Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   1.0    0Xt7.1-TTpA012g23.5                         11 END     2           7       20                T-box 3 [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012079523 Xt7.1-CABD10585.3 - 28 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD10585.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCCTTTCCTTAACGCCGTGCGGCCCAGGCTCAGGTACAGCCCCTACTCGTTCCCTATGCCCTTTGCAGAAGGCAGCAGCCTGCTCACCACCGCCCTGCACTCACTGGATGGCAAAGCGAGTCTACTCTCCAGTCCGGCTGCCACTGCTCTGGACACTGAACTGAGCAGCAGAACCCCCACACTCTCCTCTGGTTCAGTCTCTTTATCCCCAAAGCTGTGCCCAGAGAAGGAAGCGAGCAGTGAGCTCCAAAACATTCAGCGGCTGGTTAGTGGGCTGGATTCCAAGCAGGAGCGGTCAAGGAGCGGTTCCCCTGATTGAGCCCAAGAAGCACTAAGCCCAGTTCTGAAGGTCTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATCTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTCTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATCTATCTTATCAGTGCCACGCCACACTCTGCCCCCCCCCCCCTACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGCAAAAAAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAATAAATTTTTTTTTTGGAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228522                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTCCTTAACGCCGTGCGGCCCAGGCTCAGGTACAGCCCCTACTCGTTCCCTATGCCCTTTGCAGAAGGCAGCAGCCTGCTCACCACCGCCCTGCACTCACTGGATGGCAAAGCGAGTCTACTCTCCAGTCCGGCTGCCACTGCTCTGGACACTGAACTGAGCAGCAGAACCCCCACACTCTCCTCTGGTTCAGTCTCTTTATCCCCAAAGCTGTGCCCAGAGAAGGAAGCGAGCAGTGAGCTCCAAAACATTCAGCGGCTGGTTAGTGGGCTGGATTCCAAGCAGGAGCGGTCAAGGAGCGGTTCCCCTGATTGAGCCCAAGAAGCACTAAGCCCAGTTCTGAAGGTCTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATCTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTCTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATCTATCTTATCAGTGCCACxCxxxxCxCxxCCCCCCCCCCCCTACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGCAAAAAAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAATAAATTTTTTTATTGGAATAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     4     3     4     4     7     4     8     4     8     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     4     9     2     9     9     9     7     8     7     8     7     8     7     7     7     7     7     7     7     7     7     7     7     7     7     9     7     9     9     9    10    10     9    10     9    10    10    10    10    10    10    10    10    10     9     9     8     8     8     8     8     8     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10     9     9     8     8     8     8     8     9     5     6     6     6     7     8     7     8    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    13    14    13    14    13    14    13    14    12    14    13    14    14    14    14    14    14    14    14    15    15    15    15    15    14    15    15    15    14    15    14    15    13    15    15    15    13    15    14    15    15    15    15    15    14    15    13    14    13    14    13    14    13    14    13    14    11    13    12    13    11    13    10    12    12    12    11    11     9    11    10    10     9    10    10    10     9    10    10    10     9    10    10    10     9     9     9     9     9     9     8     9     9     9     7     8     6     7     2     4     3     4     2     2
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCCTTGACTTTTTGCAAGCAGGGATTTACAAAGGT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCAAACTTGGGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCTGGCAAGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             --------G---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------T-
                                                                       ...PROTEIN --- Dr ---- 1e-012     NP_999906.1 T-box 2b like [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 2e-029     NP_932169.1 T-box 3 protein isoform 2 [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 8e-030     NP_005987.3 T-box 3 protein isoform 1; bladder cancer related protein XHL; T-boxtranscription factor TBX3; T-box 3 protein [Homo sapiens] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 9e-031     XP_001234535.1 PREDICTED: similar to T-box 3 protein [Gallus gallus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 1e-047     AAD51956.1 transcription repression factor ET [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- ?? ---- 1e-047     NP_001079080.1 transcription repression factor Tbx3 [Xenopus laevis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Xt ---- 2e-053     NP_001027524.1 hypothetical protein LOC613116 [Xenopus tropicalis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD10585.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAA------------------------------------------------------------------------------------------TGA---------------------------TAA------------------------------------------TAG------------------------------------------------TAG------------------------------------------------------------TAA---------TGA------------------------------------------------------------------------------------------------------TGA------ATGTAA---------------TGA------------------------ATG---------ATGTAA---------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------ATG------------TAA---------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------TAA---TAG---------------------------TAG---------TAATAA---ATG------TGA------------------ATGATGTAATGAATG---------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                              ]
  5   1   1         - Ski1      in                        CABJ10776.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATCGAGGAGCTAAAAAGCCCCGCTAGAGATTCCCATAAAGCAGAGGAGTCGCAGCGATCCAAGGAAGCATTCCCCCCTCTCACTGTGCAAACAGACAGTAGCGCCCACCTTCTCAGCCAGGGGCATCTGCAGAACCTCGGCTTCCCCCCAGGACTCACTGGGCAGCAGTTCTTTAACCCGCTGGGCGCTTCGCATCCTCTGCTCTTTCACCCAAGTCACTTTGCAATGGGAGGGGCTTTTTCCAGTATGGCTGCTGGCATGAACCCACTTCTGGCTTCAGTTTCAGGAGCATCATCTGGGGTGAACAGCATAGACTCTACCGTCATGGCATCTTCCTCTCAAGGGCTGGCAGGCTCTTCTGCACTGCCCTTCCATTTGCAGCAGCAAGTCCTGGCCTCCCAGGGCCTGGCGATGTCTCCGTTCGGAGGGCTTTTCTCCTACCCCTACACCTACATGGCCGCGGCAGCCGCAGCCTCCTCTGCTGTACACAGACACCCTTTCCTTAACGCCGTGCGGCCCAGGCTCAGGTACAGCCCCTACTCGTTCCCTATGCCCTTTGCAGAAGGCAGCAGCCTGCTCACCACCGCCCTGCACTCACTGGATGGCAAAGCGAGTCTACTCTCCAGTCCGGCTGCCACTGCTCTGGACACTGAACTGAGCAGCAGAACCCCCACACTCTCCTCTGGTTCAGTCTCTTTATCCCCAAAGCTGTGCCCAGAGAAGGAAGCGAGCAGTGAGCTCCAAAACATTCAGCGGCTGGTTAGTGGGCTGGATTCCAAGCAGGAGCGGTCAAGGAGCGG
  5   1   1         - Lun1      in                        CABD10585.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CACCCTTTCCTTAACGCCGTGCGGCCCAGGCTCAGGTACAGCCCCTACTCGTTCCCTATGCCCTTTGCAGAAGGCAGCAGCCTGCTCACCACCGCCCTGCACTCACTGGATGGCAAAGCGAGTCTACTCTCCAGTCCGGCTGCCACTGCTCTGGACACTGAACTGAGCAGCAGAACCCCCACACTCTCCTCTGGTTCAGTCTCTTTATCCCCAAAGCTGTGCCCAGAGAAGGAAGCGAGCAGTGAGCTCCAAAACATTCAGCGGCTGGTTAGTGGGCTGGATTCCAAGCAGGAGCGGTCAAGGAGCGGTTCCCCTGATTGAGCCCAAGAAGCACTAAGCCCAGTTCTGAAGGTCTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATCTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTCTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATCTATCTTATCAGTGCCACACTCTGGCCGCCCCCCCCCCCCCC
  3  -1   1         - Ovi1      in                         CABI7266.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCTTAACGCCGTGCGGCCCAGGCTCAGGTACAGCCCCTACTCGTTCCCTATGCCCTTTGCAGAAGGCAGCAGCCTGCTCACCACCGCCCTGCACTCACTGGATGGCAAAGCGAGTCTACTCTCCAGTCCGGCTGCCACTGCTCTGGACACTGAACTGAGCAGCAGAACCCCCACACTCTCCTCTGGTTCAGTCTCTTTATCCCCAAAGCTGTGCCCAGAGAAGGAAGCGAGCAGTGAGCTCCAAAACATTCAGCGGCTGGTTAGTGGGCTGGATTCCAAGCAGGAGCGGTCAAGGAGCGGTTCCCCTGATTGAGCCCAAGAAGCACTAAGCCCAGTTCTGAAGGTCTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATCTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTCTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATCTATCTTATCAGTGCCACACTNCTGCCGCCCCCCCCCCCCCCCCCTACTGCTGCTGAACTAAACTCCATCCCCTCCCCCAC
  5   1   1         - Tad5                                 XZT60016.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAGAAGGCAGCAGCCTGCTCACCACCGCCCTGCACTCACTGGATGGCAAAGCGAGTCTACTCTCCAGTCCGGCTGCCACTGCTCTGGACACTGAACTGAGCAGCAGAACCCCCACACTCTCCTCTGGTTCAGTCTCTTTATCCCCAAAGCTGTGCCCAGAGAAGGAAGCGAGCAGTGAGCTCCAAAACATTCAGCGGCTGGTTAGTGGGCTGGATTCCAAGCAGGAGCGGTCAAGGAGCGGTTCCCCTGATTGAGCCCAAGAAGCACTAAGCCCAGTTCTGAAGGTCTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATCTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTCTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATCTATCTTATCAGTGCCACACTCTGCCGCCCCCCCCCCCCCCTACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTT
  5  -1   1         - Ovi1      in                         CABI7266.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCCCAGTTTTGAAGGTTTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTTTGCAAGCAGGGATTTACAAAGGTTTTTCATTTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTTTAGGATCATGTATTCCCCTAGCCTTTTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATTTTTTTTTTTAGTGCCACATTTTGGGGCCCCCCCCCCCCCCCCCTACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGG
  3   1   1         - Tad5      out                        XZT68235.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATTTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTTTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATTTATTTTATCAGTGCCACATTTTGCCGCCCCCCCCCCCCCCTACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGC
  5   1   1         - Neu                            TNeu009k01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TCTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATCTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTCTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACCAGCCCATCTATCTTATCAGTGCCACACTCTGCCCCCCCCCCCCCACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTNCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATGATTGGCTTGCATAAGGAATAAAACTTGAGGGTCTGGGAAAAATAAAACATTGGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATG
  5   1   1         - Neu                            TNeu015d15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TCTCATTCCAGTTCCAGACTGGCAGTGCACTTTGTGTTGGGTACAGGAAAGCCCCTCCTATCCTTGACTTTCTGCAAGCAGGGATCTACAAAGGTTTTTCATCTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCACTAGCACTCTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATCTATCTTATCAGTGCCACACTCTGCCCCCCCCCCCCCACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAAAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACT
  3   1   1         - Ski1      in                        CABJ10776.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGTGCACTTTGTGTTGGGTACAGGAAAACCCCTCCTATCCTTGACTTTTTGCAAGCAGGGATTTACAAAGGTTTTTTATTTTCTGCAAACTTGGGGGAGAAATTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCCCTAGCCCTTTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAATGTACAGCCCATTTTTTTTTTTAGTGCCACATTTTGGCGCCCCCCCCCCCCCCCCCTANTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGG
  3   1   1         - Fat1 5g3  out                         CABC447.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GGTACAGGAAAGCCCCTCCTATCCTTGACTTTTTGCAAGCAGGGATTTACAAAGGTTTTTCATTTACTGCAAACTTGGGGGAGAAGTTTGGACCCTGGCAAGCTGCTATAGGATCATGTATACCCCTAGCCCTTTACAGCCTCCTAACGGGCACTGGGAACAGGTCAGGGGCCTGCAAGTGTACAGCCCATTTATTTTATCAGTGCCACATTTTGCCGCCCCCCCCCCCCCCCCCTACTGCTGCTGAACTAAACTCCATCCCCTCCCCCACACACGCAAAAACCCTCCCGGGAATTCTGGGAGTTGTAGTTAAGCAACAGCTGGATATGGAAAGGCTGAGGATCTCTGGTGATATAAACCATCATTTCCTTGCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGCAAAA
  3   1   1         - Gas8      in                          st88g20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GAAATGATGGTTTATATCACCAGAGATCCTCAGCCTTTCCATAAGGAATAAAACCTGAGGGTCTGTTAGAAATAAAACATTTGANTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTNCTGGNTTGTGCATGCAAACTAATCCTTCCCTGTTAGCTNTGCAATGCCTGGGAAANATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTNATACCAATCACATACAAACACGAGAACACATNTAGTTCATGGGAAATCTAAACTCATA
  5   1   1         - Gas8      in                          st88g20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AATGATGGTTTATATCACCAGAGATCCTCAGCCTTTCCATAAGGAATAAAACTTGAGGGTCTGTTAGAAATAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTAATCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGCAAAAAAAAAA
  5  -1   1         - Neu                            TNeu013o10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGAATAAAACTTGAGGGTCTGTTAAAAGTAAAACATTTGATTAAGGGCAAGAAAAGGGACAATAATGCCTTGCTTGTGTACATTAGGGGATGATATGTCTTTTTCACAGGCCTGTGTTTTTAAAGCAATGTACTGGCTTCTGCATGCAAACTCCTCCTTCCCTGTTAGCTCTGCAATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGCAA
  5   1   1         - Tad0                               IMAGE:6982346                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTGGCTTCTGCAGCAAACTAATCCTTCCCTGTTAGCTCTTTATGCCTGGGAAATATCATGGCACCGACATGGGGCTCCCCTCTAGCAAAGCGGCTTTATACCAATCACATACAAACACGAGAACACATTTAGTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGCAAAAAAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCGTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGGACAATAAAATAAACATACAAACTCACAGTCTTGGCAAGTTGAACGGGGAGAGACACTTTTCCCATCCATTGCCTGAAGCAAAATTGCCCCAGAAACTACAGTCCGTTACTCCACAATACCTGCTGTTTGATCCAAAGATTCATAAAAATACCCGTTCGCATGGGGGTTCACAAGAAN
  3   1   1         - Lun1      in                        CABD10585.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATTAGTTTCATGGGAAATCTAAACTCATTATTGACTAAACAGTCCTCATGCAATAACAAGTTTAGAGAATAGGGCAAAAAAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAATAAATTTTTTTATTGAAATACAACCTCTCGCCCTATAG
  3   1   1         - Neu       in                    TNeu063h04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAGTTTAGAGAATAGGGCAAAAAAAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAAAGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCCCGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCCTGAGACAAATAAAATAAACATACAAACTCCCAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATTTCAGTTTTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTTTTGGTTAAATCTAGTTGTTGTTATTTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAATTTCAATAAATTTTTTTATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1         - Neu       in                   TNeu063h04.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAGTTTAGAGAATAGGGCAAAAAAAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTATAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTG
  5   1   1         - Liv1      in                        CAAR12127.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCAAAAAAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAATAAATTTTTTTA
  5   1   1         - Neu                            TNeu116h02.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAAAAAAAAGCGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCGTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCC
  5   1   1         - Neu       in                   TNeu106j21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCGTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAA
  3   1   1         - Neu       in                    TNeu106j21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CGAAAAGGGAGGATATTATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCGTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAAGTCTCCNAAGTTTCAATAAATTTTTTTATGAAAAAAAAAAAAAAAAAAA
  5   1   1         - Neu                            TNeu061c05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGCTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATG
  5   1   1         - Neu                            TNeu123f05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTATTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTGTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCT
  5   1   1         - Tad5      in                         XZT47079.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATTAAAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCGTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAATAAATTTTTTTATT
  5   1   1         - Neu                            TNeu030e23.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          NAAAAAAATATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCGTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTACATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGACTTGGTTAAATCTA
  5   1   1         - TbA                            TTbA079h04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AAAAAAAGTATTTATGTAATTATTTGATATCTTATGTAAATAAAACAAAAATACTGAATATTAAAATTTAATTTATTTATAATGTATATATTCATGTAAATAAGGCTCTTATTTTTAGTGTGTGTTAAACCGATTTGGTGCCAAAGGGGACGGCAGTGTATTAGTAGTAAACCAGGAGGCACGCAATGGGTTAAGCTGTTTCCTTTACCATTAGTGTTATTTTCATTGAACTATTAAAAAAACAAACAAAATTTATATATATATATATTTTTTTTTTGTTTGTTTTTTTTTTGTATTTATAAAACCATGAGACAAATAAAATAAACATACAAACTCACAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGAGTCTCCATACAAATATCTCAGTTCTGCACTGCGGGTTTCACAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATCTGCACAGTTTGACTCCTAGCTGTGTCAGTAATAATATATGAAGGTCTGAATATCTATCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCTCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAAT
  3   1   1         - Tad5      in                         XZT47079.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTTATTTTTAGTGGGGGTTAAACCGATTTGGGGCCAAAGGGGGCGGCCGTGTTTTTGTTGTAAACCCGGGGGCCCGCAATGGGTTAAGCTGTTTCCGTTACCCTTAGGGTTTTTTTCCTTGGACTTTTAAAAAAACAAACCAAATTTATATAAAAAAATATTTTTTTTTGGTTGGGTTTTTTTTGGGATTTATAAAACCCTGGGGCAAATAAAATAAACATTCAAACTCCCCGTTTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCCTCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCCCAAAAACCTGCTTGTTTGATCCCAGGGTCTCCATACAAATATTTCAGTTTTGCCCTGCGGGTTTCCCAATGAAAACCTACTCTGTTTATAAAAACCTCTGTCTTGGTTAAATCTAGTTGTTGTTATTTGCCCAGTTTGACTCCCAGCTGGGTCAGTAATAATATATGAAGGTTGGAATATCTATCTCTCTATATATGATGTAAAGAATGTTCGATAGAACGTTTCCCCCTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAATAAATTTTTTTTTTGG
  3   1   1         - Liv1      in                        CAAR12127.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAGGGTTATTTTCCTTGAACTTTTAAAAAAACAAACAAAATTTATATATAAAAATATTTTTTTTTGGTTTGGTTTTTTTTGGGATTTAAAAAACCCTGGGGCAAATAAAATAAACATCCAAACTCCCAGTCTTGGCAGGTTGAACGGGGAGAGACACTTTTCCCATCCAATGCCTTGAAGCAGAATTTGCCCAAGAACTAACAGTCCGTTTACTCACAAATACCTGCTTGTTTGATCCCAGGGTCTCCATACAAATATTTCAGTTTTGCCCTGGGGGTTTCCCAATGAAAACCTACTCTGTTTATAAATACCTCTGTCTTGGTTAAATCTAGTTGTTGTTTTCTGCCCAGTTTGACTCCTAGCGGGGTCAGTAATAATATATGAAGGTCGGAATATCTTTCTCTCTATATATGATGTAATGAATGTTCGATAGAACGTTTCCCCTTGTATTTTTGTTTGTTTCAAAAGTCTCCAAGTTTCAATAAATTTTTTTTTTGGAATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)