Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 28 Jan 2022 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 415.0    0Xt7.1-TNeu117p19.3.5                       78 PI      84        458      876                Forkhead box protein C2 (FoxC2)

 This cluster: approximate FL confidence score = 98%

 1012079713 Xt7.1-TGas132n18.5 - 34 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                     3     6     6     9     6    10     6    10     6    10     9    11     9    11     9    11    10    12    11    12    11    12    11    12    11    12    11    12    11    12    12    12    12    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    12    11    11    11    11    11    11    11    11    11    11    10    11    10    11    10    11    10    11    10    11    10    11    11    12    10    11     9    10     9    10     9    10     9    10     9    10     9     9     8     8     6     7     7     7     7     7     6     6     6     6     6     7     7     8     7     8     8     9     7     8     7     8     7     8     7     9     8     8     7     7     7     7     6     7     6     7     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     5     5     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     3     3     3     3     3     2     2     3     3     3     3     3     3     3     3     3     3     2     2     2     2     2     2     3     5     3     5     3     5     3     5     3     5     3     5     3     5     4     6     4     6     5     7     6     8     6     8     6     8     7     9     6    10     6    11     7    12     9    13     9    13    10    13    11    13    10    13    11    13    11    13    12    13    14    15    15    16    15    16    15    16    14    16    14    16    16    16    15    16    15    16    15    16    16    16    16    16    15    16    16    16    16    16    15    16    15    16    15    16    15    16    15    15    14    15    15    15    15    15    15    15    12    15    12    15    13    15    11    15    12    14    12    14    12    14    12    14    12    14    12    14    11    14    11    13    11    13    10    13     9    12     9    11     9     9     5     7
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    --------A---
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ------T-----
                                               BLH ATG     336    2084                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH MIN     321     240                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               BLH OVR     336    1303                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               EST CLI     -12      16                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                               ORF LNG     336     123                                                                                                                                                                                                                                                                                                                                                                                                                                                                
                                                                       PROTEIN --- Sc ---- 3e-023     NP_014331.1 Fork Head homolog two; Fkh2p [Saccharomyces cerevisiae] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 3e-037     NP_001041116.1 defective PHArynx development family member (pha-4) [Caenorhabditis elegans] ------------------------------------------------------------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bb ==== 1e-040     BAD97363.1 forkhead protein FoxE4 [Branchiostoma belcheri] ============================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ci ---- 1e-058     BAE06434.1 transcription factor protein [Ciona intestinalis] -------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ==== 1e-060     NP_524202.1 crocodile CG5069-PA [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Bf ==== 2e-068     CAH69694.1 forkhead transcription factor [Branchiostoma floridae] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 6e-074     XP_780709.2 PREDICTED: similar to forkhead transcription factor C [Strongylocentrotus purpuratus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Gg ==== 6e-131     NP_990337.1 winged-helix transcription factor [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 0          NP_001444.2 forkhead box C1 [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Mm ==== 0          NP_032618.2 forkhead box C1; mesoderm/mesenchyme forkhead 1; congenital hydrocephalus [Musmusculus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dr ==== 0          NP_571803.1 forkhead box C1a [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 0          AAI08536.1 MGC130988 protein [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = ?? ==== 0          NP_001089846.1 hypothetical protein LOC734912 [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xt ==== 0          NP_001007864.1 foxc1-prov protein [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas132n18.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATG---------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------ATG---------ATG---ATG------------------------------------ATG---------------------------------------------ATG------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------TGA---------TGA---------------------------------------------------------------------------------ATG---TAG---------------------------------------------------------------TAA---------------------TGA---ATG---------TAA------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ]
  5   1   1           Gas  FLx                    TGas132n18.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g                        TGas008d06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCCCGGGCCCCGGGCCGAGTGCCCCGGACCTGCCAGCGCCTGNATGCAGCGCCCCCACCCCCACATACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACATTCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCT
  5   1   2       bld Gas  5g                        TGas013i02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCCCCGAGCCTGCCAGCGCCTGAGTGCAGCGCCCCCACCCCCACAGTACGGGGCCAACCTCACCGCTGCCTCCCACTCCTGCACTGCCACATACCGGGGGTACGAGGGAACTAAGCGCCCAGCGCATCTGCCACACAGCCAGAGTCCGGAGCCGGGAGAGCCAAACCTCGGGTCCCCAGAGTTCTCTGCCGTCAGTGCCTCCCCTATTCCCAGCAGGTACTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTGTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGAGGTACAGCCCCAACTCCCTGGGAGT
  3  -1   2       bld Gas       in                    TGas060a15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGGGAGATCCGGGTCAGTGGGGTGTGCATGCCACTTGTTCCCCATCGTTGTGCCCATCTGAGTTTGCCCGGGGCTGGCAGTGCCCGCTGCAGGAGGAGGCGGAGGAGCCATGCAGGCGCGCTACTCGGTGTCCAGCCCCAACTCCCTGGGAGTCGTGCCCTACCTCAGCGGGGAGCAGAGTTACTACAGGGCGGCTGCAGCTGCGGCGGCGGCAGGAGGAGGCTACACGGGCATGGCTGCCCCCATGAGCATGTACTCCCACCCCGCGCATGAACAGTACCAGGCCGGCATGGCCAGAGCCTATGGG
  5   1   2       bld Gas8      in                          st25h21.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GCCGGCATGGCCAGAGCCTATGGGCCTTACACCCCCCAACCCCNGCCCAAGGACATGGTGAAACCCCCCTACAGCTACNTCGCCCTCATCACCATGGCCATCCAGAACGCCCCTGAAAAGAANATCACCCTGAATGGCATCTACCAGTTCATAATGGAGAGGTTCCCCTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTANGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCANGGGACGACNAGAANCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAANATCGGCTCCTGAAAGAGCATCATGGNAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGNAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGANAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCANCAGCAGCACCANCANAG
  5   1   2       bld Eye       in                         CCAX2126.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTCTATCGAGACAACAAGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTACTCCCCAGGCCAGGGCTCCATCTACAGCCCCCCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCACTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAG
  5   1   2       bld Gas8      ?                           st59k09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCAGGGCTGGCAGAATAGTATTAGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCNGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTA
  5   1   2       bld Gas8                                   st1m09.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AGGCACAACTTATCCCTCAACGAGTGTTTTGTCAAGGTGCCAAGGGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCNCCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCG
  5   1   2       bld Eye       in                         CCAX7793.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGACGACAAGAAGCCGGGTAAGGGCAGCTACTGGACCTTGGACCCGGACTCGTACAACATGTTTGAAAATGGCAGCTTTCTGAGGAGGAGGCGCAGGTTCAAGAAAAAAGATGTGGTCAAAGATGCCACTAAGGAGGACAAAGATCGGCTCCTGAAAGAGCATCATGGCAGCCAGCCCGCAGCCGCGCAACAGCAGCGCCAGCAGCAGCAGGGCCAGGCCCAAGCGGAGCAGGACAGCGGCTCCCAGCCGGTCAGGATCCAGGATATAAAGACCGAGAACGGCACCTCGTCTCCTCCCCAGGCCATGTCTCCTGCACTCAGCACGGTGCCCAAGATAGAGAGTCCGGATAGCAGCAGCAGCATGTCCAGTGGCAGCCCCCACAGCATCCCGTCCAACAGGTCCATGAGCCTGGAGGCTGCAGAGTCTCACCACCCGCACCAGCAGCACCACCACAGCCAGGGCTTCAGTGTGGATAACATCATGACCTCCCTCAGGGGGTCCCCGCAGGGCTCAGGAGAACTGCCTTCTCCCCTCATCTCCTCTTCCAGGACAGGTATCGCCCCCTCCTCCCTACTCACCTACTCCCCAGGCCAGGGCTCCATCTACAGCCCCCCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCACTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCTGCAGCTACCACGGTGGAAGACACCTTACCTGAC
  3   1   2       bld Gas8 5g3  in                          st83l02.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCTGCAGTCAGGGCACAAGCAGCGGCGGTGGGGCAGGGACCTATCANTGCAACATGCAGGCCATGAGCTTGTACTCTGGGGACAGGTCGGGCCACTTGACTCCTGCCAACACCCCTGCAGNTACCACGGTGGAAGACACCTTACCTGACTATTCCATCACTACCACCACCACCTCTGCCCTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTC
  5   1   2       bld Ski1      in                         CABJ4206.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGCCACTTGACTCCTGCCAACACCCCTGCAGCTACCACGGTGGAAGACACCTTACCTGACTATTCCATCACTACCACCACCACCTCTGCCCTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACC
  3   1   2      seed Tad5 5g3  in                         XZT66680.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GCCTTGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCT
  3   1   2       bld Gas  FLx  in                    TGas132n18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TGAGCCACGGCAACCAGGAGCACCCTCACCAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTNCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTGAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu074f21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CACGGCAACCAGGAGCACCCTCACCNAGGGCCGATTGCCCTCTTGGTATCTCAATCAAGCTGGGGATTTGGGCCACTTGGCCGGGGCCACCTACCCCGGGGCAGCAGCAGAACTTCCACTNCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCNCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTGAATGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Tad5 5g3  in                         XZT64900.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GGCCACCTACCCGGGGCAGCAGCAGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGCCAAGCTTCCATAGACTTGTTTTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTCCCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATTACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCT
  3   1   2       bld Eye       in                         CCAX7793.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGAACTTCCACTCGGTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTTTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCCCCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCTA
  3   1   2       bld Gas8      in                          st25h21.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GTGCGAGAGATGTTCGAGTCGCAGAGATTAGGATTGAACAGTTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTNCCGCACCTCGGGGGCGNTTGTCTATGACTGCAGCAAATTCNGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTANTNTNTNTATCAAT
  3   1   2       bld Eye       in                         CCAX2126.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATTGAACAGTCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCCCCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCTA
  3   1   2       bld Gas8      in                         st103c08.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TCCCCTGTGAATGGAAATAGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTNTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTGAAAATATCCCGAAGGCTCAGCACCGTTG
  5   1   2       bld Gas8      in                         st103c08.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGCAGCTGTCAGATGTCTTTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCNANGNGTTAGTTTTGTACAGACAGCAAATTGNGTCTNGGTTTGTTAAAANGGGACAGNGTTAAACTCGGAAAATAACACGTAAGTTCCTTCNGCTTGNGATACATGGCAAACTCGTAAGGTATTATTTCCCTGNGTTTAANAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCANATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGNGNGGACCAAAACGCCCAGCCNGNGGCGATCAACTCACATACGATTATGTGTCGCANCTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTANCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGC
  3   1   2       bld Ski1      in                         CABJ4206.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATGTTTTTTCCCCCCAGCCAGTCCTTGTTCCGCACCTTGGGGGGGTTTGTTTATGACTGCAGCAAATTTTGGCCAAAACGTTGAAAACAACTTTTCAAAAAATTTTTTTTTAATAGGGATTTTTTTTTTGAAAGGAAAAACCCCCCCCCCATCCAAAAAAATCCTATGGGTTAGTTTTGGACAGACACCAAAATGGGTTTTGGTTTGTTAAAAAGGGGCAGGGTTAAACTCGGAAAATAACCCGGAAGTTCCTTTTGCTTGGGAAACAGGGCAAACTCGTAAGGGTTTTTTTCCCCGGGTTTAAGGGGGGATTTTTTTTTATAAAAATATATGGCAAGCTTCCCTAGACTTGTTTTCAGAGGTAAATTGCAAAATAGTAATTTTTTTAAAGAAAAAAAAAAATGTCCCCGGGTTGGGTGGGCCAAAACGCCCACCCCGGGGGGGTCAACTCC
  5  -1   2       bld Gas       in                   TGas060a15.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TTCCCCCCCAGCCAGTCCTTGTACCGCACCTCGGGGGCGTTTGTCTATGACTGCAGCAAATTCTGACCAAAACGTTGAAAACAACTTTTCAAAATATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAAAAAAAAAAAAAAAAAAAGCGG
  3   1   2       bld Neu0 5g3  in                     NISC_ng07d05.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ATTTTTTTTTAATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGCCAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTGCCATTCGATTTGAATGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG
  3  -1   2       bld TbA       in                    TTbA036i06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTTTTTTTTTTATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTGTTTCTTAATAAATTG
  5  -1   2       bld TbA       in                   TTbA036i06.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AATAGGGATTTTTTTTATGAAAGGAAAAACACCCTCCACATCCAAAAATATCCTATGTGTTAGTTTTGTACAGACAGCAAATTGTGTCTTGGTTTGTTAAAATGGGACAGTGTTAAACTCGGAAAATAACACGTAAGTTCCTTCTGCTTGTGATACATGGCAAACTCGTAAGGTATTATTTCCCTGTGTTTAAGAGCGTATATTATATTATATATATATATGACAAGCTTCCATAGACTTGTTCTCAGATGTAAATTGCAATATAGTAATTTATTTAAAGAAAAAATAAATGTACCAGGATTGTGTGGACCAAAACGCCCAGCCAGTGGCGATCAACTCACATACGATTATGTGTCGCAACTTTGGCGTTTTCATAACAAAAATTAAGGGATTTTGTATCCAAACTATTTTATCTATCAATTTGTTTTCTTGTTTTGAAAATATCCCGAAGGCTCTAGCACCGTTTTTTCTTAATAAATTG

In case of problems mail me! (