Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TEgg074j08.3                         29 END     1           3        3                Unknown (protein for MGC:121934) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012079784 Xt7.1-TGas123d05.3.5 - 30 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                  Xt7.1-TGas123d05.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTTTTGAAGAGGAGGATTTCCAATCAATGACATATGGATTTAAGATGGCAAACAGTGTGACAGATCTTCGAGTAACAGGCATGTTAAAAGATGTAGAAGATGACCTGCAACGCAGAGTGAAGAGCACAAGGAGTCGCCAAGGAGAGGCAAGAGACCCTGAAGTAGAGCTCGAACACCAACAGTGTTTGGCAGTATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGA
                                                  Xt7.1-CHK-1008228200                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGAAGAGGAGGATTTCCAATCAATGACATATGGATTTAAGATGGCAAACAGTGTGACAGATCTTCGAGTAACAGGCATGTTAAAAGATGTAGAAGATGACCTGCAACGCAGAGTGAAGAGCACAAGGAGTCGCCAAGGAGAGGCAAGAGACCCTGAAGTAGAGCTCGAACACCAACAGTGTTTGGCAGTATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAxxxxxxCTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     2     2     2     2     2     2     2     2     2     2     2     3     4     4     4     4     5     5     5     5     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    11    12    11    13    11    13    11    13    11    12    11    12    10    11    10    11    10    11    10    11    11    11    11    11    11    11     9    10     9     9     9     9     9     9     8     8     9     9     8     8     8     8     8     8     8     8     7     7     7     7     8     8     8     8     9     9    10    10    10    10    10    10     9    11     9    12     7     9     8    10     8    10     8    10     8    10     8    10     8    10     8    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10     7    10     7    12     7    12     7    12     7    12     7    12     7    12     6    11     6    11     6    11     8    13     8    13     8    13     8    13     8    13     8    13     8    13     9    14     9    14     9    14     9    14     8    14     9    15     9    15     9    15     9    14    10    15    10    15    10    15    10    15     9    15     9    15     8    15     9    15     5    15     5    12     5     8     5     5     5     5     5     5     5     5     4     5     4     5     4     5     4     5     4     5     3     4     3     4     3     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3
  5   1   2  SIG                                    Xt7.1-TGas123d05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTTTTGAAGAGGAGGATTTCCAATCAATGACATATGGATTTAAGATGGCAAACAGTGTGACAGATCTTCGAGTAACAGGCATGTTAAAAGATGTAGAAGATGACCTGCAACGCAGAGTGAAGAGCACAAGGAGTCGCCAAGGAGAGGCAAGAGACCCTGAAGTAGAGCTCGAACACCAACAGTGTTTGGCAGTATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAAACATTTGACAAAAAAAAAAAAAAA
  5   1   2  SIG                                      Xt7.1-CABG4510.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGTTTGTTTCTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAACGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTAAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GTTTCTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAACGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTTAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAAGTATTAAA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACATTTGACAAA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----A-------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ----------TT
                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Ce ---- 4e-035     NP_505179.1 Embryonic growth-associated like (91.5 kD) [Caenorhabditis elegans] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Xt ---- 3e-080     AAH77680.1 MAK10 protein [Xenopus tropicalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 4e-100     NP_001014546.1 CG4065-PB, isoform B [Drosophila melanogaster] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 5e-173     XP_788784.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Dr ---- 0          NP_955844.1 Unknown (protein for MGC:64157) [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 0          NP_084429.1 embryonic growth-associated [Mus musculus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Hs ---- 0          NP_078911.2 corneal wound healing-related protein [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Gg ---- 0          NP_001026623.1 corneal wound healing-related protein [Gallus gallus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                  Xt7.1-TGas123d05.3.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG---------------ATG---------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------------------ATG------------------------------------------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------ATG---------ATG------------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---TAG------------------------------ATG------TGA---------------------------TGA------------------------------------------------------------------------------------------------------------------------------------ATG---------TAG---------------------------------------------------TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ]
  5   1   2  SIG                                    Xt7.1-TGas123d05.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTTTTGAAGAGGAGGATTTCCAATCAATGACATATGGATTTAAGATGGCAAACAGTGTGACAGATCTTCGAGTAACAGGCATGTTAAAAGATGTAGAAGATGACCTGCAACGCAGAGTGAAGAGCACAAGGAGTCGCCAAGGAGAGGCAAGAGACCCTGAAGTAGAGCTCGAACACCAACAGTGTTTGGCAGTATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAAACATTTGACAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008293788                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTGAAGAGGAGGATTTCCAATCAATGACATATGGATTTAAGATGGCAAACAGTGTGACAGATCTTCGAGTAACAGGCATGTTAAAAGATGTAGAAGATGACCTGCAACGCAGAGTGAAGAGCACAAGGAGTCGCCAAGGAGAGGCAAGAGACCCTGAAGTAGAGCTCGAACACCAACAGTGTTTGGCAGTATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTxxTxAAACATTTGACAAAAAAAAA
  5   1   2       ext Gas7                                 XZG27656.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAAAGCGGCTGTTTTTGAAGAGGAGGATTTCCAATCAATGACATATGGATTTAAGATGGCAAACAGTGTGACAGATCTTCGAGTAACAGGCATGTTAAAAGATGTAGAAGATGACCTGCAACGCAGAGTGAAGAGCACAAGGAGTC
  5   1   2       ext Sto1      in                         CABG6446.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGTTTTTGAAGAGGAGGATTTCCAATCAATGACATATGGATTTAAGATGGCAAACAGTGTGACAGATCTTCGAGTAACAGGCATGTTAAAAGATGTAGAAGATGACCTGCAACGCAGAGTGAAGAGCACAAGGAGTCGCCAAGGAGAGGCAAGAGACCCTGAAGTAGAGCTCGAACACCAACAGTGTTTGGCAGTATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACCACAGGGCACGGCAGAGAGACAAACTTGGACACATT
  5   1   4      seed Ova1      in                         CABE2077.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTGCAACGCAGAGTGAAGAGCACAAGGAGTCGCCAAGGAGAGGCAAGAGACCCTGAAGTAGAGCTCGAACACCAACAGTGTTTGGCAGTATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCCCAG
  5   1   3        nb Gas7      in                         XZG53995.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTGTTTGGAGATTTAGCAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTANCAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACACAGAGACAGCATTTGGCTTGC
  5   1   2       ext Gas       in                   TGas123d05.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CAGAGTAAAGTTTACACGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTACTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAAGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTGTAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACT
  5   1   3        nb Gas7      in                         XZG14874.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGCATTCTCCTGACTGTATTAATTGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTTAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTACTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAAACACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGC
  5   1   2       ext Gas7      in                         XZG62707.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCTTTCACAAAGAAGGAGACAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAAGCAGTTGACCTTTTGTCTGCAATTCACAACTCCCTCTTACATGGTATTCAAGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGNGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTA
  5   1   3        nb Gas5                                   XZF557.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACTCTGCAGCAGACAAAGTGCAGTGGTTGAAGCATCAAAGCTTATTGGCCAGCAGTTGATCTTTTGTCTGCATTCACAACTCCCTCTTACATGGTATTCATGCCCAAAATGATACCACAAAGGGCGACCACCCAATTATGATGGGATTTGAGCCACTTGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTACTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTACCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAAT
  5   1   2       add Neu0                               IMAGE:6993190                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTTAACCAGCGGTTGCTTCCACCAACTTTTCCTCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATTATAGAAGGAGCAACAGAAGGGGACGCCAGTAGCAAAAAAAAACCAAAGGAAAAACAAAGAAAAGTTTCGGACCCTCTGGGGGCAGAAAAGGAATCACCCCTTAAGTTCAAGGCCATAATTCAGAAA
  3   1   2       ext Gas7      in                         XZG62707.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCGATATGCAAAAATAATTAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTTCTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGC
  5   1   3        nb Gas                            TGas074g12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TAAGAAGGAGGAAATGGTCATCTACTTTTCTAAACTTATAGATCGGATAAAAACAGTGTGTGAAGTTGTCAATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTACTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTA
  5   1   3        nb Eye       in                         CCAX8235.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTAACAAACCTACACAGTATATTGGATTTCTTCTGTGAATTCAGTGAACAATCTCCTTGTGTATTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGGCCATTTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGC
  3   1   3        nb Gas7      in                         XZG14874.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTGTGAATTCAGTGAACAATCTCCTTGTGTACTCTCAAGATCCCTCTTACAGACTACGTTTCTGGTGGACAACAAGAAGGTTTTTGGAACTCATCTGATGCAGGACATGATAAAAGATGCATTGCGGTCTTTTGTTAGTCCTCCTGCCCTTTCTCCAAAATGTTGTCTGTATAATAACCACCAAGCAAAAGACTACATTGATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGC
  5   1   3        nb Gas                            TGas010o02.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTCCTTTGTGACTCACTGTGTTAGGCCATTTTGCAACCTGNATCCAGNATCCATGGNACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGGACGCAGTAGC
  5   1   2       ext Te1       in                         CBWN3038.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCATTTTGCAACCTGATCCAGATCCATGGACACAACAGGGCACGGCAGAGAGACAAACTTGGACACATTCTAGAAGATTTTGCCACTTTACAAGATGAGGCAGAAAAGGTAGATGCAGCCCTTCACAGCATGCTACTCAAGCAAGAACCACAGAGACAGCATTTGGCTTGCCTGGGGACCTGGGTTCTTTACCATAACCTGCGAATAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTA
  3   1   2       ext Gas       in                    TGas123d05.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TAATGATTCAGTATCTACTGAGTGGCTTTGAGTTGGAGCTCTATAGCATGCATGAATATTACTACATTTATTGGTATCTCTCTGAGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTATTTTGGGAAAAAAGTATTANAACATTGACAAAAACAAAAAAAAAAAAAAAAAA
  3   1   4      seed Ova1      in                         CABE2077.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGTTCCTCTATGCCTGGCTGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAACATTTGAC
  3   1   3        nb Ova1      out                        CABE1064.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGATGTCCACACTGAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGCTCTGTTAAGATTTTTTTTGGGAAAAAGAGTATTAAACACCTGACAAAAAC
  3   1   2       ext Sto1      in                         CABG6446.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GAGTCGAGCAGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAGAGTATTAAACATTTGACAAAAAAAAAAAAAA
  3   1   2       ext Te1       in                         CBWN3038.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGGTATTAAACATTTGACAAAAAAAAAAAAAAA
  3   1   3        nb Gas7      in                         XZG53995.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGGTATTAAACATTTGACAAAAAAAAAAAAAAAG
  3   1   0       chi Eye       out                        CCAX1234.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AATAAGGAAAATTACTTTGAAAACAAAAATATTGTGGGGGAGACGCACAGTTTTGTATATGAAGCATAAATAGAACTTTTCAGTTGTATTTGGTGGATCTTGGAGGAAAACAATTTTATTCTTCTGATTCCATGAAAACCTTGTGACCTACATAACAAGGAGCAGCTATTTGATCTTAAGGCAATTGCACCACAACATTATTTTGACAGATGCTGAAGGTACCAGTTTGAGCAAGCCTCCGCTGACTAAAGTAACATAGATTTTAGAAACTGAATCTTTATAGATTATACAGACACACCCATATAGGAGCATAGTTAATGATAACAATTGGAATTACTGGTGGTGTCTGATCATCTATTTTCTTTATCCTTCAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTTTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCCCCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAACATTTGAC
  5   1   2       ext Neu       in                   TNeu080p23.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAACATTTGACAAAAACAAAAT
  3   1   2       ext Neu       in                    TNeu080p23.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTGGGAAAAAAGTATAAACATTGACAAAAACAAAATAAAAAAAAAAAAAAAAAA
  3   1   3        nb Eye       in                         CCAX8235.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCCTACATGCAGTGTTCCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAACATTTGAC
  5   1   2  SIG                                      Xt7.1-CABG4510.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGTTTGTTTCTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAACGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTAAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTAT
                                                  Xt7.1-CHK-1008293790                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGTTTGTTTCTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAACGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTAAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAACA
  5   1   4   10 seed Sto1 5g3  in                         CABG4510.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGACAGCTCACAAATGGCAGAAGAGCGTATAATAGAGGAGCAACAGAAGGGACGCAGTAGCAAAAAAACAAAGAAAAAAAAGAAAGTTCGACCTCTGGGCAGAGAGATCACCCTAAGTCAAGCATATCAGAATATGTGTGCTGGCATGTACAAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGTTTGTTTCTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAACGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTTAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAA
  3   1   2       add Neu  5g3  ?                     TNeu122g03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTTTTGAAGGCTAATCACAACGGAGGCAGCCTCTATAAAAGCACCCTGTGTCACAAAGGAATATTTAGCATTTCAGCACTAGGAAATGGTTTTGAAAAACACATTTGTTGGGTTCTTCTTGTTTCAGACTATGATTGCTTTCGACATGGATGGCAAAGTAAGAAAGCCGAAATTTGAACTTGATAGTGAACAGGTTCGATATGAGCACAGGTTTGCACCATTCAACAGCGTGATCACACCACCACCAGTGCATTACTTGCAGTTCAAGGTTTGTTTCTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAACGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTTAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTGAGAGAGGTTTTTCTTTCTCAAGTATTTACCACCTTGTCATTCAGTAATCGGAAGTGTTGGGGGGATAGATTCTTTACTGAAATGGGAAGTTATAGTCCTATAAAAAAAAAAAAAAAAA
  3   1   4      seed Sto1 5g3  in                         CABG4510.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TCACACCACCACCAGTGCATTACTTGCAGTTCAAGGTTTGTTTCTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAACGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTTAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTGTTTGAATATTTGTGTGTTAAGATTTTTTTTGGGAAAAAAGTATTAAACATTGAC
  3   1   3        nb Kid1 5g3  in                        CABA10425.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTATTCTTTAGCAAAAGTATGATCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAGCGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTAAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATGTGTAGAAAATTG
  5   1   3   10   nb Kid1 5g3  in                        CABA10425.5p ....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CTATTCTTTAGCAAAAGTATGCTCCTTTCATAATGTCAGCCCTGTCTGCACTACATGGAATAAAGTAGGACTGACTATTGGTCACATATGAGACTTTCAGCGTTGTTTTGTGCTCCCATAGAGATGAACAGGTAGACGTCTGGTGTACAACTGATTCAGCACCATAAATGAGGCATTTTGGGGGAACAAGAGCAATATGCCAGGATGTCCGTATATCAAAATCCTACCAGTATTCTTTTAAGGGCTCTATTCTGTTAAGTAATTAGACTTGATAGTGCTCTCAGTAAATGAATATTTGTGTCAAGTAACTGGCAGTAAATTCTTATAATTATTCATCTTTCCACTATAAAATAACAGGAAATGTCAGATCTGAACAAGTACAGTCCTCCGCCTCAGTCTTCAGACCTGTACTTGGCTGCTAGCAAACATTTCCAACAAGCAAGGATGATTCTAGAAAGCATTTCCAGCCAGGATCAGGAGGTTAATGAGATACTGAAGGTTGCTAAGAACAATATTGTTGTCATGAAATTGCTTGCTGGTGGTCACAAAAAAGACTCTAAGATTCCGCCCGACTTTGACTTTTCTGCACACAAGTATTTCCCTGCTGTCAAACTGGTATAAAGTCTTTTCATTCAACCCCCTACATGCAGTGTTCCGTATGCACCAACAATAGAGCAACGTATCCAAATTCAGCCGGTTCGTCAGTTTTGTACAGCCCATTGTGTAGAAAATTG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)