Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 28 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     11.6699999999999999    0Xt7.1-TNeu085g11.5                          3 END     3          10      100                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 240.0    0Xt7.1-TGas119l01.3                        106 PI      78        659     1009                novel similar to snail homolog 2 (Drosophila) (SNAI2) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 97%

 1012079481 Xt7.1-TNeu122i19.3 - 28 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu122i19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAGAAGTTATTGGGGGGGCGGAGCCCGGTGCCTCCCATTCTGCACCTGACTGCTCAGCTATTTACAGCACTTTGTAAGAAGTCTTAGCGCTGCCACTTGGTGAATGGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTGTTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTTAAAAAAAAAA
                                                  Xt7.1-CHK-1008228620                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGTTATTGGGGGGGCGGAGCCCGGTGCCTCCCATTCTGCACCTGACTGCTCAGCTATTTACAGCACTTTGTAAGAAGTCTTAGCGCTGCCACTTGGTGAATGGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTGTTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTTAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     4     4     6     7     7     9     8    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    11    11    11    11    11    11    11    11    11    10    10    11    11    11    11    10    10     9     9     9     9     9    10     9    10     8     9     8     9     8     9     8     9     8     9     6     8     7     9     6     9     6     9     6     9     7     9     7     8     7     8     7     8     6     8     8     9     8     9     8     9     7     9     7     9     7     9     7     9     8    10     9    11     9    10     9    10     9    10     8     9     7     9     9    11    10    12    10    11    10    11    11    13    11    13    12    13    12    13    13    14    13    14    13    14    12    13    13    14    13    14    12    14    13    14    13    14    13    14    13    14    13    14    12    14    14    15    14    15    14    15    14    15    13    15    14    15    13    14    12    13    11    13    12    13    12    13    12    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11     9    10     9    10     8    10     4     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ------T-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --A---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---A--------
                                               BLH ATG     232    1005                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     232     144                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     232     817                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     232      43                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                       ...PROTEIN --- Sc ---- 4e-022     NP_012479.1 Zinc-regulated DNA binding protein involved in zinc ion homeostasis; Zap1p[Saccharomyces cerevisiae] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED - Ce ---- 6e-047     NP_499902.2 predicted CDS, snail (4B64) [Caenorhabditis elegans] ------================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ci ---- 2e-052     AAB61226.1 snail homolog [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 4e-065     NP_476600.1 CG3758-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Sp ---- 5e-072     NP_999825.1 zinc-finger transcription factor Snail [Strongylocentrotus purpuratus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Bf ==== 8e-080     AAC35351.1 snail [Branchiostoma floridae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 7e-124     NP_001008581.1 zgc:92564 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 2e-142     NP_003059.1 snail 2; neural crest transcription factor SLUG; slug (chicken homolog), zincfinger protein [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 5e-144     NP_035545.1 snail homolog 2 (Drosophila); slug, chicken homolog [Mus musculus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED = Gg ==== 7e-148     XP_419196.1 PREDICTED: similar to slug protein [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 3e-159     AAK54138.1 zinc finger transcription factor slug alpha [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 3e-159     NP_001079751.1 snail homolog 2 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 5e-161     CAJ82453.1 snail homolog 2 (Drosophila) [Xenopus tropicalis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu122i19.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAA------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAG------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TGA---------TAG---------------------------------ATG---ATGTAG------TAG---------------------------------------------------------------TGA------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------TGAATG---------------TGA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------TAA---TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ]
  0   1   1           Neu  FL                     TNeu122h01.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATA
  5   1   1           AbdN FL                     IMAGE:7006382.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACAGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTTTAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu0 5g3  in                     NISC_ng07h04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GAAACTGCTTGGAAGGATTTAAGAAGTTATTGGGGGGGCGGAGCCCGGTGCCTCCCATTCTGCACCTGACTGCTCAGCTATTTACAGCACTTTGTAAGAAGTCTTAGCGCTGCCACTTGGTGAATGGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACAGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCAC
  5   1   2       bld Neu  5g                        TNeu006i21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTAAGAAGTTATTGGGGGGGCGGAGCCCGGTGCCTCCCATTCTGCACCTGACTGCTCAGCTATTTACAGCACTTTGTAAGAAGTCTTAGCGCTGCCACTTGGTGAATGGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTC
  5   1   2       bld Neu0 5g                          NISC_ng23b04.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GATCTGACTGCTCAGCTATTTACAGCACTTTGTAAGAAGTCTTAGCGCTGCCACTTGGTGAATGGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACAGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCA
  5   1   2       bld HeRe 5g                          EC2CAA44CH12.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGCTGCCACTTGGTGAATGGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACCAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTATAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCAAAAAAA
  5   1   2       bld Egg  5g3  in                   TEgg024n08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGAATGGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAG
  5   1   2       bld Tbd0 5g                            IMAGE:6978214                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCANGACACACACTTTACCCTGCGTCTGTAAATCTGCGGCAAGCTTTTCTAGGCCATGGCTACTACAGGGCACATCCGCACTCACACTGGAGAAAGCCCTCTCATGTCACN
  5   1   2       bld In62 5g                         IMAGE:8952412.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAATCGTTAATATTTAGAAGGATTTCAAACGTATTCAAATTCGTCCCGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCATGCAGACTGTCAAACTTCTCTAGAATGTCGCTCCTCAAAAGCATGGAGAATTCTTGGGTTGTTGTGTGTGTAG
  5   1   2       bld Neu  FL   in                   TNeu122h01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACTCGGTGCGCACACGATGCGACAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCC
  5   1   2       bld Neu  5g                        TNeu008a21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCGGTGCGCACACGATGCGACAGGNATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGNCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCANGACACACACTNTACCCTGCGTCTGTAAAATCTGCGGC
  5   1   2       bld AbdN FL                            IMAGE:7006382                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGGATCAGCTTGAGGCCGGGGAGGAAACTAAAGTCGCTCCTTGTGGGACAGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAAGCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGAATCAACTTGCGAGCCCAACTGCAGAACCATTCTGATGTGAAAGAATTATCATGGCAAGAACTGTTCCAAAAACTTTCTCTAGAATGTCGCTCCTTCACAAGCATGGAGGAATCCTGGTTTGTTGTGGTAGCACAATTTAGACCCTTCCTATGGTTTTACCCAGGACTTTACCCCATCCCTTCCAGGGGTTTCCTTGGGGGTAAAAAGA
  5   1   2       bld TpA                            TTpA075d05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CCCGGGGAAACACTTCAACTCGGCCAAACAGTCCAATTACGGGGAGTTGGACAACCATACAGTGATCATCTCCCCATTCCTGTATGAGCGGTACCCTGTGTCTGTGCTACCCCAGCCTGAACTCTACAGCTCGGTGGCCTACAGCCCCATCACCGTGTGGACAGGACTGCTTCACCCACCACTGCCCAGCGATCTCTCCCCTCTCTCAGGATACCCTTCATCTTTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCNCAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATC
  5   1   2       bld In62                            IMAGE:8954246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATTAGGACGGGTCAGCCCCCCTCCGCAGTCGGACACGTCGTCTAAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCATTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATTTGGCAGGAAGGATCATGAATGGTCTTAGCGATGCCACATTTCCTTGACTGTATAATCGATGCTATTGTAGAAGCCTAGACATCAGCACATCAGCGACTTCAGCTCGTCCATGGGCTTACTAGTAGCCTGAATCCTCTTCGATCGAATGATCTAACTGGCATAGGATGCATTGTTTACTAGTCACGGGCTGGCACATGCCTCCACTCTGTTATGACTTAATTCCAGGGATTTAAATCACTGTCCTGAAGCCAGAGTATGTGCGCAAGA
  5   1   2       bld Spl1      in                         CABK2323.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAGACCACAGTGGCTCGGAGAGCCCCATCAGCGATGAGGAGGAAAGACTCCAGACCAAACTTTGCGACTCACATGCAATAGAGGCTGAGAAGTTCCAGTGCAGCTTATGCAGCAAGACCTACTCTACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAATTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTTCTCCTGAATCGATATGACTCTTAAACT
  5   1   2       bld Neu       in                   TNeu122i19.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACTTTCTCTGGGTTGGCTAAGCACAAGCAGCTGCATTGCGACGCCCAGTCTAGAAAATCGTTTAGCTGCAAGTACTGTGAAAAGGAGTATGTGAGCCTGGGCGCGCTGAAGATGCACATCAGGACACACACTTTACCCTGCGTCTGTAAAATCTGCGGCAAAGCTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATGATAGAAACAC
  5   1   2       chi TbA       in                   TTbA002p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTAAGTCGCTCCTTGTGGGACCGTTACTTTGCCAGGCTTGGGCACCGGCACTCCTCTCTCCCGCACTGAAAATGCCACGATCTTTTCTGGTCAAGAAACACTTCAACTCGGCCAAAAAGCCCAATTACGGGGAGTTGGACAACCATACAGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTGTTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGG
  5   1   2       bld Gas                            TGas110n02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTTTTTCTAGGCCATGGCTACTACAAGGGCACATCCGCACTCACACTGGAGAGAAGCCCTTCTCATGTCCACACTGCAACAGAGCATTTGCAGACAGATCCAACTTGCGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATGATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAATCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAATGTA
  5   1   2       bld Ski1      in                          CABJ940.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGAGCCCACCTGCAGACCCATTCTGATGTGAAGAAATATCAATGCAAGAACTGTTCCAAAACCTTCTCTAGAATGTCGCTCCTTCACAAGCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATGATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAATCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAATGTATTGCCATTGTTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAA
  3   1   2      seed Ski1      in                          CABJ940.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCACAGCNATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATGATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAATCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAATGTATTGCCATTGTTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATT
  3   1   2       bld Neu       in                    TNeu122i19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCATGAGGAATCTGGTTGTTGTGTAGCACATTAGACCGTCATATGTTTACCAGGACTTAACACATCCTTCAGGGTTTCTGGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATGATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAATCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAATGTATTGCCATTGTTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl1      in                         CABK2323.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGTGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAAAAAAA
  3   1   2       bld Neu       ?                     TNeu085g11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TGTAAAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGAGGCATTTTTTAATAAACCCTTTCGATAAATTTTAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  FL   in                    TNeu122h01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAAGAAATTCCAAACATTTTTTTCTTACCTCTTTTTGTTCCTGTTAAAGGAAAGCCTATGCAAGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCGGGAAGGATCAATGAAATGGTTTTTAGGGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGGGACTTTCAGCTTGGTTTTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTTTTCCTGAATGGATATGATTTTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGTTAGGCTCCATTTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACCCAGTGGGATTTTTTTTAAATAAAATTTACAATTTTGTTTTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGGGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTTTCCCCCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGGGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGGGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGTTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
  3   1   2       bld HeRe                             EC2CAA18BG01.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GTTAAAGGAAAGCCTATGCAGGATTCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAATCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTGTTTTTAGCTAGGCTCCATTTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGGCCCAATTTGTTT
  3   1   2       bld Neu       ?                     TNeu134i21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGTAAAGGAAAGCCTATGCAAGATCACCAAAAACACCAGAATTTCAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu       ?                     TNeu105d01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGGTTCGATTTGCAGTATGGATTACAAATAATAGAAACACATTTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGCGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTTAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg  5g3  in                    TEgg024n08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TTCCATATGGCAGGAAGGATCAATGAAATGGTCTTTAGTGATGCCACATTTCCTTGACATGTATAAATCAGATGCATATGTAGAGAGCCTAGACAATCCAGCAACAATCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTGTTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTGTGTTTTTCGAGATGCATTTTTTAATAAACCCTTTCGATAAATTT
  3   1   2       bld Neu0 5g3  in                     NISC_ng07h04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCCAAGCGACTTTCAGCTTCGTTCTCATGTGCTTTACTAAGTAGCCCATGAGATCCCTTCTTCCTGAATCGATATGACTCTTAAACTGTGCCATTCAGTGTATTGCCATTATTTTTAGCTAGGCTCCATCTGTGCCTTTGCCAGCCATTGCCTTCAGACATTCCTTGGTTTTATTTAAGACTTTTACAAATTTCACACAGTAGGATTTTTTTTAAATAAAATTTACAATTTTGTTCTCATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTTAAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld TbA       in                    TTbA002p01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGGGAATAAGTGCAACCGAGAGGGGTTTAAGTGAATGCGAAAATGTAGATCCTGAACTTTTCCTATGCACAAAAAAAAATGCAACTCATTTTCAGGATTCTCCACCCTTCATGTGCCTTTTTTATAATAATTTGTAAAATATGTGAATATATTTTGAAATGTTTATATTTTTATATATGTGTGTGTGTGAATGTGGCGTGTGAAAGAGAGAAGCAGCAAGTTGCCAATTCAGGGATAACTTGAAATGATGTGCCAATTTGTTTTTCAGATGCATTTTTTAATAAACCCTTTCGATAAATTTTATTTTTCTATGTTTCTTCATATCTGGTAAATGAGTTTATATTGATGTTTATGTTAATAAAGATAGTATATGGCTAGATATACAATATATAAATATATATAATGCACCTGTGCTGCAAATAAGATAAGGTTTATTTCATGCCTTAAGAATAGAACTAAGCATTTCCCATAGCTTGCTTTTTATAATCTCAGCCAATAAAAGGTATCACTTCTCTATATTTTCATGTGCCACTACTTTAAGAGAGATCGCCGGGATATAAAATGGTAATGTTACATAGTTAAAATAGTCAATAGATGTAAAAATGTAGTATTATATTTAATTGATGCACTTGGGTTCACCAACCTATGGTTTTCAGCTGCTGCCCTACAACAAATGCCGACATAAAGCAAGAGAATTCTGGGAAATGAAGGGCAATAGCTTGAAAGCAATATGTCTTATAATAAAGTTATGCAACTTTGTACCAACCCTAGATAATAAAAAAAAAAAAAAAAAAGCG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)