Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TEgg045g12.3                         14 END     1           4        7                nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor);Glucocorticoid receptor, lymphocyte; glucocorticoid receptor; nuclear receptorsubfamily 3, group C, member 1 [Homo sapiens]

 This cluster: approximate FL confidence score = 88%

 1012079548 Xt7.1-TGas091h17.3 - 24 ESTs
                                                                       .-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas091h17.3                                                                                                                                                                                                                                                                                                                                  CAGGCAGATCCCAACTTTGGCAGAATTACAGCAGGATCCGAGTGTGGGAGAGAGAGAATAGCCATGCAGTACCAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGAGTACACCCATGCCCTCATCCGGCACGACTCCCTGGGCAAACCCTTGCTATGGAGCCCCTTCATCCAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCTTCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAATGGAGGCGTCTCAAGCAGGAAAACCCACAGGGAAATAAGAAAGACGAAACTGAAAGTCTAGAGAATATCTGCGAAGAGAGTCAGGAGAGGTGTTTGAGTGCTGAGCAGAAGAGCAGAGAGTCCTCCTTGGATGAACCCACCTCATCGCCCACCTCCCAAGAGACTCTGGATTCAGAGGTGTCCGATGATTCCGACCAGGAGGTGGACATTGAAGGAGACAAAGGATTTTACAACTGTGCACATTAACTGCTGCTCAGTAAGAATGGACCTCTCTTCAGCTTGCACTTTAACAGAAGCTGGACCTAGCTCCCTGGTAGCCTGACTTGGGTTAAGCCAGTGGCTGTCGGACTTTCTCAGTTCAAGCCCCCACTGGAGTTCCAACCTTTGTTCAGGGCCCCCTCAGCTCATAACAAGGAAAGCAGCGGTGTACCAGTCAGAGCAGAAAATACATTTTTATCCCAAATCTTATCCTAATTAACCTTCAAGTTGGAGGTATCTAGGAGAGCAAGTAGGCATTCTCCTCAAATTTCATTCTTTATTGACCTTTCAGGTGTATTTAGGAGAGCAAATAGGCATCCTCTCTAATTCTCACCCTAACTGGCAAGCTTCTATCCCACAGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGGATNACAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008229396                                                                                                                                                                                                                                                                                                                                        AxxCxCAACTTTGGCAGAxxTxxxGCAGGATCCGAGTGTGGGAGAGAGAGAATAGCCATGCAGTACCAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGAGTACACCCATGCCCTCATCCGGCACGACTCCCTGGGCAAACCCTTGCTATGGAGCCCCTTCATCCAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCTTCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAATGGAGGCGTCTCAAGCAGGAAAACCCACAGGGAAATAAGAAAGACGAAACTGAAAGTCTAGAGAATATCTGCGAAGAGAGTCAGGAGAGGTGTTTGAGTGCTGAGCAGAAGAGCAGAGAGTCCTCCTTGGATGAACCCACCTCATCGCCCACCTCCCAAGAGACTCTGGATTCAGAGGTGTCCGATGATTCCGACCAGGAGGTGGACATTGAAGGAGACAAAGGATTTTACAACTGTGCACATTAACTGCTGCTCAGTAAGAATGGACCTCTCTTCAGCTTGCACTTTAACAGAAGCTGGACCTAGCTCCCTGGTAGCCTGACTTGGGTTAAGCCAGTGGCTGTCGGACTTTCTCAGTTCAAGCCCCCACTGGAGTTCCAACCTTTGTTCAGGGCCCCCTCAGCTCATAACAAGGAAAGCAGCGGTGTACCAGTCAGAGCAGAAAATACATTTTTATCCCAAATCTTATCCTAATTAACCTTCAAGTTGGAGGTATCTAGGAGAGCAAGTAGGCATTCTCCTCAAATTTCATTCTTTATTGACCTTTCAGGTGTATTTAGGAGAGCAAATAGGCATCCTCTCTAATTCTCACCCTAACTGGCAAGCTTCTATCCCACAGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGGATAxxAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                       2     3     2     4     5     7     5     7     5     7     5     7     6     8     6     8     6     8     6     8     6     8     6     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     6     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     7     9     7    10     7    10     7    10     7    10     7    10     6     9     6     9     6     9     6     9     6     8     5     8     5     8     5     7     4     7     4     7     5     6     5     6     5     7     6     6     6     6     5     6     5     6     5     6     6     7     7     8     7     7     7     7     6     7     7     7     6     6     5     6     5     6     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     6     6     7     7     7     7     7     8     7     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     9     9     9     9     9     9    10    10    10    10     8     8     8     8     9     9     9     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    11     8    11     9    11     3     4     3     3
                                               BLH ATG      63     424                                                                                                                                                                                                                                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bb ---- 2e-013     BAA83377.1 BbTTF-1 [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Bf ==== 2e-017     AAM90855.1 Amphink2-tin [Branchiostoma floridae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Dm ---- 7e-019     NP_650938.1 CG7056-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Ce ---- 2e-023     NP_508131.3 defective PHArynx development family member (pha-2) [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Cs ---- 1e-037     BAC81669.1 homeodomain protein Hex [Ciona savignyi] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                       PROTEIN --- Ci ---- 4e-039     BAE06482.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ==== 1e-049     XP_781292.2 PREDICTED: similar to Hex [Strongylocentrotus purpuratus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Dr ==== 2e-084     NP_571009.1 hematopoietically expressed homeobox [Danio rerio] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 5e-105     NP_990583.1 probox protein [Gallus gallus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Hs ==== 5e-111     NP_002720.1 hematopoietically expressed homeobox; proline-rich homeodomain-containingtranscription factor [Homo sapiens] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Mm ==== 6e-112     NP_032271.1 hematopoietically expressed homeobox [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 7e-154     AAB82335.1 homeodomain protein XHEX [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 7e-154     NP_001079059.1 hematopoietically expressed homeobox [Xenopus laevis] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Xt ==== 4e-160     AAN78202.1 homeodomain transcription factor [Silurana tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas091h17.3                                                                                                                                                                                                                                                                                                                                                                                                 ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------TAA---------TAA------------------------------------------TGA---------ATG------------------------------------------ATG---------------------------------TAA------------TAA---------TAA---------------------------------------------TAG------------------TAA------------------------------TGA---------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TAG---------------------------------ATG------TAA---------------TAA------------TAA---------------------------------------------------------------TAATGA---------------------------------ATG---------------------------ATGTAA------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                 ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ]
  3  -1   2       add Neu                             TNeu061g07.q1kT7                                                                                                                                                                                                                                                                                                            TTGTTCTTTTTGCAGAAGCTCAGAATAAACGCTCAACTTTGGCAGATCTGATACCATGTACCCCTACGATGTGCCCGATTACGCCCCACCTGATCAGTACCAGCACCCCAGCTCCTCAGCTCTGGGGCTCAGTGTCCCCCTGTTCGCTCCCACCCCTCTGCAGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAACAGCGCATCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCTCCCAACTCATCCTTCACCAGCCTGGTGGCTACTTACCGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCAGGGGCAGCCCTAGCAGCTTCCTATGGAGCCAGCACCTATGCCTCCCCTCTGTACCCCTTCTCCAGGCCAGTCAGCGACTACACCCACGCCCTCATCCGACACGACTCTCTGGGCAAACCCCTGCTCTGGAGCCCCTTCATCCAGAGGCCTCTGCACAAGCGGAAAGGAGGACAAGTGAGGTTTTCCAACGATCAAACCTATTGAGTTGGAGAAAAAATTCGAGACGCAAAAATATTTATCGCCCCCTGAGAGGAAGCGACTGGCTAAAATGCTGCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAAATGGAGGCGTCTCAAGCAGGAGAACCCACAGGGAAATAAGAAAGACGAAACCGAAAGTCTAGAAAATATCTG
  5   1   2       bld TpA  5g3  in                   TTpA052k10.p1kSP6                                                                                                                                                                                                                                                                                                                      TGGCCCCAGTGTCAGGCAGATCCCATATACTGGTGGATTACAGCAGGATCCGAGTGTGGGAGAGAGAGAATAGCCATGCAGTACCAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGAGTACACCCATGCCCTCATCCGGCACGACTCCCTGGGCAAACCCTTGCTATGGAGCCCCTTCATCCAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCTTCAGCTCAGCGAGAGACAGGTCANAACCTGGTTCCAGAACAGAAGAGCCAAATGGAGGCGTCTCAAGCAGGAAAACCCACAGGGAAATA
  5   1   2       bld Tad5                                 XZT11527.5p                                                                                                                                                                                                                                                                                                                                 TCAGGCAGATCCCATATACTGGTGGATTACAGCAGGATCCGAGTGTGGGAGAGAGAGAATAGCCATGCAGTACCAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGAGTACACCCATGCCCTCATCCGGCACGACTCCCTGGGCAAACCCTTGCTATGGAGCCCCTTCATCCAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCTTCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAATGGAGGCGTCTCAAGCAGGAAAACCCACAGGGAAATAAGAAAGACGAAACTGAAAGTCTAGAGAATATCTGCGAAGAGAGTCAGGAGAGGTGTTTGAGTGCTGAGCAGAAGAGCAGAGAGTCCTCCTTGGATGAACCCACCTCATCGCCCACCTCCCAAGAGACTCTGGATTCAGAGGTGTCCGATGATTC
  3  -1   2       add Neu                             TNeu072n01.q1kT7                                                                                                                                                                                                                                                                                                                                        ACGCTCAACTTTGGCAGATCTGATACCATGTACCCCTACGATGTGCCCGATTACGCCCCACCTGATCAGTACCAGCACCCCAGCTCCTCAGCTCTGGGGCTCAGTGTCCCCCTGTTCGCTCCCACCCCTCTGCAGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAACAGCGCATCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCTCCCAACTCATCCTTCACCAGCCTGGTGGCTACTTACCGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCAGGGGCAGCCCTAGCAGCTTCCTATGGAGCCAGCACCTATGCCTCCCCTCTGTACCCCTTCTCCAGGCCAGTCAGCGACTACACCCACGCCCTCATCCGACACGACTCTCTGGGCAAACCCCTGCTCTGGAGCCCCTTCATCCAGAGGCCTCTGCACAAGCGGAAAGGAGGACAAGTGAGGTTTTCCAACGATCAAACCATTGAGTTGGAGAAAAAATTCGAGACGCAAAAATATTTATCGCCCCCTGAGAGGAAGCGACTGGCTAAAATGCTGCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAATGGAGGCGTCTCAAGCAGGAGAACCCACAGGGAAATAAGAAAGACGAAACCGAAAGTCTAGAAAATATCTGCGAAGAGAGTCAGGAGAGGTGTTTGAGCGCCGAGCAGAAGAGCAGAGAGTCCTCCCTGGATGATCCCACCTCGTCGCCCACCTCTCAAGGGAACCTGGATTCGGAGGTGTCTGACGATTCCGACCAGGAGGTGGACATTGAAGGCGACAAAGGATATTACAACTGTGCACATATCACTAGTGACTGACTAGGATCTGGTTACCACT
  5   1   2       bld Neu  5g3  in                   TNeu129d23.p1cSP6                                                                                                                                                                                                                                                                                                                                                       TGGATTACAGCAGGATCCGAGTGTGGGAGAGAGAGAATAGCCACGCAGTACCAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCGTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGAGTACACCCATGCCCTCATCCGGCACGACTCCCTGGGCAAACCCTTGCTATGGAGCCCCTTCATCCAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCT
  5   1   2       bld Gas  5g                        TGas023e18.p1kSP6                                                                                                                                                                                                                                                                                                                                                       TGGATTACAGCAGGATCCGAGTGTGGGAGAGAGAGAATAGCCATGCAGTACCAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGCTGTAACAACTAACTGCCAGTTGTATGGGAGAGACCCCTCTCTGTCAGTGGGTCCTGTTATTCTAACTATGCTGTAAGTGCAAATTATCAATGGTTTTAATGTTTTATTTTTTCGTTATAAATGTAATTGAAATGATCTGTCTGGTTGTTTATATGACTGCACCGCTGGCTTCTGACTCCTAAACAATGTAGCAGAAAACAGCTGATTAACAAACCTGNGGGGGAAACTCACTTCTGCTACATTGTGTCAATAGTCACATTCAGAGAACCTAAAATAGAGCCTAAAACGCCGATTTCAAATACGATTCCATTTATTAAGCGGTTTGATACTTAGAATGGCATTTCCTTTC
  5   1   2       bld Gas  5g3  in                   TGas091h17.p1kSP6                                                                                                                                                                                                                                                                                                                                                         GATTACAGCAGGATCCGAGTGTGGGAGAGAGAGAATAGCCATGCAGTACCAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGAGTACACCCATGCCCTCATCCGGCACGACACCCTGGGCAAACCCTTGCTATGGAGCCCCTTCATCCAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCTTCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAATG
  5   1   2       bld Lun1      in                        CABD12434.5p                                                                                                                                                                                                                                                                                                                                                                                                          CAGCACCCCAGCTCCTCAGCCCTGGGGCTCAGTGTCCCCCTGTACGCACCCACCCCTCTGCAGCCAGTGCACCCAACTCCCTTCTACATTGATGATATCCTGGGAAGGAGCAGCGCCTCTAATGGGACCCCAGCCTTACCCACCCCAACCCTGCCATCGCCCAACTCTTCCTTCACCAGCCTGGTGGCTACCTACAGGACTCCCATCTATGAGCCTACTCCCATTCACCCTGCCTTCACCCACCCCGGGGCAGCCCTGGCAGCTTCCTATGGAGCCAGCACCTATGCCAACCCTCTGTACCCCTTCTCCAGGCCGGTCAGCGAGTACACCCATGCCCTCATCCGGCACGACTCCCTGGGCAAACCCTTGCTATGGAGCCCCTTCATCCAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCTTCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAATGGAGGCGTCTCAAGCAGGAAAACCCACAGGGAAATAAGAAAGACGAAACTGAAAGTCTAGAGAATATCTGCGAAGAGAGTCAGGAGAGGTGTTTGAGTGCTGAGCAGAAGAGCAGAGAGTCCTCCTTGGATGAACCCACCTCATCGCCCACCTCCCAAGAGACTCTGGATTCAGAGGTGTCCGATGATTCCGACCAGGAGGTGGACATTGAAGGAGACAAAGGATTTTACAACTGTGCACATTAACTGCTGCTCAGTAAGAATGGACCTCTCTTCAGCTTGCACTTTAACAGAAGCTGGACCTAGCTCCCTG
  5   1   2       bld TpA       in                   TTpA001c21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGAGGCCTCTTCACAAGCGGAAAGGCGGCCAAGTGCGGTTTTCAAACGATCAGACCATCGAATTAGAGAAAAAGTTTGAGACACAAAAATATTTATCGCCCCCGGAAAGGAAACGCCTGGCTAAAATGCTTCAGCTCAGCGAGAGACAGGTCAAAACCTGGTTCCAGAACAGAAGAGCCAAATGGAGGCGTCTCAAGCAGGAAAACCCACAGGGAAATAAGAAAGACGAAACTGAAAGTCTAGAGAATATCTGCGAAGAGAGTCAGGAGAGGTGTTTGAGTGCTGAGCAGAAGAGCAGAGAGTCCTCCTTGGATGAACCCACCTCATCGCCCACCTCCCAAGAGACTCTGGATTCAGAGGTGTCCGATGATTCCGACCAGGAGGTGGACATTGAAGGAGACAAAGGATTTTACAACTGTGCACATTAACTGCTGCTCAGTAAGAATGGACCTCTCTTCAGCTTGCACTTTAACAGAAGCTGGACCTAGCTCCCTGGTAGCCTGACTTGGGTTAAGCCAGTGGCTGTCGGACTTTCTCAGTTCAAGCCCCCACTGGAGTTCCAACCTTTGTTCAGGGCCCCCTCAGCTCATAACAAGGAAAGCAGCGGTGTACCAGTCAGAGCAGAAAATACATTTTTATCCCAAATCTTATCCTAATTAACCTTCAAGTTGGAGGTATCTAGGAGAGCAAGTAGGCATTCTCCCTCAATTTCATTCTTTATTGACCTTTCAGGTGTATTTAGGAGAGCAAATAGGCATCCTCTCTAATTCTCACCCTAACTGGCAAGCT
  5  -1   2       add Egg0      out                        dad68h09.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTGAGTTGGAAATAAAATTGGAGGGTCTACGATGTTTTGGAGCACTTATAGGTAGGGTAGGTTAAAATGTGTAAGTAAGTGAAAGAACGGTGAAAAGTTGGTTCAGAACAAGAAAAGCCAAAAGGAGGGGTTTTAATGAGGAGGACCCACAGGGAAATAAGAAAGGTGAAACGTAAAGTTTAGAAAATATTTGGTAAGAGAGTCAGGAGAGGTGTTTGAGAGCCAAGCAGAAAAGCAGAGAGTCCTCCTTGGATGATTCCACCTGGTCGCCCACCTTTCAAGGGAACTTGGATTTGGAGGTGTCTGAGGATTCCGACCAGGAGGTGGACATTGAAGGCCACAAAGGATATTACAACTGTGCAC
  5   1   2       bld Spl2      in                        CBSS8175.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGAGAGGTGTTTGAGTGCTGAGCAGAAGAGCAGAGAGTCCTCCTTGGATGAACCCACCTCATCGCCCACCTCCCAAGAGACTCTGGATTCAGAGGTGTCCGATGATTCCGACCAGGAGGTGGACATTGAAGGAGACAAAGGATTTTACAACTGTGCACATTAACTGCTGCTCAGTAAGAATGGACCTCTCTTCAGCTTGCACTTTAACAGAAGCTGGACCTAGCTCCCTGGTAGCCTGACTTGGGTTAAGCCAGTGGCTGTCGGACTTTCTCAGTTCAAGCCCCCACTGGAGTTCCAACCTTTGTTCAGGGCCCCCTCAGCTCATAACAAGGAAAGCAGCGGTGTACCAGTCAGAGCAGAAAATACATTTTTATCCCAAATCTTATCCTAATTAACCTTCAAGTTGGAGGTATCTAGGAGAGCAAGTAGGCATTCTCCTCAAATTTCATTCTTTATTGACCTTTCAGGTGTATTTAGGAGAGCAAATAGGCATCCTCCCTAATTCTCACCCTAACTGGCAAGCTTCTATCCCACAGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAATGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAG
  5   1   2       bld Gas7      in                         XZG15076.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GAGACTCTGGATTCAGAGGTGTCCGATGATTCCGACCAGGAGGTGGACATTGAAGGAGACAAAGGATTTTACAACTGTGCACATTAACTGCTGCTCAGTAAGAATGGACCTCTCTTCAGCTTGCACTTTAACAGAAGCTGGACCTAGCTCCCTGGTAGCCTGACTTGGGTTAAGCCAGTGGCTGTCGGACTTTCTCAGTTCAAGCCCCCACTGGAGTTCCAACCTTTGTTCAGGGCCCCCTCAGCTCATAACAAGGAAAGCAGCGGTGTACCAGTCAGAGCAGAAAATACATTTTTATCCCAAATCTTATCCTAATTAACCTTCAAGTTGGAGGTATCTAGGAGAGCAAGTAGGCATTCTCCTCAAATTTCATTCTTTATTGACCTTTCAGGTGTATTTAGGAGAGCAAATAGGCATCCTCTCTAATTCTCACCCTAACTGGCAAGCTTCTATCCCACAGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCA
  5   1   2       bld Spl2      in                        CBSS9968.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCGCGTCCGCAGAGGTGTCCGATGATTCCGACCAGGAGGTGGACATTGAAGGAGACAAAGGATTTTACAACTGTGCACATTAACTGCTGCTCAGTAAGAATGGACCTCTCTTCAGCTTGCACTTTAACAGAAGCTGGACCTAGCTCCCTGGTAGCCTGACTTGGGTTAAGCCAGTGGCTGTCGGACTTTCTCAGTTCAAGCCCCCACTGGAGTTCCAACCTTTGTTCAGGGCCCCCTCAGCTCATAACAAGGAAAGCAGCGGTGTACCAGTCAGAGCAGAAAATACATTTTTATCCCAAATCTTATCCTAATTAACCTTCAAGTTGGAGGTATCTAGGAGAGCAAGTAGGCATTCTCCTCAAATTTCATTCTTTATTGACCTTTCAGGTGTATTTAGGAGAGCAAATAGGCATCCTCTCTAATTCTCACCCTAACTGGCAAGCTTCTATCCCACAGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCANGAATCTCATTGTGTAAGAAAGCTCAGAT
  3   1   2       bld Gas  5g3  in                    TGas091h17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAATGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGCGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCGTCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAGACCAGTGGAATAAAAGAAAAAAATGGATNACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu129d23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACAGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAGGCAGTGGAATAAAAGAAAAAAATGGATNACAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas  5x3  ?                     TGas090e03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGTGGCACAGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAGACCAGTGGAATAAAAGAAAAAAATGGATACACAAAAAAAAAAAAAAAAAA
  3   1   2      seed Lun1      in                        CABD12434.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTTTGGGAACCACTGAGTTAAGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGGATACAC
  3   1   2       bld TpA  5g3  in                    TTpA052k10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGGGGATGGAAAGGACATTTTATCAGTGTATATCAAGGTTTAGTTTGATCATGGTCAAAGTTCTATTTCAGATTGTGTATTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACNTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGGAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS8175.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTATCATAAACGGTGTTACTGTAATATTTTGCCTAATTGCACAATACCACTAATATTCCCCAAGTGCCTTTTTTATACAGGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGCGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGGAT
  3   1   2       bld Spl2      in                        CBSS9968.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTAGATCAGGAATCTCATTGTGTAAGAAAGCTCAGATTTTATTGACACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGGATACAC
  3   1   2       bld TpA       in                    TTpA001c21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGTAAGAAAGCTCAGATTTTATTGCCACTCAAAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGCCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACCCAAGCAAACTGTCAATCATGGAGGGTGCCCAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTTTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTTTATTTGGAATGGAAAAATAAATTTTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTCCATATTTGTACATAATTTTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATTTCAAATCAAATGTTATTATATGATTTTTTTATTGGGAATATGTAATATATCCATTGTTCTTTTTGTATAATGCGGGTGTTGTTGTTATCCCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTTTTAAAAAACCAGTGGAATAAAAGAAAAAAATGGATCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Gas7      in                         XZG15076.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAAATGAAGGAAGTTTTGTGTATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGG
  5   1   2       bld Bone      in                        CBTC1632.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACAGTGGAATAAAAGAAAAAAATGGATAC
  3   1   2       bld Bone      in                        CBTC1632.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATAAATTCCAGTGCATCTCAGGTTGGGGTGGCCAGGCCTATTGTTTGAGTGGCTTGGGAATTTCCCCTATGTACACAAGCAAACTGTCAATCATGGAGGGTGCACAGCCAATGAGGTCGCAAACAGGCAACCCATTTCACGTGGACCATATGGACAGCCCTTTTATGGGGTACAATTCATATTCCCTTATTGCTCCATTGTCTATAAATGACTTTAGGCTTACATAACTATATTGTTGGGTCTATTTGGAATGGAAAAATAAATATTAAAAGAAGCTTAATTTAGCAATAATTAAAATTTTACATATTTGTACATAATTCTTTTTGTAAATCCCAAGTGCATTGAGAAAATTGCCAAATAATGATTTTTTTTTTTACAAAGGGAGATCTCAAATCAAATGTTATTATATGATTTTTTTATTGTGAATATGTAATATATACATTGTTCTTTTTGTATAATGCGTGTGTTGTTGTTATACCTCAGGTTGTTTATATGTCTTGTAAATATATTTTCATCATCCAAGCAAAAAACATATTTAATTTTGTGTCTTAAAAAAACCAGTGGAATAAAAGAAAAAAATGGATAC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)