Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ9440.3                           19 END     3          18       15                (no blast hit)
     2   2.0    0Xt7.1-CABJ9440.5                           11 END     2          12       18                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012079567 Xt7.1-CAAK5058.5 - 16 ESTs
                                                                       ...-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......2930......2940......2950......2960......2970......2980......2990......3000......3010......3020......3030......3040......3050......3060......3070......3080......3090......3100......3110......3120......3130......3140......3150......3160......3170......3180......3190......3200......3210......3220......3230......3240......3250......3260......3270......3280......3290......3300......3310......3320......3330......3340......3350......3360......3370......3380......3390......3400......3410......3420......3430......3440....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAK5058.5                                                                                                                  CCTGCTGCTGCTGAGCGGCTGCGATAGGAGCGTTTCCGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGA
                                                  Xt7.1-CHK-1008232184                                                                                                                        GCTGCTGAGCGGCTGCGATAGGAGCGTTTCCGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGAGTTTAA
                                                      consensus depths                                                                                                                       3     3     3     3     4     4     6     6     7     8     7     8     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    11    10    12    10    12    10    12    10    12    10    12    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    14    11    15    13    16    13    16    13    16    12    16    14    16    14    16    14    16    14    16    13    16    13    15    13    15    13    15    12    14    12    14    12    14    11    13    11    13    11    13    11    13    11    13    10    12    10    12    10    12    10    12    10    12     9    11     9    11     9     9     8     9     8     9     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     6     6     6     6
                                               BLH ATG     235     350                                                                                                                  
                                               BLH MIN     235      40                                                                                                                  
                                               BLH MPR     235      40                                                                                                                  
                                               BLH OVR     235     600                                                                                                                  
                                               CDS MIN     235      40                                                                                                                  
                                               EST CLI      16       1                                                                                                                  
                                               ORF LNG     235      11                                                                                                                  
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 2e-030     NP_001004593.1 zgc:92140 [Danio rerio] ===============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 8e-049     XP_422292.1 PREDICTED: similar to chromosome 1 open reading frame 21 [Gallus gallus] =======================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Mm ==== 2e-048     NP_932107.1 RIKEN cDNA 1700025G04 [Mus musculus] ===========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 2e-049     NP_110433.1 chromosome 1 open reading frame 21 [Homo sapiens] ==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 3e-061     AAH72863.1 MGC80268 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 3e-061     NP_001085507.1 MGC80268 protein [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Xt ==== 4e-066     AAI23936.1 Hypothetical protein MGC145881 [Xenopus tropicalis] =============================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAK5058.5                                                                                                                                                                                                                                                                TGA------------------------------------------------------------------------------TGA---------ATG---------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------------ATG---------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                      ]
  0   1   1           HeRe FL                   EC2CAA10BG03.FL-Pollet                                                                                                                 gcctgctgctgctgagcggctgcgataggagcgtttccgacttgtgctcagctctgcgctccgtgtcccTGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGGGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAAGTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATAgaATCTCCCaCCatTTTTCTACtaaaaataaaagttttgg
  0   1   1           Brn3 FL                          CAAK5518.FL-MGC                                                                                                                                                               CTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGAGTTTATGTTTTTTTTTTTTTTTATGTTTTGGGGGTTTTGCAGACATTGTTCTGGCATTTTAACCACATGCATTACATATATGTGCCTAAGTGTGGGTAATTAGTTATCATTATGGCTGTATGCACATTTTGCTTTTGTGACATGAGGCAGAGGTGCTTCTGGGTAGAAGCTACAGTGCAGGCTGCTGTGATTGTATGTACAAGTTCTCTATGTAACTGTGCTCCATGCAGACAATTATTCATTAGAACATAAAATGCTAATGTTTGGATAACGTTTCAGTCTGTTTCCAAAAGTACCTGCCAGACGTGAGCAAATGCGGGAGCCATGTTTGAGCGACAATCGCCCATCGGAACAGGCAGCATCTACATAAAGTGAATGGGTGCAATTTAAAGCATGTAGTCCCCCACCTGCAGTGCTACAAAACACTGCAGATCACCCTGTGTGGCATTACCCTAAAGCAGAATATTAGGCATGATCAGTGGTCTTAATATAAGTCACTAGTAATGAGTGGCAGAACTGTGTGAAAATGCCCGGTGTATCCCAGCAAATGTAACAGCAGAAAACTGGCTCTAACTAAACGCCTGTCATAAACAATGTGCAGTGTTCTCAGGTGAAAACTTGTAATTTTCTTTTCTTGATCCTTTTTACATTCACACTGAAGGCTTTGGTTGTGTCCAGTTTATATTTGTTGCTCCTACTGGTCGGATGGAAGAAATCCCCATTGACTTCTATGAGAATATGTTGTGCTCTCTGGAGACTACACGAACTGTAGGTCCAGAGCAGCTGGTGGGCCCCCATATTGTAGCTCCTGCCTAACTAGTCTGAAGCGAGGGAGTTGTGTGAATGCATAAATGTGTTGTTGCCTGTAGCCCATCAGCATATATACATCAGTGCTGCTGTCATACTGGGTGAGTACATACACTGAGCTTAGCTTTTATTTCTCCTGATAGACTTTCTGGTCTTGTCTATGGAAGTATGTTGACTGTCGAACAACAGCAGTGACCTAATATTTTTTTTTTTCCCACGTACACTGGCTATTTATGTTATGCACAGATGGAATATTGCTGTCTGCCTCTTGCTCCATTCGCTCCCCCCACTGTGAGAAAGACCCATTTAACTCAAGTCAGGGAATGAAGGGATAAGGGATTGTATTCTGGCAAAGGGCTGCTCATGGCATGCGTTCACAAAGTAAAGTGTGTGCGTTCACATATACATCAAGATACTGGTGCAGCTTCCCCTCACATTATCATGCCGTATTTATTCAGTATAACAGTGGGTGCACGCTCAATCTCTGTTTTGTGTCCCATTTGCTTACATCATGTTGCTGAGTATCCCACCATTATCCCCCAAGTTCTGAAGTGCCTCGGGCAGTTATTCAATTCATATACATGAGTTGGGGTTTTCACTTTCAAGGGTTTCATCTTGAGACGTGCCCAGTATATACAAGAATTTATGGACCGGTTTATAAACTGTAGAAATAAGAATCCCCTCTTTCCTAAGGGCTTTCATTGACAAAATTAGTAGTTCACTTTTAAAGGGAAATGACACCTCCCCTTTTGACATAAGCTCATTCAGTTGGGCTTATGATAAAAATGTGTATAAACCCTATGTGGACTGCCAGAAATAAATATAAATGTATGATTGCACAGACATACCTGTTTATACCTGTTTATCACCTTGTTTTGTTGTGAAATGATGGATTCTGGCACTTGAAGTCCCCCTTGCTTTCCAGAGAATCTGGACATGTAGATAAATGGGGAGCACAAGTCACACTTTAACTGTGCAAATGGTTCTTGGTGGTGCTGCTCCTGGACACACCGCTACATCACCATTAGACACCAATATTGTATGAAGTTGAAGCACTCTGCATTTCTTGCTTTGCAATTTGTAATTTTATTTAGCCAGTTTTACCGCAAGAACAACATTTCAGGGGAGTCTGCACCACCTAGCCTGACAAAAGAAGGTGCAGACGCCCCAATTGTTGTTCTTGTTGTGTAACTAAATTAACAAATTGCAAAACAAGAAATGGTGAGTGTGTTGACATAATACAATTTTTGGATCCAGAGAATCTGGGCACCACCCGTTATGGAAAGCACAGGTCCTAGAATCCATCACTTCCCAACTAAACAATGTGAGGGGAGGGGATGAGTTACACTATGAGCCTAAGGAGGGGGTTGTGTGAATATCATGGTTTCCTTTCAATCTGCTGAATCAGGTCTGTATGAAAAGAAATACATTTATATTTGGTGGTTCAGATCATGTTTATGCTTTTCTACATAAGCTCAACTGACGTCATTTTAAAATAGGGGTAAAATATTTAGTATAATGTAAAAAAAAAAAAAAA
  5   1   2   15  bld Brn3 5g3  out                         CAAK474.5p TCTGTGCTGCCTCTCTGTATAATGAAGGCCTGGCCAGACCGGCTGTCTAATGAGTAGCAGTCTCTCACCCCTCCCATCCCCTCCCTATTCCCCCTCTGCTCTCTCCCTTCCCTGCTGCTGCTGCTGAGCGGCTGCGATAGGAGCGTTTCCGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACCTAGCTTCCATTCAAAATATGGTGTAAATATC
  5   1   2   10  bld Limb 5g3  in                        CBSU2880.fwd .............................GGCCTGGCCAGACCGGCTGTCTAATGAGTAGCAGTCTCTCACCCCTCCCATCCCCTCCCTATTCCCCCTCTGCTCTCTCCCTTCCCTGCTGCTGCTGAGCGGCTGCGATAGGAGCGTTTCCGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCTGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAA
  5   1   2       bld HeRe FL   in                     EC2CAA10BG03.g1                                                                                                                 GCCTGCTGCTGCTGAGCGGCTGCGATAGGAGCGTTTCCGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCTGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGGGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTAT
  5   1   2   30  bld Thy1 5x3                            CBST6514.fwd .................................................................................................................................GGCTGCGATAGGAGCGTTTCCGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTT
  5   1   2   14  bld Brn2 5g3  out                       CAAJ16708.5p ...............................................................................................................................................CGTTTCCGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGGTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCG
  5   1   2   14  bld Brn3 5g3  out                        CAAK5058.5p .....................................................................................................................................................CGACTTGTGCTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCCAATCATGTATTCCTTGNNCTANNAG
  5   1   2   14  bld Brn3 5g3  out                       CAAK10567.5p ..........................................................................................................................................................ATATTTAGAATGTTAGAAAAAAATCTCCTGTCATTTATAGAGAATAAGAGGCTTCTATATATTATTCTGACATATTTCGCGCTCACCTACAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGNCATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAAATCATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGA
  5   1   2      seed Brn3 FL   out                        CAAK5518.5p                                                                                                                                                               CTCAGCTCTGCGCTCCGTGTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCC
  5   1   2   10  bld Int1 5g3  in                         CAAP2880.5p ................................................................................................................................................................................GTCCCCGCTCTGCCCAGTGCCTGCCCCACTGGAACCCCCGTCCCAAGCCCCGGAGCAGCACCTCAGCAAGGTTCAGCAATGATGGACACATTCTTGGGTTTTTGGCACCACTTGTCAGCGTCTCACTAGAAATGTTTTTTCCAATCAGTCAGTCTGGAGCTGACTGATAAATATGGGATGTGCTTCGGCAAAGCATGTATCTACAGTACAAAATGAGGACGATGCACAGAACGGCAAAAATTACCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATNTCAC
  5   1   2       bld Gas7      in                         XZG47730.5p                                                                                                                                                                                                                                                                                                                                                                                                                    CAGAACGGCAAAAATTATCAAAATGGAGATGCCTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACTCACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGAGTTTAAAAA
  3   1   2       bld HeRe FL   in                     EC2CAA10BG03.b1                                                                                                                                                                                                                                                                                                                                                                                                                                       AAATGGAGATGCTTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGGGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAAGTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATAGAATCTCCCACCATTTTTCTA
  3   1   2       bld Gas7      in                         XZG47730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                ATGCTTTTTGTGATGAATACAGGATTAAGCCAGTTGAAGAAGTCAAATACATGAAAAATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACTCACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGAGTTT
  3   1   2       bld Limb 5g3  in                        CBSU2880.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATGGGGAAGAAGAGGAGCAGAAGGTTGTTTCAAGGAACCAGGAGAACTTGGAGAAAAGTGTCACCCATGCTGCCCGATCCAGAAGTAACGTTGAAGCTGCAGGCGCAGGACATCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGGTGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTCAGTGAGTTT
  3   1   2       bld Int1 5g3  in                         CAAP2880.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCCCTATCGAATAAATATCCACATCTCTGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGAGTTTATGTTTTTTTTTTTTTTTATGTTTTGGGGGTTTTGCAGACATTGTTCTGGCATTTTAACCACATGCATTACATATATGTGCCTAAGTGTGGGTAATTAGTTATCATTATGGCTGTATGCACATTTTGCTTTTGTGACATGAGGCAGAGGTGCTTCTGGGTAGAAGCTACAGTGCAGGCTGCTGTGATTGTATGTACAAGTTCTCTAT
  3   1   2       bld Tad5      in                         XZT68265.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCACGCGTCCGGAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGAGTTT
  5   1   2       bld Tad5      in                         XZT68265.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGAGCCAGCAGGAGTTCTTCAGGATGCTGGATGAAAAAATTGAAAAGGGACAAGATTACTGCTCAGAAGAGGAGGATATAACATAGCTTCAATTCAAAATATGTGTAAATATCTTAACACACCGAGTGGGGCTCTGGCAATGTATCTCCCTAAATGCTACAGCAAAATGCCGCTGTGGACTCCTATCGTTTTGCTGCGAACCTAGAACATTGTCTCTCTGCAATTGTTTCTATCGCATCTTTTATTGCGGCACACTGTCTTCTACTAAGAAGCTCGATGGGTTTGGTAGGAGATTTTATTGCTTCCGATTTGGATATAACTATTTCACAACCGGAGGAGCCAATCAATGTATTCCTTGGCCTAAAAGCACCAGTGGAGTGAGGGTTTAACTTGGCCAAAAAGGAACTAATATTGATGATCTCCGTATCACGGACTGCTTCCTGTTTCTTCCTCCTGCTGTGTTTCAGGAAAAGATGTTCCAACCGGTAGTGGAGGGATTTGAGATGTCGTTTGTTCTAATTGCACATACCACAGTCTGCAAATCATATGAATCTCCCACATTTTTTTCTACTAAAATAAATGTTAGTGAGTTTAAAAAAAAAAAAAAAAAAAAAAAAAAGG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)