Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 09 Mar 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 415.0    0Xt7.1-TNeu117p19.3.5                       78 PI      84        458      876                Forkhead box protein C2 (FoxC2)

 This cluster: approximate FL confidence score = 98%

 1012079713 Xt7.1-TGas132n18.5 - 34 ESTs
                                                                       .......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas132n18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCGATGTGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAGCCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTACTCCCCAGGCCAGGGCTCCATCTACAGCCCCCCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCACTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCTGCAGCTACCACGGTGGAAGACACCTTACCTGACTATTCCATCACTACCACCACCACCTCTGCCCTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCT
                                                  Xt7.1-CHK-1008227507                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAGCCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTACTCCCCAGGCCAGGGCTCCATCTACAGCCCCCCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCACTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCTGCAGCTACCACGGTGGAAGACACCTTACCTGACTATTCCATCACTACCACCACCACCTCTGCCCTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAAxxxxAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     6     6     9     6    10     6    10     6    10     9    11     9    11     9    11    10    12    11    12    11    12    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    11    11    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    11    12    10    11     9    10     9    10     9    10     9    10     9    10     9     9     8     8     6     7     7     7     7     7     6     6     6     6     6     7     7     8     7     8     8     9     7     8     7     8     7     8     7     9     8     8     7     7     7     7     6     7     6     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     6     4     6     5     7     6     8     6     8     6     8     7     9     6    10     6    11     7    12     9    13     9    13    10    13    11    13    10    13    11    13    11    13    12    13    14    15    15    16    15    16    15    16    14    16    14    16    16    16    15    16    15    16    15    16    16    16    16    16    15    16    16    16    16    16    15    16    15    16    15    16    15    16    15    15    14    15    15    15    15    15    15    15    12    15    12    15    13    15    11    15    12    14    12    14    12    14    12    14    12    14    12    14    11    14    11    13    11    13    10    13     9    12     9    11     9     9     5     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------T-----
                                               BLH ATG     336    2084                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN     321     240                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR     336    1303                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               EST CLI     -12      16                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG     336     123                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                       PROTEIN --- Sc ---- 3e-023     NP_014331.1 Fork Head homolog two; Fkh2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-037     NP_001041116.1 defective PHArynx development family member (pha-4) [Caenorhabditis elegans] ------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bb ==== 1e-040     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] ============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 1e-058     BAE06434.1 transcription factor protein [Ciona intestinalis] -------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ==== 1e-060     NP_524202.1 crocodile CG5069-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bf ==== 2e-068     CAH69694.1 forkhead transcription factor [Branchiostoma floridae] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 6e-074     XP_780709.2 PREDICTED: similar to forkhead transcription factor C [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 6e-131     NP_990337.1 winged-helix transcription factor [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_001444.2 forkhead box C1 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_032618.2 forkhead box C1; mesoderm/mesenchyme forkhead 1; congenital hydrocephalus [Musmusculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_571803.1 forkhead box C1a [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAI08536.1 MGC130988 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 0          NP_001089846.1 hypothetical protein LOC734912 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          NP_001007864.1 foxc1-prov protein [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas132n18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------ATG---ATG------------------------------------ATG---------------------------------------------ATG------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------TGA---------TGA---------------------------------------------------------------------------------ATG---TAG---------------------------------------------------------------TAA---------------------TGA---ATG---------TAA------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   1           Gas1 FL                     IMAGE:6987041.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTTTTCCCGATGTGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTTTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAACCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTACTCCCCAGGCCAGGGCTCCATCTACAGCCCCCCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCACTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCTGCAGCTACCACGGTGGAAGACACCTTACCTGACTATTCCATCACTACCACCACCACCTCTGCCCTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Gas  FLx                    TGas132n18.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas1 FL                            IMAGE:6987041                                                                                                                                                                                                                                                                                                                                                                                                                             ACCCGGAGTCCCTGGAATTCCCCGGGATGTTTTCCCGATGTGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCTGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTTTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAACCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAAAACGCCCCTGAAAAAAAAATCACCCTGAATGGGATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATTGAGACACCAGCAGGGCTGGCAAAATAAATTGGGACAATTATCCTCACCATTGTTTGTTAGTGCAGGGAAAAAGAAACCGGTAAGGCACACTGGAC
  5   1   2       bld Gas  5g                        TGas008d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGGGCCCCGGGCCGAGTGCCCCGGACCTGCCAGCGCCTGNATGCAGCGCCCCCACCCCCACATACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACATTCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCT
  5   1   2   12  bld Tad5 5g3  in                         XZT64900.5p .........................................................................................................................................................................................................................................................................................................................................................................................................................................................GTTTTCCCGATGTGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAGCCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATACAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACT
  5   1   2       bld Neu  5g                        TNeu023f09.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTCCCGATGTGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAGCCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGG
  5   1   2       bld Neu  5g                        TNeu032e05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                           TTTTCCCGATGTGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCC
  5   1   2       bld Neu  5g3  in                   TNeu074f21.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTCCCGATGTGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAGCCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAA
  5   1   2       bld Gas  FLx  in                   TGas132n18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAGCCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACACATGTTTGAAAATGGCAGCTTTCTG
  5   1   2       bld Gas  5g                        TGas013i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGAGGTACAGCCCCAACTCCCTGGGAGT
  5   1   2       bld Neu0 5g3  in                     NISC_ng07d05.y1                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTTTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAACCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAA
  5   1   2       chi Gas7 5x   ?                          XZG36020.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACTAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAAGAGGCCGCGGGATGGGACGTGGGAATATCTTCCAAAAACGGCGATAACCAGAATTGGTTTTGTATTTTTAATGTGGTGTTTTGATATGTTCCTGAATGTTTCCATTTTTGTTTATTTTTTTTTTTTTCCTTTTGATTAATAAAACTGTTCATGAACTG
  5   1   2       bld Gas8 5g3  in                          st83l02.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTTTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAACCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGT
  5   1   2   12  bld Tad5 5g3  in                         XZT66680.5p ...........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCAGCCCAAGGACATGGTGAAGCCCCCCTACAGCTACATCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAAGATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCG
  3  -1   2       bld Gas       in                    TGas060a15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTTTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGG
  5   1   2       bld Gas8      in                          st25h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCNGCCCAAGGACATGGTGAAACCCCCCTACAGCTACNTCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAANATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTANGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCANGGGACGACNAGAANCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAANATCGGCTCCTGAAAGAGCATCATGGNAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGNAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGANAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCANCAGCAGCACCANCANAG
  5   1   2       bld Eye       in                         CCAX2126.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTACTCCCCAGGCCAGGGCTCCATCTACAGCCCCCCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCACTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAG
  5   1   2       bld Gas8      ?                           st59k09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCNGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTA
  5   1   2       bld Gas8                                   st1m09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCNCCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCG
  5   1   2       bld Eye       in                         CCAX7793.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTACTCCCCAGGCCAGGGCTCCATCTACAGCCCCCCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCACTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCTGCAGCTACCACGGTGGAAGACACCTTACCTGAC
  3   1   2       bld Gas8 5g3  in                          st83l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCANTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCTGCAGNTACCACGGTGGAAGACACCTTACCTGACTATTCCATCACTACCACCACCACCTCTGCCCTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTC
  5   1   2       bld Ski1      in                         CABJ4206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCACTTGACTCCTGCCAACACCCCTGCAGCTACCACGGTGGAAGACACCTTACCTGACTATTCCATCACTACCACCACCACCTCTGCCCTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACC
  3   1   2      seed Tad5 5g3  in                         XZT66680.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCT
  3   1   2       bld Gas  FLx  in                    TGas132n18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTNCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu074f21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGGCAACCAGGAGCACCCTCACCNAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCCGGGGCAGCAGCAGAACTTCCACTNCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCNCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTGAATGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT64900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGCCAAGCTTCCATAGACTTGTTTTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTCCCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATTACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCT
  3   1   2       bld Eye       in                         CCAX7793.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTTTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCCCCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCTA
  3   1   2       bld Gas8      in                          st25h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTNCCGCACCTCGGGGGCGNTTGTCTATGACTGCAGCAAATTCNGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTANTNTNTNTATCAAT
  3   1   2       bld Eye       in                         CCAX2126.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTGAACAGTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCCCCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCTA
  3   1   2       bld Gas8      in                         st103c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTNTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTGAAAATATCCCGAAGGCTCAGCACCGTTG
  5   1   2       bld Gas8      in                         st103c08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCNANGNGTTAGTTTTGTACAGACAGCAAATTGNGTCTNGGTTTGTTAAAANGGGACAGNGTTAAACTCGGAAAATAACACGTAAGTTCCTTCNGCTTGNGATACATGGCAAACTCGTAAGGTATTATTTCCCTGNGTTTAANAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCANATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGNGNGGACCAAAACGCCCAGCCNGNGGCGATCAACTCACATACGATTATGTGTCGCANCTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTANCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGC
  3   1   2       bld Ski1      in                         CABJ4206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTTTTTTCCCCCCAGCCAGTCCTTGTTCCGCACCTTGGGGGGGTTTGTTTATGACTGCAGCAAATTTTGGCCAAAACGTTGAAAACAACTTTTCAAAAAATTTTTTTTTAATAGGGATTTTTTTTTTGAAAGGAAAAACCCCCCCCCCATCCAAAAAAATCCTATGGGTTAGTTTTGGACAGACACCAAAATGGGTTTTGGTTTGTTAAAAAGGGGCAGGGTTAAACTCGGAAAATAACCCGGAAGTTCCTTTTGCTTGGGAAACAGGGCAAACTCGTAAGGGTTTTTTTCCCCGGGTTTAAGGGGGGATTTTTTTTTATAAAAATATATGGCAAGCTTCCCTAGACTTGTTTTCAGAGGTAAATTGCAAAATAGTAATTTTTTTAAAGAAAAAAAAAAATGTCCCCGGGTTGGGTGGGCCAAAACGCCCACCCCGGGGGGGTCAACTCC
  5  -1   2       bld Gas       in                   TGas060a15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAAAAAAAAAAAAAAAAAAAGCGG
  3   1   2       bld Neu0 5g3  in                     NISC_ng07d05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGCCAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3  -1   2       bld TbA       in                    TTbA036i06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTTTTTTTTTATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTG
  5  -1   2       bld TbA       in                   TTbA036i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTTTTCTTAATAAATTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)