Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 02 Dec 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 98%

 1012079664 Xt7.1-XZT55559.3 - 33 ESTs
                                                                       .-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT55559.3                                                                                                                                                                                                                                                                                                                                                                                                                                                GTTCGAGGCTGAGCAGCAGCAACTTTCTGCTTTAGCCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTCACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAACCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTTAAAAAAAAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227635                                                                                                                                                                                                                                                                                                                                                                                                                                                      GGCTGAGCAGCAGCAACTTTCTGCTTTAGCCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTCACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAACCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                     2     2     2     4     2     4     4     4     4     4     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     9     7     9     7     9     7     9     8    10     7    10     7    10     8    10     8    10     9    10     9    10     9    10     9    10     9    10     9    10     8    10     9    10    10    11    10    11    10    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    12    12    12    12    13    11    12    10    12    10    12    11    12    10    12    10    12    11    13    11    13     9    12     9    12     9    12     7    11     9    11     7     8     7     8     7     8     7     8     6     8     5     7     5     7     5     7     5     7     5     6     5     6     5     6     4     6     4     6     4     6     4     6     4     6     4     6     4     7     4     7     3     6     4     6     4     6     3     5     3     5     3     5     4     6     4     6     4     6     4     6     4     6     4     6     4     6     4     7     5     7     5     6     5     6     5     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     4     5     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     4     3     4     3     5     5     5     7     7    10    10    10    10    10    10    11    11    12    12    13    13    13    13    13    13    14    14    14    14    15    15    15    15    16    17    15    17    16    17    17    17    17    17    17    17    17    17    16    17    17    17    16    17    16    17    16    17    16    17    15    17    16    17    16    17    16    17    15    16    15    16    15    16    15    15    15    15    15    15    15    15    14    14    14    14    14    14    13    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13     9    13    11    13    12    14    12    14    12    14    11    14    12    14    12    14    12    14    12    14    12    14    12    14    12    13    10    13    12    13    12    13    11    12     9    11     9    11    10    11     8    11     2     3     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -------T-A--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    -----------G
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    T-----------
                                               BLH ATG     349    1014                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN      67     205                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR     349     986                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG     349      69                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Sc ---- 9e-021     NP_009991.2 Dosage-dependent suppressor of cmd1-1 mutation; shows homology to fork headfamily of DNA-binding proteins; Hcm1p [Saccharomyces cerevisiae] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN -== Br ==== 4e-024     CAA72307.1 whn transcription factor [Branchiostoma lanceolatum] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Bb ---- 6e-033     BAD97361.1 forkhead protein FoxQ1 [Branchiostoma belcheri] ------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Cs ---- 2e-033     BAB68347.1 forkhead protein FoxD [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ce ---- 2e-036     NP_491826.1 forkhead box F1a, LEThal LET-381 (40.0 kD) (let-381) [Caenorhabditis elegans] --------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 6e-044     NP_523950.2 CG18647-PA, isoform A [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bf ---- 2e-063     CAH69695.1 forkhead transcription factor [Branchiostoma floridae] --------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Ci ---- 2e-063     BAE06437.1 transcription factor protein [Ciona intestinalis] ----------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Sp ---- 5e-073     XP_794135.1 PREDICTED: similar to Forkhead box protein F1 (Forkhead-related protein FKHL5) (Forkhead-related transcription factor 1) (FREAC-1) (Forkhead-related activator-1) [Strongylocentrotus purpuratus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED - Gg ---- 6e-152     XP_414186.2 PREDICTED: similar to forkhead transcription factor [Gallus gallus] ---------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 1e-162     NP_034556.1 forkhead box F1a [Mus musculus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 1e-169     XP_694768.1 PREDICTED: similar to Forkhead box protein F1 (Forkhead-related protein FKHL5) (Forkhead-related transcription factor 1) (FREAC-1) (Forkhead-related activator-1) [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 7e-170     NP_001442.2 forkhead box F1 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 0          CAB44732.1 XFD-13 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === ?? ==== 0          NP_001084262.1 XFD-13 protein [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xt ==== 0          NP_001039226.1 forkhead box F1 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT55559.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGA---------TAAATG---------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------ATG------ATGATG---------------------------------------------------------------------------------------------------------ATGATG------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------ATG---------------------------------------------------------------ATGTGA------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------TAA---------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------TAG------ATG---------------------------------------------------------ATG---------------TGA---------------------------------------------------------------------------------ATG---------------ATG---------------------TGA------------------------------------------------------------------------------------------------------TAA------------------------------TAA------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                               ... open reading frame                                                                                                                                                                                                                                                                                                                        ]
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  0   1   1           Tad5 FL                          XZT49405.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCGAGGCTGAGCAGCAGCAACTTTCTGCTTTACCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTCACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCGAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAGCCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAATTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu093i16.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCGAGGCTGAGCAGCAGCAACTTTCTGCTTTACCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTCACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAGCCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAATTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Fat1 FLq                         CABC1449.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTTTACCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTCACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAGCCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA  5g3  in                   TTpA071g02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                       AATCCAGAAGTTCGAGGCTGAGCAGCAGCAACTTTCTGCTTTAGCCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCATATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGCCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAaagccgccttactcgtacattgcgctaatagtcatggccatccagagctcccccaccaaaaggctcaccctcagcgagatCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCNNAGAGGCTCANGAGGAAATGCCNAGCTCTCAAACCCATGTATAGCATGATGA
  5   1   2   22  bld Tad5 5g                              XZT72907.5p ...............................................................................................................................................................................................................................................................................................................................................................................................................................................GTTCGAGGCTGAGCAGCAGCAACTTTCTGCTTTAGCCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCATATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTCTCCCCAGCGCTCAGAGGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCCGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTGACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCAAGCGCTCAAACCCATGTATAGCATGATGAATGGCC
  5   1   2       bld Tad5 FL   in                         XZT49405.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTCGAGGCTGAGCAGCAGCAACTTTCTGCTTTACCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAaagccgccttactcgtacattgcgctaatagtcatggccatccagagctcccccaccaaaaggctcaccctcagcgagatCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAG
  5   1   2       bld Neu  FL   in                   TNeu093i16.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTCGAGGCTGAGCAGCAGCAACTTTCTGCTTTACCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAA
  5   1   2   10  bld Fat1 5g3  in                         CABC4860.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAaagccgccttactcgtacattgcgctaatagtcatggccatccagagctcccccaccaaaaggctcaccctcagcgagatCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTNCAACCCATGTATAGCATGATGAATGGC
  5   1   2       bld In63 5g                         IMAGE:8957511.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCAGCCTTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTCACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGCTGGGCAGACCCGGGAAAGGGCCATTACTGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGAGGGCTCCTTTAGAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCCTCCAAACCCA
  3  -1   2       bld Fat1      in                         CABC9242.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAaagccgccttactcgtacattgcgctaatagtcatggccatccagagctcccccaccaaaaggctcaccctcagcgagatCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCANACCCATGTATAGCATGATGAATGGCCTGNGCTTCAACCACATACCAGAGACTTACAGCTTTCAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGAT
  5   1   2       bld TpA  5x3  out                  TTpA063f18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GACCTATCACCGGTGGCGCAAGAGCAGCGCTTATGTAGGAATTCTCCGCCTGCTTCTCCAGCTCTCGCCTGTATTCCCAGCGCTCATTAGAGGCTTTCCCATAGGCCATAGCAACCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCATCTGCAGCCTGAAAAGCTCTGTATATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCTGCCATCGGTTATGGAGTCTGCCAACTGTGCCTCCATAACCAAGAAGACCAACGCTGGCATAAGAAGGCCACAAaagccgccttactcgtacattgcgctaatagtcatggccatccagagctcccccaccaaaaggctcaccctcagcgagatCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAATTGAGTGCTTTATCAAACTGC
  5   1   2       chi Fat1 FLq  in                         CABC1449.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGCTTTACCCGGAGACGCAATCGTAGGCAAGGTCCTTGCCAGCCTGCACCCAGCCATCCACTAACGGACCCAACATCAGTTACCAAGGGACCATTCAGCCACACACAGCGGGACCTATCACCGGTGGCGCAAGGGCAGCGCTTATGTAGGAATTCTCCGCCGCTTCTCCAGCTCTCGTCTGTATTCCCAGCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAaagccgccttactcgtacattgcgctaatagtcatggccatccagagctcccccaccaaaaggctcaccctcagcgagatCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGNGCAAGTGGAACCATCGCTTGTC
  5   1   2       bld TbA  5x3  out                  TTbA016k18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCGCTTCTCCAGCTCTCGCCTGTATTCCCTTCGCTCAGAAGAAACTTTCCCAAAGGCCAAGCAGCCAAGTGCGAACTGCGGGACTCGTATCCTCCCTCCCAGCCCTGCCTGCGCTCTCAGCTTTCCTCATTTTCTTCAGCTGCAGCCTGAAAAGCTCTGTAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAaagccgccttactcgtacattgcgctaatagtcatggccatccagagctcccccaccaaaaggctcaccctcagcgagatCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGAT
  5   1   2       bld In63 5g                         IMAGE:8958972.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGTAAAATGACTGCAGAGATTCAGCAGCCCCCCTCCCAGCCCCCTGCCCAGAGCAGCCCAATGTCTGCGGCCACTGACAAGCACGGAGGGCAGCCATCGGTTATGGAGTCTGCCAACTGTGCCACCAAAACCAAGAAGACCAACGCTGGCATAAGAAGGCCAGAAAAGCCGCCTTACTCGTACATTGCGCTAATAGTCATGGCCATCCAGAGCTCCCCCACCAAAAGGCTGACCCTCAGCGAGATCTACCAGTTTCTGCAGAGCCGCTTCCCATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCGCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGAAGCTGCACAGGCTCTCTGTGGGGACTACTCCATCATGATTCGCTCTCTCTCTAGGGAGGGGTGATGAAGCCCCATCGTCTATCAGCCCGCATCGGCTGGGACCATCAGCTTCACCCATACATCACAACAGCTCCTCTCCATGTATCTGCTGCTAACCATGTCTCAGCCTCCTCCATCTCTGCACCAGTCTAACTGGCACAAAAAAGCACATATATACGA
  5   1   2       bld Tad5      in                         XZT55559.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CATTTTTCCGAGGCTCCTACCAGGGCTGGAAAAACTCTGTCAGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGANAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTA
  5   1   2       bld Tad5                                 XZT55554.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AAACTCTGTCGGCACAACCTGTCCCTAAATGAGTGCTTTATCAAACTGCCCAAGGGGCTGGGCAGACCCGGGAAGGGCCATTACTGGACCATTGACCCGGCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCCAGCAGTAGGTTACCAAG
  5   1   2       add HdA       in                  THdA040a11.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAATTAATTACATAATTGCTATCATAAGCATGCTTGTTCTGTGTTGTCTGCATAAAGAAATGCTTCAGCAAGGCTGTGTAAATTTTTATCTAATTCCAATTTAACATTTTATAACGACCTAAATAAATACACCTACATAGCAAATGATGGAGAATAAACAAAATGTGCACGGTTGCACGGCAAAGAAAACAGTCTTTATAAATAAGAGTGGAAAGTATGCCAATATTGTTTTATGTATTTTTACTTTTTTGCCTTAGCTTTCTGTATACGGTGTATAAATAAGTGTACTTTATACACAGGCCCACTTTATTTTACCGTAAAAAAATTGATTACCCTTCACTGAATTTAGAAGAATTTTAGATTTTATTGTGTCATGTACTATAAATGTAATTTAATCCAGTATGCATTCGATTTGGATGTTAACCAGTTCTGGTTTATATTTGTGATGCCCTGGTTGGTGTTATTAGTATTATATCGATTGCAATAATGTGTGTGATATTATTATTATTTATTATTATTTAGTTTTGTGGTTATGAATATAAGATATTAAACTCAAGCCTCGGTTTTGCATGTAAGTATTTATATTTGTAATTATGTGTTTTCCTCCCATAAATGTCGGCTAACATTGTCCCGTTTGCCCTTGCAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAAGTTACCAAGATATCAAGCCCTGCGTGATGTGATTGGATAGC
  5   1   2       bld TpA                            TTpA017o07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCAGTGAGTTTATGTTTGAGGAGGGCTCCTTTAGAAGAAGACCAAGAGGCTTCAGGAGGAAATGCCAAGCTCTCAAACCCATGTATAGCATGATGAATGGCCTGGGCTTCAACCACATACCAGAGACTTACAGCTTTCAAGGGGCAAGTGGAACCATCGCTTGTCCACCCAACAGCTTGTCATTGGACAGTGGCATTGGAATGATGAACGGCCATTTGCCAAGTAATGTAGATGGAATGGGTTTAAGTGGACACCCAGTATCGCATATAGCTGCTAACGGTGGTCATTCCTACATGGGTAGCTGCACAGGCTCCTCTGGTGGGGACTACTCCCATCATGATTCCGGCTCTCCTCTCCTAGGGGAAGGGGGGGGTGATGGA
  5   1   2       bld In66                            IMAGE:8964336.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTTGATTAAACCAAAATATTAAAAAAATAAAAAAACCCGGCTCTCCTCTCCTAGGGGGAGGGGGGGTGATGGAGCCCCATTCCGTCTATTCCAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACATCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAGCCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAATCCTAACCAGGCCTAAAGGTGCGTACCCAATACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAAAAAGTGGGATGAGAGACTGGTTTCATTTTGGACAAAACATGAGCGTTCAGTGCATTTTTCTAGTATAATTGTGCTCTTTAATGTGACGCAATGTACTCTTATTACGCAACGCGTAGATGCATTGAAGAAAAAGACTCTGAACT
  3  -1   2       bld Lun1      ?                         CABD10930.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCCCCGCATCGGCTTGGGCCCCATCAGCTTCAACCCCATACACCAAACAACAGCCTCTCTCCCCTTGTAACTCTGCTGCTAACCCACTGTCCTCCAGCCTCTCCTCCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAACCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAATATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTT
  5   1   2       bld Tad5      in                         XZT11536.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCTCCAGCCTCTCCTCCACTCTCTGGACCAGTCCTACCTGCACCAGAACAGCCACAATACAGCCTCAGAGTTACAAGGTATCCCAAGGTACCACTCCCAGTCTCCTAGTATGAACGACAGAAAAGAATTCGTTTTCTCTTTTAATGCCATGGCCTCATCCTCGATGCACTCTGGCAGTGGATCTTATTACCACCAGCAAGTAGGTTACCAAGATATCAAACCCTGCGTGATGTGATTGGATAGCTTTGTCTCAGACTTGCCCTCTTCCAGCGCTTCTGGCAGCCAAGTGGTTAAACAAGAAGTTAGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTT
  5   1   2       bld Tad5      in                         XZT54210.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AGTCATTGCACTAACCAAAGAGGTATTTGTTCCCATATTGAGGACGGAAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAGCACAACAACTGTCTCCTCAAATTCTGCGGGGTATTAATCGAAGAAAGGTGGGATGAGAGAAGTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCCTTA
  5   1   2       bld Tad5                                 XZT28273.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGACGCGTGGGGAGGACGGAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTANGTGGGTGCATTCGGCGCCGACCCTGTTAT
  3   1   2       bld Neu  FL   in                    TNeu093i16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTTTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTTTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGCAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAATTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5      in                         XZT46895.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AAAAAAAACTCTTAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAGCACAACAACTGTCTCCTCAAATTCTGCGGGGTATTAATCGAAGAAAGGTGGGATGAGAGAAGTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAANATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACA
  5  -1   2       bld Fat1      in                         CABC9242.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TAGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAAATAAAATTTGTATGTTATTTGTAAAAAAAAACCTCGG
  3   1   2       bld Fat1 FLq  in                         CABC1449.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATGAAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTCAAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGT
  3   1   2      seed Tad5      in                         XZT55559.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGATGGAAAAGAAATAGTTTTGCATAATAGATTTTCTTACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGT
  3   1   2       bld Fat1 5g3  in                         CABC4860.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TACTGAGGTCTTTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACACAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTGTAAAAAA
  3   1   2       bld Tad5      in                         XZT46895.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTTTATACTTCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTACCCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAGCACAACAACTGTCTCCTCAAATTCTGCGGGGTATTAATCGAAGAAAGGTGGGATGAGAGAAGTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGT
  3   1   2       bld TpA  5g3  in                   TTpA071g02.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCAAACATTTATGTTTTTTAAAGAACTAGCACAGAAAGGCCAAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGCAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTTTCCTCAAATTTTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTTTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTTTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTTTTTTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTTTTTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATTTGACAAAAAACCCCAAGAAAAAAAATAAAATTTGTATGTTATTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                  XZT3118.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCAAACGTTACCCTTTCATTGCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAGGCCTAAAGGTGCGTACCCAATAACGCAGCAAGATCCTGGACCCCAGCACAACAACTGTCTCCTCAAATTCTGCGGGGTATTAATCGAAGAAAGGTGGGATGAGAGAAGTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAAAA
  3   1   2       bld Tad5      in                         XZT11536.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CCCTGGTAACCTTGCAACCCACCCAGTGTCGAGAAAAACCTAACCAAGCCTAAAGGTGGGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTCTGCGGGGTAATTTTCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTCCAGGGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTCTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACCCCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTAGTTTTCTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATCTTTTCTATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCGCCGACCCTGTTATTTTTCTCTGCACCGTATAAACGTAACGGAGACAGCGTTTCCCCCCTTGTGT
  3   1   2       bld HdA       in                    THdA040a11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAACCTAACCAGGCCTTAAGGGGGGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTTTCCTCAAATTTTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTTTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTTTGAACTGCCCTCTGTAGAGAGTTACCATGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTAATGACAACGCGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGTGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTTTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTTTTTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATTTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAAAAAAAAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tad5 FL   in                         XZT49405.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAACCTAACCAGGCCTAAAGGTGGGTACCCAATAACGCAGCAAGATCCTGGACCCCAACACAACAACTGTCTCCTCAAATTTTGCGGGGTAATTATCGAAGAAAGGTGGGATGAGAGAACTGGTTTCATTTTGGACATAAAACAATGAGCGTTCAGTGTATTTTTCTAGTATAAAATGTGCCCTTTATGTGACAGGCAATGTACTCCCTTATTTAGCGCAACGGCGTTAGATGGAATGAGAAGAAAAGACTTTTGAACTGCCCTCTGTAGAGAGTTACCAGGGCACTTTTCACTCACTCTCTTTATTTATTTATCTTTCCCTTTCCTTTTTTTTTTTAATGACAACGGGACACCAGATGCATCCGTCGGTTTATCAGTATTGATGGGGTTTTTGTGTTGGCAATATTTGCCAAGTGAATTTTGTTTTTTTCTTTAAAGTCACTGTAAATTTGGAACAAAATTCCGTTCTGGGTAAAGTCAGTCTTTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGGGGGGGCATTCGGCACCGACCCTGTTATTTTTTTCTGCCCTGTATAAATGTAAGGGAGACAGGGTTTCCCCCCTTGTGTACATCTGACAAAAAACCCCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAATGGT
  3   1   2       bld Tad5      in                         XZT54210.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTCACTGTAAATTTGAACAAAATTCCGTTCTGTGTAAAGTCAGTCTNTAATATGTTTTATATAAATCTATATTATATATATAAAATAAGGGATGTTCGTGTGTTAGGTGGGTGCATTCGGCACCGACCCTGTTATTTTTCTCTGCACTGTATAAATGTAACGGAGACAGCGTTTCCCCCCTTGTGTACATCTGACAAAAAACACCAAGAAAAAAAATAAAATTTGTATGTTATTTGTAATTGT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)