCTGCCGCCATAGCTATCTGCTGCCAGAACAAACACACTGAAAACAAACAAAACACAAACTACCGGTGAATTATACCAATATAACCTTCTGACTTGTGAAGCTTTGAACTATTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATTCCCGGG
  3  -1   2       bld Int1      in                         CAAP7654.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TTACTGGGTGCAGCTCTCATCATGGGTCTGGACATTTGAGTGACTTTGTAAGGCCCATACACAGGGCTGGCAATGAAGGCTCGGCTTGTGTTGGGAAAAGTGAGGTCACTTCCCATGCTCTGTGCTGCCATGCACCAGACATTGCCTGCAAAGTGAAAGAATATTCTCCCGTGGGCTTTATGGACAAGGTGACTGTTTCATGCGATGAAGGCTGGACGCTGACTGGCTGCAATGCATACTCCCGCAGTTCCAATACTCTGGGAGCATATTCTATTGATGACACCTGCGTTGTGTCAAACCCTAAAGGTGGAAAAGGAGCTGCCGCCATAGCTATCTGCTGCCAGAACAAACACACTGAAAACAAACAAAACACAAACTACCGGTGAATTATACCAATATAACCTTCTGACTTGTGAAGCTTTGAACTATTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAGAAAAAAAAAAAAAAAGCTTCCCTTTCTGCAAAAGACCCTAATATATAGTGCACAGATATTTATAAACATGGCCCTTTTCAGTGGCATATCTTATAGGTCACGGTATCTAGAGCAGGAAACAAGAAATGACATTGCTAAAAAGAACAACTTTGA
  5   1   2       bld Liv1      in                        CAAR10095.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCCCAAGACATTTGAAACATAAATTTTAATATGCATGTTGTTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAGAAAAAAAAAAAAAAAGCTTCCCTTTCTGCAAAAGACCCTAATATATAGTGCACAGATATTTATAAACATGGCCCTTTTCAGTGGCATATCTTATAGGTCACGGTATCTAGAGCAGGAAACAAGAATGACAATTGCTAAAAAGAACAAACTTTGATTAGGGCAACATGAcccttaaaggacatgtaaacccttcacaaaaaatgtaaccagtgaacagcctctttgaaatctttaaatacttgccactgttgttgttcagaggttaatagtaaggctgcagcatccccttaatcactttggattccttctgctctaacccacttggcccctcccttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtaT
  5   1   2       bld Liv1      in                         CAAR7724.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTACACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAGAAAAAAAAAAAAAAAGCTTCCCTTTCTGCAAAAGACCCTAATATATAGTGCACAGATATTTATAAACATGGCCCTTTTCAGTGGCATATCTTATAGGTCACGGTATCTAGAGCAGGAAACAAGAATGACAATTGCTAAAAAGAACAAACTTTGATTAGGGCAACATGAcccttaaaggacatgtaaacccttcacaaaaaatgtaaccagtgaacagcctctttgaaatctttaaatacttgccactgttgttgttcagaggttaatagtaaggctgcagcatccccttaatcactttggattccttctgctctaacccacttggcccctcccttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagacaatgtagggtttacatgtcctttaacTGCTGTAAATGTGATTGTTACAGTGTACTCTTTCATA
  5   1   2       bld TpA       in                  TTpA049n17.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GCATATCTTATAGGTCACGGTATCTAGAGCAGGAAACAAGAATGACAATTGCTAAAAAGAACAAACTTTGATTAGGGCAACATGACCCttaaaggacatgtaaacccttcacaaaaaatgtaaccagtgaacagcctctttgaaatctttaaatacttgccactgttgttgttcagaggttaatagtaaggctgcagcatccccttaatcactttggattccttctgctctaacccacttggcccctcccttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCCTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAAGATGTATAAGTTactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaaCTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCC
  5   1   2       bld Int1      in                         CAAP6432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATTCGGCACGAGGCTAGAGCAGGAAACAAGAATGACAATTGCTAAAAAGAACAAACTTTGATTAGGGCAACATGAcccttaaaggacatgtaaacccttcacaaaaaatgtaaccagtgaacagcctctttgaaatctttaaatacttgccactgttgttgttcagaggttaatagtaaggctgcagcatccccttaatcactttggattccttctgctctaacccacttggcccctcccttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaacTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTTGAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATGGCACTAAAGGCAATAGTA
  5  -1   2       chi Int1      in                         CAAP7654.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GACTGGTGAAGCTTTGAACTATTTTTTTTAAGTTGTACATTGGAATATTGGCATTCTGCNCAAGACATTTGAAACATAAATTTTAATATGCATGTTGGTTAGCTGAAGGTATATATCAGGCATCTGCAAGTTGTAGCTGTAGTTATTGTACTAATATACACATATCTCTTACTTATAGCCAGATTCTGTTGGGAGTAGCAGAAAAATGTAAGAACCTTACAACAGGTTGTATTATTACATCTATAGTAAGCTGAGCTATACACAATATAAAAAGAAAAAAAAAAAAAAAGCTTCCCTTTCTGCAAAAGACCCTAATATATAGTGCACAGATATTTATAAACATGGCCCTTTTCAGTGGCATATCTTATAGGTCACGGTATCTAGAGCAGGAAACAAGAATGACAATTGCTAAAAAGAACAAACTTTGATTAGGGCAACATGTCCTTTAACTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGT
  3   1   2       bld Int1      in                         CAAP6432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCACTTTGGATTCTttctgctctaccccacttggcccctcccttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaacTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAG
  3  -1   2      seed Int1      in                         CAAP2017.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 tctgctctaacccacttggcccctcccttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaacTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTTGAATAAA
  5  -1   2       bld Int1      in                         CAAP2017.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GctctaacccacttggcccctcctttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaacTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTGAATAAA
  3   1   2       bld Liv1      in                        CAAR10095.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GctctaacccacttggcccctcccttaagaattaactttggctgttggctactggncatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaacTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTTGAATAAAACATAAAAATAT
  3   1   2       bld TpA       in                   TTpA049n17.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ttaagaattaactttggctgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCCTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAAGATGTATAAGTTactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaaCTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTTGAATAAAACATAAAAATTAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Liv1      out                        CAAR6045.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              tgttggctactgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCCTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaacTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTTGAATAAAACATAA
  3   1   2       bld Liv1      in                         CAAR7724.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      actgggcatgctcagttcttctcaactcaggttaccaaacacacccttcagtctaacagccaatgaagagaTTTTTTTCTCTTAACCTCAACTTAACCGTTACAGGGCACAACCCAAGCAGAACTTTTCATCAAAGTAGGTTCTGCCTGTGTAAACCTGCAagatgtataagttactgaagatgtgtcagagggaaaatggccactgggtgaaagctgctatatgttttaggaaagtgtgatggtgctggtaaacagagtggatatatgcagtataaaggatgtagtgtgggagatgtgcccaacttatatacatggtaagaaaatgtagggtttacatgtcctttaacTGGTGTAAATGTGATTGTTACAGTGTACTCTTTCATATAAAAGTAACTTACATTCTCATTTTTTAGTCCCTTTAGCATAGAATGTTTTTTGAAAACATCTATAATTGTAGTTGTCAGGCTTAGTGCTTTCTCTTTTATTGCACTAAAGGCAATAGTAAGAGCTTGTATCTAAATTGTTTGTTCTAGTCTTTATTGCGAATTACAGACAGGAGTTATATACAATGAGCCTTAGGTTCTAGGATGTCAAGCTTGGGAAGGATAGGAATGACATCTCCAGGCACTGGCTGAGGACCTCTGAAGTCATATTTCACTGCAATGCTGAAGTAGGACATTACTGCTTAAAGCTTTGCTTTCCACTGTACTTCTCTTTTTATACTTTGGACATATTTATTTGGGGCTTGTGAACTAGCTTTGTTTTGTACATCAGTCATATTTGAATAAAACATAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)