Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABK4161.3                            6 END     2           7       33                (no blast hit)

 This cluster: approximate FL confidence score = 97%

 1012079984 Xt7.1-XZG30954.3 - 28 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZG30954.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228450                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAAxxAAAAAAAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10     9    10     9    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    12    12    12    13    12    13    12    13    12    13    12    13    11    13    12    14    12    14    11    13    11    13    11    13    11    13    10    12    10    12    10    11    10    11    10    11     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8     6     7     6     7     6     7     7     9     7    10     8    11     8    11     7    11     7    11     7    11     9    11     7    11     7    10     7    10     8    11     7    10     7    10     7    10     7    10     6    10     9    11     7    11     8    12     8    11     8    11     8    11     9    11     9    11    10    12    10    13    12    15    12    15    12    15    12    15    12    15    11    14    10    14    10    13    10    13    10    13    10    13    14    14    14    14    14    14    13    14    14    14    14    14    13    14    13    14    13    14    14    14    14    14    13    14    14    14    12    14    14    14    14    14    12    14    14    14    13    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    11    13    12    13    12    13    11    12     3     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     C-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ------G-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 -A----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ----------A-
                                               BLH ATG     130    1423                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     109     204                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR     130     839                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               EST CLI     -12       7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG     130      38                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bb ---- 2e-010     BAA96552.1 muscle LIM protein [Branchiostoma belcheri] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Cs ---- 2e-010     BAB68342.1 Cs-LHX3 [Ciona savignyi] --------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sc ---- 1e-010     NP_010041.1 Expressed most highly in sporulating cells; may also play a role during mating;Lrg1p [Saccharomyces cerevisiae] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ---- 3e-076     BAE06429.1 Ci-Fhl1/2/3 [Ciona intestinalis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 2e-079     XP_784011.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bf ---- 1e-093     AAC69756.1 LIM-domain protein [Branchiostoma floridae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 2e-099     NP_730213.1 CG32171-PC [Drosophila melanogaster] -------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                        PROTEIN --- Ce ---- 2e-102     NP_001021410.1 Temporarily Assigned Gene name family member (tag-15) [Caenorhabditis elegans] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Dr ==== 6e-130     NP_956307.1 Unknown (protein for MGC:63514); wu:fb09g09 [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Mm ==== 1e-137     NP_034343.1 four and a half LIM domains 3 [Mus musculus] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Hs ==== 1e-138     NP_004459.2 four and a half LIM domains 3 [Homo sapiens] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PREDICTED = Gg ==== 6e-165     XP_417754.1 PREDICTED: similar to four and a half LIM domains 3 [Gallus gallus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xl ==== 0          AAH73254.1 MGC80605 protein [Xenopus laevis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === ?? ==== 0          NP_001085725.1 MGC80605 protein [Xenopus laevis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN === Xt ==== 0          AAH82347.1 Fhl3-prov protein [Xenopus tropicalis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZG30954.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGA------------------------------------------------------------------------TAA---------------------ATG------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------ATG------------------TAA---------------TAA------ATG------------------------------------TGA------------------------------------------------------------TAG---TAG------------------------------------------TGA------------------------TAA---------------------------TGA------------TGA---------ATG---------------------------------------------------------------ATG---------------------------ATG------------ATGTAA---------------TAA---------------------------------------TAG---------------ATG------------------------------TGA---------------------------------TGA---------------TAG------------------------------------------------------------------------------------------------------------------------TGAATGTGA------------------------------------------------------------ATG------------------------------------------------------------------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           BrSp FL                   EC2BBA18DB04.FL-Pollet                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGAGTTAGTCATTTCCTCTGTGAGTAAGTGATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTTCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACCTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAGCCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTTTTTGGAGTATCGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGTCCTATTGCTTTATGTAActgAAgtgctaaAataaaaAcaattatttagccc
  0   1   1           Neu  FL                     TNeu012k11.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAAAAAAAAAAAAAAAAAAAAA
  5   1   1           Gas1 FL                     IMAGE:6986205.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld BrSp FL   in                     EC2BBA18DB04.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGGGAGTTAGTCATTTCCTCTGTGAGTAAGTGATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTTCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACCTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAGCCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTA
  5   1   2       bld Gas1 FL                            IMAGE:6986205                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AATTCCAAGGGATATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCGATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTATCTCCACTCTGCACACACTGCAAAAAGTCTCTTACAAAGGAGGGGTTACTATCGAGATGAACATGGCACAAGGATGTTTTGTCTGCCCCGGATGTAAAACCCGCTGGGTGGGACCGTTCACTTCCCGGTGAAAAGCCTACGCA
  5   1   2   12  bld Gas7 5g3  in                         XZG30954.5p ..................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................GTAAGTGATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAG
  5   1   2       bld TbA  5g3  in                   TTbA034c24.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AAGTGATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGG
  5   1   2       bld Neu  FL                        TNeu012k11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATCGGTACTGTACTGTGTGTCAGCCAGCGCTGAGCGTGCTTCTCTGCATCTCATCTGCTTCACTGCTGCCTGCATTCCTGCATCTGCCTTTTGGAACTCAAGAAATAAAAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCAC
  5   1   2       bld Te5       in                         CAAO5314.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCGCAGAAACAGAGCCAGGCTCTCCCTGGAGAAGACATGAGTGAACCATTTGATTGTGATAGCTGTAAGGAGTCCTTGTACGGACGCAAGTATATCCAGATGGAAGAGGGTCCTTACTGTATTCCTTGCTATGATTCCCTTTTTGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACCTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAGCCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGNGGAAGGGTTTTATCCCAGACNATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTA
  5   1   2       bld Tbd1      in                        CBXT20913.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCAAACACTTGTGATGAATGTAAAGAACTTATTGGCCACGACTGTCGGGAGTTGTATTACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACCTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCT
  5   1   2       bld Sto1      in                         CABG6572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACGAAGACCGCCATTACCATGAGCACTGCTTTCGATGCTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATTCGTTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTA
  5   1   2       bld Tad5      in                         XZT31588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CTTTCGTTGTGACCATTCTCTGGCAGATGAGCCTTTCACATGCCAGGATGAGGAACTCTTATGTAATGACTGTTACTGCAATGAATTCTCCTCCAAGTGCATTAGTTGTGAGAAAACCGTCATGCCAGGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGNCAGATGGTAAAAAAAATGTATTTCCTATATAACAGGC
  5   1   2       bld Spl1      out                        CABK4161.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGAATGAAGATGGACGCCACTGGAATGCATGTTTGTGATCCCGCAAGTTAGAATACAATGGGCAGACGTGGCATGAACACTGTTTTATTTGCAACAGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCCTTCCTGNGTTTTTTTTTATTTGATTGATTGCACTTTGAAAGCAAGCAATG
  5   1   2       bld Spl2      in                        CBSS9147.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCGCGTCCGGCTGCCAGCAACCAATTGGATCTCGTTCTTTCATCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTACATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGC
  3   1   2       bld BrSp FL   in                     EC2BBA18DB04.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCCCAGAGAATCAAAACCATTACTGCATTCCTTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGTTACTTATCGAGATGAGCCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTTTTTGGAGTATCGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTG
  5  -1   2       bld Spl1      out                        CABK8289.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATANCTGCATTCCTGTTATGAGAGCAAGCTAGCTCCACGCTGCACACACTGCAAAAAGTCTCTTACCAAAGGAGGGGGTTACTTATCGAGATGAGCCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTTTTTGGAGTATCGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGTCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAAAAACGAATCGATG
  3   1   2       bld Sto1      in                         CABG6572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GGGTTACTTATCGAGATGAACCATGGCACAAGGAATGTTTTGTCTGCACCGGATGTAAAACCCAGCTGGCTGGGCAGCAGTTCACTTCCCAGGATGAAAAGCCATACTGCATAAAATGCTTTGGGAACCTCTATGCCAAGAAATGTGCAGGGTGTACTAAACCTATAACAGGTTTCGGAGGAGCTAAATACGTCTCCTTCGAAGAGAGACACTGGCATCACAGCTGCTTCAATTGTTCCCGTTGCTCTACTTCTCTGGTGGGGAAGGGTTTTATCCCAGACAATGAGGACATTCTTTGCCGTGCATGTAACAGTGATTTATAATCTAATAGAGCCTGCTGCCAAGGTGTGTCATTTCTCTGCCAGAGGCCTGCAGCCCTTTGTGGAGCAATGTGTTACAGGCTTCTTGTGTAACAAACTGCAAGATGGTAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAA
  3   1   2       bld Tad5      in                         XZT31588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTAAAAAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCGNTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATC
  5   1   2       bld Tad5      in                         XZT28487.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTAT
  3   1   2       bld Te5       in                         CAAO5314.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAAAATGTATTTCCTATATAACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTTTTTGGAGTATCGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGTCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGGTTTCACCCACATCTATGGATGACAATGTTGTATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCAACAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTATTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAATT
  3   1   2      seed Gas7 5g3  in                         XZG30954.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TATATAACAGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATC
  3   1   2       bld Tbd1      in                        CBXT20913.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ACAGGCTTTTAGAATTTGCACGGTGATCTTTATATCCGTTTTTATGGCTTTGCACTCCAGTAATATGTGTGTCTGTTGACTGGAGCTAGTGGTAGTTTGTCTTTGTTTTTGGAGTAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGAGTTCACCCACATCTATGGATGACAATGTTGTATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCAACAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTTGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS9147.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGCAACGGGTGGTTATGCTGCTGAGTGACCACCTGAAAAATACTTTGTAATTTAATTTCCTTCCTTGTGTTTTTTTTTATTTTGATTGATTGCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGTTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATC
  3   1   2       bld TbA  5g3  in                    TTbA034c24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTTTTTATTTTGATTGATGCGACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTGTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGGGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTTTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGGTGCACATTTCACATCCCTGCTCTAGAAAGGGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATGGGAGGGTTCTCTATATATACCTGGGAATGGGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGGGGTTCATTACAAATGTTTTAGGTATTATTTGGTAGGCTTCAGTGCCACTAGGGGATGGTATACACCCCTGCAATGGGTCTCATCGGAAATATTTTCTCCTCTTAAATAAAGGACTCCCTTATCAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Tad5                                 XZT22010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCACTTTGAAAGCAAGCAATGTTAAGAGTTAGGAATGGGAAGTCTCTGGCACCATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATC
  3   1   2       bld Tad5      in                         XZT28487.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATTGAAAATAAGCCTAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATCCCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTTTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGAGGGCTGCCCATTTCACATCCCTGCTTTAGAAAGTGCAGAGTCAAAGAAGTAACATCCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGGGAATGTGACATATTTTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATTTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTTTC
  5   1   2       bld Neu                            TNeu120p12.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TAGAATGGTGCATAGCAATGCTAAGTTATACTGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTT
  3   1   2       bld Gas7      in                         XZG64160.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCACGCGTCCGGTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATC
  5   1   2       bld Neu                            TNeu144h24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCCGGGGGATTCCCCGTTATGTGTCCTATTGCTTTATATAACTCAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTATGTTTCACCCACATCTATGGATGACAATGTTGTATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTGGTTCTCAACAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTATTTTAAGTTCTCTCAAAGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTATTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTGTTATGTATTATTTTGTATGCTTCATTGCCACTAGGGGATTGTATACACCCCTGCAATTGGGCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAATT
  5   1   2       bld Gas7      in                         XZG64160.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTTTCCAGGCACAATATGCCCTATTGCTTTATGTAACTGAAGTGCTATAATTAAAAAACAAATCTTGAGCTAAAATGCCATGCTATTTGTTATTAGATTTCACCCACATCTATGGATGACAATGTTGTATATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCATCAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTCTTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAATTAAAAAAAAAAAAAAAGG
  5   1   2       bld Eye       out                         CCAX917.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGTTGTATACCTTCAATATATGATTTCAGAAAACAATTTCATTCACTTCTGATTTCTGAGAATGCTGGGAGCTGTAGTTCTCAACAAATAGATGGCTGCACATTTCACATCCCTGCTCTAGAAAGTGCAGAGTCAAAGAAGTAACATGCCTTAGTTTAGGTTCTCTCAAGGATTGGAAGCTTCTCTATATATACCTGTGAATGTGACATATTATTTTATATATAGGCAGTATAGTATTAAGCCCAGGTGTTCATTACAAATGTTTTATGTATTATTTTGTATGCTTCAGTGCCACTAGGGGATTGTATACACCCCTGCAATTGGTCTCATCTGAAATATTTTCTCCTCTTAAATAAATGACTCCCTTTATCAATTAGAGACCCTTGCATTTATTATACTGGATTATGGCGTTATTTTTACATAATCTCATTTTATCAAAACATTTTCAGGTTGCACACTAGAGGAGAACTCACTATTCACTTGGATAGCATTTTATCACCTTTGCTAAATATGCATCTAAAATCCTACAAGAGTGAATAGAGAATTGTGAAATTCCTCTCTGACAAACTGGTAATCTTTTGTAATTAATATACCCTTTTGTCCATGCATCTAATCTGCTAATAGACACCTTCAAACCAGCCCTGGGTGGGGGGTATGATACAGAGAAGTATAATTTAAGTTTTTGACCAGTTGTTTGCCTAGTATCATTGGCCACATACTGCCCCCCA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)