Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 01 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABJ11702.3                          11 END     7          41       63                (no blast hit)

 This cluster: approximate FL confidence score = 96%

 1012079707 Xt7.1-CABJ11702.5 - 17 ESTs
                                                                       .-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABJ11702.5                                                                                                                                                                                                                              CTATAGCTTCCCCTCTCTCACAGACACAAACCTTATGGTGAGCCCTTACTCCTGTCGGGGAATGAGAGGGAAGGCTCTGTAAATGACGCGCCTTTCTTTTGCAGAGAGGTTGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTCCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCATGATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTACAAGAAAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATGAAAAGCAACTTTAAAAATAAGTTGTGAAATATTATTTAAAAAATAGTATTGTGAGGGTGAATTAAGAAATTGCAAATAAACCTTTATATATGATTG
                                                  Xt7.1-CHK-1008231662                                                                                                                                                                                                                                    CTTCCCCTCTCTCACAGACACAAACCTTATGGTGAGCCCTTACTCCTGTCGGGGAATGAGAGGGAAGGCTCTGTAAATGACGCGCCTTTCTTTTGCAGAGAGGTTGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTCCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCAxxATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTACAAGAAAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATGAAAAGCAACTTTAAAAATAAGTTGTGAAATATTATTTAAAAAATAGTATTGTGAGGGTGAATTAAGAAATTGCAAATAAACCTTTATATATGATTGAAACCT
                                                      consensus depths                                                                                                                                                                                                                                   2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     5     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     4     8     7     8     7     8     8     9     8     9     8    10     8    10     9    10     9    10     8    10     9    10     9    11     9    11     9    11     9    11    10    12    10    12     9    12     9    12     9    12     9    12     9    12     9    12    10    13    10    13    10    14    10    14    10    14    10    14    10    15    10    14    10    15    12    15    12    15    12    14    13    15    13    15    13    15    13    14    12    13    12    13    11    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                  --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -----A------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          -------T----
                                               BLH ATG     257       4                                                                                                                                                                                                                              
                                               BLH MIN     311      24                                                                                                                                                                                                                              
                                               BLH MPR      23      24                                                                                                                                                                                                                              
                                               BLH OVR     176     380                                                                                                                                                                                                                              
                                               ORF LNG     176      43                                                                                                                                                                                                                              
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Hs ---- 3e-009     NP_078863.2 hypothetical protein FLJ22353 [Homo sapiens] --------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Ce ---- 5e-010     NP_491980.1 putative mitochondrial protein of eukaryotic origin (37.5 kD) (1H520) [Caenorhabditis elegans] ---------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Mm ---- 3e-012     NP_081113.1 RIKEN cDNA 1110038M16 [Mus musculus] ----------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PREDICTED - Gg ---- 2e-013     XP_422420.1 PREDICTED: similar to FLJ22353 [Gallus gallus] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xl ---- 3e-015     AAH87518.1 LOC496092 protein [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - ?? ---- 3e-015     NP_001088819.1 hypothetical protein LOC496092 [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 5e-025     NP_611751.1 CG3082-PC [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 2e-034     XP_798655.1 PREDICTED: similar to CG3082-PC, isoform C [Strongylocentrotus purpuratus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Dr ---- 4e-066     XP_693478.1 PREDICTED: similar to CG3082-PC, isoform C [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABJ11702.5                                                                                                                                                                                                                                                                    TGA---------------------TGA------------------TGA------------------------TGA---------------------------------------------------------------ATG------ATG------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG------------------------------------------------ATG------ATG------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------ATG---------------------------------------------TAA------------------------------------------------TAA---------TAA------TAA---------------------------------TAA---TAA------------------------------------------TAA------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                              [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   1           Neu  FL                     TNeu058m05.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                       AGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTTCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCACGATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACATAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACTGTACAAGAAAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATGAAAAGCAACTTTAAAAATAAGTTGTGAAATATTATTTAAAAAATAGTATTGTGAGGGTGAATTAAGAAATTGCAAATAAACCTTTATATATGATTGAAACCTAGGAAAACACAAAAGTAGATTATGTCCAAGTCAGTGCCTTCAACTGTGTATTTTGCATAAACATTGGGGAAAATATTAAACCGCATTTTTACAGGAATCGAATGTGTAAAAGAGATGCAAACTGCCCACTAGTGAACTCACTAATACTCTCCTGAAGCACAAAGTACAGAGATTTCACAAGAGGTTTGTTGGGTCAAAGTGAACTTAAACAAACTATTTACAGACTTGCATGTTATGCTAATAGATACTAAACATGTATACCTGCAGCCATCTGTAAAGTGCCAAAACTTTTATTTTTACAACAATAGTAATAAGTATATGTTATTTATATAGTGTTGACATATACATCATTTACATAAGTCTTTGCTCTACAGTTTAGGGTCGCAATCGCATTCACACACAGAATGGTCAATTATATCAGGAGTCAAGTAACCAGCATCTCTGAATTTGTTTGTGGGAAGAAACCCACATAAATACAGGCAAATATACAAACTCCTTGCAGACTGGAATTAAAGGGGTGGTTCACCTTTAGTCTAACTTTTAGTATGTTATAGAATTACCTATTCTAAGAAACTTTTCAATTGGTCCCTATTTATTTGTTTTTGAATTATTTGCCGCCTTCTTTCAACTCTTTGCAGTTTTTAAATGGTCACTGACCCCAGCAGCCAAAAAACGATTGCTCTGTGAGGCTACCGTTTTATTGTTATTGTTACTTTTAGTAATATTTCTTTCTATTCAGTCCCTATCCGATTCATATAACAGTCTCTGATCCAAACCACTCCCTGGCTGCTAAGGTAACTTGGACCCTAGCAACCAAATAACTGCTGAAACTCCAAACTGGAGAGCTTTTGAACTGAAAATGAAATAACTAAAAAACTAGAAATAATAAAAAATGAAGACTAATTGCAAATTGTCTCTACACCAGGGATACCCAACCTTTCTTACTCGTGAGCCACAGTAAATCCACAGCAAAAAAGCACCCGGGTTGTATATTATGTGACATAAGACTACCTTGAAAACAATATATTTTCAAAAAGTACATAACCTGTTTAACATCCTGTGCAAATAAAATGTGAAATTTTGCTGACAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Gas7      out                        XZG49182.5p TTCCTGGCACCACACTGTTGCAGAATCGCATGCATGCATGAATCAGAGGGGGCAGGACTGTTTATCTTAGCTTCTTCTACCGCAAACAGAACTGAATGTTCTACTGACCGAAATATGCAGGAACGCCCTTTCCCTCTCGTATGTTATATATGGGCCGCACAAAGGGAGCGTGTGCTACTGCTTTACCCGCGCCTCTTTACATTACACTGGACACGGACCAGCTATAGCTTCCCCTCTCTCACAGACACAAACCTTATGGTGAGCCCTTACTCCTGTCGGGGAATGAGAGGGAAGGCTCTGTAAATGACGCGCCTTTCTTTTGCAGAGAGGTTGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTCCCCTACACACAGTAAGTTCCAAGTGCCCGCGATCTGTTAGTATAGGGTTAATGTGATGGCCTCCCCGCTGGCAGTGTATATGGAGCACACGGCAGCCCGATGTACTGCTCAGTTTCGTGCTGTTGGGAGGACACTGAGACATTCCTGGCAGCACAGAGAAACCCCATCCTACTCTAGCAATAACTCAGGGGTTTGTGTGACTAAAGCTAAGAAACCGTCACAGTTACGGCTAAAATGAACTAACGAGGCTATCACAATGTCCTCCCACTTACCCCCCTTCCTAAAGTGTCTTTATTTTGTGTGCCCTTCAGTCGCAGACCCGGACCCAATAAGGATCTAGTTATAGGTTTTTGCCTAGTTTTTATCTTCAGGTCAATAAAATAGCAATGCTAGGGGGATGTGTGAGAGTTT
  5   1   2       chi Liv1      out                       CAAR11494.5p                                                                                                      cgactttttcgtattgagcgctcgtaagtggcggccgaaactttcagacttagcatgattttggaagcctcccataggactcaatggcaccctgcagctccaacctggcccaagaaaagtcaccatactgaagcttgaatgaatccgaacgctacgaaaaaatcgcaacattttgcgcaactttcggaatggctgcgaaaaaggcgcgacttttcgcgcaagttttaacgctacgaaaaaatcacgagattttgcgcagcattcggatggcaacgaaaaagtcgcgataattttccaaaaaaatcgccaaataccgatcattacgaaaaaaacgcaatcggacgcattcggccggttcatgagGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCACTATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCC
  5   1   2   10  bld Mus1 5g3  out                       CABH10557.5p .............................................................................................................................................................................................................................CTATAGCTTCCCCTCTCTCACAGACACAAACCTTATGGTGAGCCCTTACTCCTGTCGGGGAATGAGAGGGAAGGCTCTGTAAATGACGCGCCTTTCTTTTGCAGAGAGGTTGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTCCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCATGATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCAATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGT
  5   1   2   10  bld Ovi1 5g3  in                        CABI14140.5p ......................................................................................................................................................................................................................................CCCCTCTCTCACAGACACAAACCTTATGGTGAGCCCTTACTCCTGTCGGGGAATGAGAGGGAAGGCTCTGTAAATGACGCGCCTTTCTTTTGCAGAGAGGTTGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTCCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCATGATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCAATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCTAANAGCTTATACAGTAGATTACTA
  5   1   2       bld BrSp 5g3  out                    EC2BBA28AD07.g1                                                                                                                                                                                                                                                                                                                                          GGGGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGCCTTTCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCACGATTCCTGACCCTATAATTACCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTTTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCCATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAAAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAG
  5   1   2       bld Neu  FL   out                  TNeu058m05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                        GCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTTCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCACGATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACATAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGAT
  5   1   2       bld Ski1      out                       CABJ11702.5p                                                                                                                                                                                                                                                                                                                                                                                                                          TTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTTCCCTACACACAGGGCATTTTGTCCAAATGTGCCAGTCCAGTTCCACTATTCCTGACCCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACAT
  5   1   2       bld Ova1      in                         CABE5456.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAGTTCCACTATTCCTGAGGCTAAAATTATCGCCGATGCAGGATCTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCAT
  5   1   2      seed Ova1      in                         CABE1584.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTCCTCCCAAAGCTCAGGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTA
  5   1   2       bld Gas                            TGas015o01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GGCATCATCTGAGCCTTTCCAATCAAGCAATGTAAAAAATACTCCCATTCTGTCTTCCTGTACACAGACCCTTCAGTTCCCAGGAGCTGTTGGCCATCACGTCCCCTCTTGCTGATGCTGCCCTGGTTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCAATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAATGTGGTAGAAGAG
  5   1   2       chi Gas7      in                         XZG19444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGGACACGGCCCAGCTATAGCTTCCCCTCTCTCACAGACACAAACCTTATGGTGAGCCCTTACTCCTGTCGGGGAATGAGAGGGAAGGCTCTGTAAATGACGCGCCTTTCTTTTGCAGAGAGGTTGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTCCCCTACACACAGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGTATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAATGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAANGAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACAC
  3   1   2       bld Ovi1 5g3  in                        CABI14140.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTGGGCTCGAAAGCGCATTCATATGAGAAGTATATCCATCTTTACTTTAAATTAGGCTTTGATGTTCTGGTAGCAGAAAGCTTTGTATCCCATTTTTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCAATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAATGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTAC
  3   1   2       bld Ova1      in                         CABE5456.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTGTGGCCTAGTAAAGGCCTGGACTATGCAGGAAATCTGCTCGATCTTCTGTCAGCAGAGAAGGACCTTGCTTCACGCAGCCTTTATGTCCATGCCTTTTCTATAGGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTACAAGAAAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATG
  5   1   2       chi Tad5      out                        XZT40889.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAAACCTTATGGTGAGCCCTTACTCCTGTCGGGGAATGAGAGGGAAGGCTCTGTAAATGACGCGCCTTTCTTTTGCAGAGAGGTTGAATAGTTGTAGGCCCTCCTCTATGCCAGGGTCTGCCCGGTAAGCTGCTGCAGAGTGAGAAGGTGATGTTGGGAATGTTAAGATGCACCATGCGCTCTCCGGCTTCAGCCTCTCGGCTTTCCCTACACACAGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTACAAGAAAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATGAAAAGCAACTTTAAAAATAAGTTGTGAAATATTATTTAAAAAATAGTATTGTGAGGGTGAATTAAGAAATGCAAAT
  5   1   2       bld Ski1      out                        CABJ6232.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAAAGGTGGTTGTGGTGGAGGGGGTGGATATTATGGCAGTGGAGGCAGTGGAATAGGAGGATCCTCACAACAATACATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTACAAGANAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATGAAAAGCAACTTTAAAAATAAGTTGTGAAATATTATTTAAAAAATAGTATTGTGAGGGTGAATTAAGAAATTGCAAATAAACCTTTATATATGATTGAAACCT
  3   1   2       bld Gas7      in                         XZG19444.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCTACACACAGTGGCTACACATTTGCCCAGATGCTGGTGTCTTCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGTATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAATGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTACAAGAAAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATG
  3   1   2       bld Ova1      in                         CABE1584.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TCAATAAGTAATCATAAAAAACATAGAGAGATGCTGGAGAGGATCCAGGGACAGGTGTTTGACAGTCTTGTTGTAGGAAGCATGGAAAGGATGGCAACAGGTGTAGCACGCATGGTTGCCCTCCCAGCATTTCAGCAGATTATTGTAAATGGAACTTTGCTCTATTTTTCCCTCCTAAAAGCTTATACAGTAGATTACTACGAGAAGGGAATCCAGACTTTCTGGAACTCACCTGTCACCTGCCCAGCTCTTTTCTTTTACTGCATGGATGACCCTCTAAGTGATCACAAAGTGGTAGAAGAGCTTCTTAAGGACTGGGAGAAGCAAGGGATTCAAGTAAAGGCAAAGAGGTGGAATAGTTCAACACATGCCGGACATCTAAGAAAGCATCCACAGGAGTACACAGAAACCCTAAACACTTTTATTCAAAGTTTGCATCAGAACACTCCAAAATGCAAGTTATAGGTAGAGCAGATATTGCATCCTGTCTGGTATACAAAAATCACAAAAATGGAAGTATGGCAAATTTATTTTTTTATAATTTATAAATTTATAATTTAAGTAAAGCTTCCTTCCATTCCCATTATAATAACTTACCGTACAAGAAAATAAAGGAGAATATAAAGAAAATAAAGAAGACATGAATTAAACAATGAAAAGCAACTTTAAAAATAAGTTGTGAAATATTATTTAAAAAATAGTATTGTGAGGGTGAATTAAGAAATTGCAAATAAACCTTTATATATGATTGAAACCT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)