Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTbA049d15.5                          6 END     2          11       40                Unknown (protein for MGC:121714) [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZT26563.5                            2 END     2          11      100                (no blast hit)

 This cluster: approximate FL confidence score = 0%

 1012080071 Xt7.1-CABE9629.3 - 18 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABE9629.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGTTTTTACCTACCACCTCTGTGCATTCAGGCAAAAGAAAAGCTTATTCTGCCTTAGGCAATGAGAGCTCTGATATTAAGCCAAACCCCTTAGTTCAAAGGCAGCTTACTAACAAAGAAGCTACATGCGAAAGTGGCTTTAAAACAGCAAAAGAGCAGTTGTGGGTTGATCAGCAGAAGAAATACAGTAATCAACCTCAACGTAATCCAAGTCCTCTGTATGGTGGTGCCAAAAAGTCATTGGGAGCTGCTCGTTCTCGTGGTCTTCATGGAAAATTTGTTCCTCCAGTTCCTAGGCAGGAGGATGTCCAGGATAGCAACAGGAAAGTATATGGCCAGGGCAACAGTGAGATGAATGCACCTTCTGATGAACGTTTAAAAAACATAGAGCCAAAGATGATCGAACTGATAATGAGTGAGATAATGGATCACGGGCCTCCGCTGAACTGGGATGACATTGCTGGCCTCGAGTTTGCTAAAACAACTATCAAGGAAATAGTGGTGTGGCCAATGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGACT
                                                  Xt7.1-CHK-1008231388                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TTTACCTACCACCTCTGTGCATTCAGGCAAAAGAAAAGCTTATTCTGCCTTAGGCAATGAGAGCTCTGATATTAAGCCAAACCCCTTAGTTCAAAGGCAGCTTACTAACAAAGAAGCTACATGCGAAAGTGGCTTTAAAACAGCAAAAGAGCAGTTGTGGGTTGATCAGCAGAAGAAATACAGTAATCAACCTCAACGTAATCCAAGTCCTCTGTATGGTGGTGCCAAAAAGTCATTGGGAGCTGCTCGTTCTCGTGGTCTTCATGGAAAATTTGTTCCTCCAGTTCCTAGGCAGGAGGATGTCCAGGATAGCAACAGGAAAGTATATGGCCAGGGCAACAGTGAGATGAATGCACCTTCTGATGAACGTTTAAAAAACATAGAGCCAAAGATGATCGAACTGATAATGAGTGAGATAATGGATCACGGGCCTCCGCTGAACTGGGATGACATTGCTGGCCTCGAGTTTGCTAAAACAACTATCAAGGAAATAGTGGTGTGGCCAATGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     8     8     8     8     8     8     9     9    10    10    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    11    11    11    11    11    11    11    11    11    12    12    11    12    13    13    12    12    10    12    12    12    10    12    12    12    12    12    10    12     9    12    10    12    12    12    11    12     9    12    10    11    10    11    11    11    10    11     8    10     9    10    12    12    11    12    11    12    10    12    10    12    11    12    12    12    11    12    12    12     9    12    10    12    10    12    10    12     9    12    10    12    10    12    10    12    10    12    10    12    10    12    10    11     9    10     8    10
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ------C-----
                                                                       ...PREDICTED - Sc ---- 9e-078     NP_010966.1 Putative ATPase of the AAA family, interacts with the Sin1p transcriptional repressor in the two-hybrid system [Saccharomyces cerevisiae] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Dm ---- 6e-092     NP_608763.2 CG3326-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Ce ---- 7e-100     NP_504197.1 fidgetin-like 1 (66.1 kD) (5E820) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED - Sp ---- 2e-140     XP_783737.2 PREDICTED: similar to fidgetin-like 1 [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                   PREDICTED - Dr ---- 1e-163     XP_698026.1 PREDICTED: similar to Fignl1-prov protein [Danio rerio] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 5e-169     NP_068691.2 fidgetin-like 1 [Mus musculus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PREDICTED - Gg ---- 7e-179     XP_001234039.1 PREDICTED: fidgetin-like 1 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Hs ---- 0          NP_071399.2 fidgetin-like 1 [Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- Xl ---- 0          AAH77410.1 Fignl1-prov protein [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                           PROTEIN --- ?? ---- 0          NP_001086763.1 fidgetin-like 1 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Xt ---- 0          AAI35672.1 Unknown (protein for MGC:121714) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABE9629.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------------ATG---------ATG------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG---------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------TAG------------------TAA---------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ]
  5   1   2       bld Gas7      in                         XZG19386.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAAATTGGCCTGAATAACTATGCAGACAGCATTTTAACTTTGGCAAAATGTCAGAGAAATGAAAGTGACAAGTGGCAGTCTTCCTTGACAACTAATAATGTTTTAAAATTAAAGAGTGTGCAAGACATGGCAGTGGCAGGAAGAAGAACCCAGTTGTCTAAGAGCTCAGCAGATGCCTCAGTGAGAGTTGGTAATGGGATAAATACATCAGGATATTCTGCAGGTCTTGGTAATAATGTCCTTAGAAACTCAGGGTATACAGTTCCTCATGCTGCTTTATCAGATTGTCAAATGCCAGGGGGAAGCGCAAACTTTCTCCAAAAACCCAAGATTTCAGCATTTACTATAGCCAATACTACTTCTGTTGCAAACACCTCTTCCAACACTTTGATTAACAACAGTATTTCTATGACTTCTTCCCTGATGCAAAGCAATGAAGACAAAGATCCAGCATCATTCTCTGGCCACATGTTTTTACCTACCACCTCTGTGCATTCAGGCAAAAGAAAAGCTTATTCTGCCTTAGGCAATGAGAGCTCTGATATTAAGCCAAACCCCTTAGTTCAAAGGCAGCTTACTAACAAAGAAGCTACATGCGAAAGTGGCTTTAAACAGCAAAAG
  5   1   2       bld Ova1      in                         CABE9629.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATGTTTTTACCTACCACCTCTGTGCATTCAGGCAAAAGAAAAGCTTATTCTGCCTTAGGCAATGAGAGCTCTGATATTAAGCCAAACCCCTTAGTTCAAAGGCAGCTTACTAACAAAGAAGCTACATGCGAAAGTGGCTTTAAAACAGCAAAAGAGCAGTTGTGGGTTGATCAGCAGAAGAAATACAGTAATCAACCTCAACGTAATCCAAGTCCTCTGTATGGTGGTGCCAAAAAGTCATTGGGAGCTGCTCGTTCTCGTGGTCTTCATGGAAAATTTGTTCCTCCAGTTCCTAGGCAGGAGGATGTCCAGGATAGCAACAGGAAAGTATATGGCCAGGGCAACAGTGAGATGAATGCACCTTCTGATGAACGTTTAAAAAACATAGAGCCAAAGATGATCGAACTGATAATGAGTGAGATAATGGATCACGGGCCTCCGCTGAACTGGGATGACATTGCTGGCCTCGAGTTTGCTAAAACAACTATCAAGGAAATAGTGGTGTGGCCAATGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCANAACTGAGTTNTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACT
  5   1   2       bld Gas7                                 XZG24191.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTTATTCTGCCTTAGGCAATGAGAGCTCTGATATTAAGCCAAACCCCTTAGTTCAAAGGCAGCTTACTAACAAAGAAGCTACATGCGAGAGTGGCTTTAAAACAGCAAAAGAGCAGTTGTGGGTTGATCAGCAGAAGAAATACAGTAATCAACCTCAACGTAATCCAAGTCCTCTGTATGGTGGTGCCAAAAAGTCATTGGGAGCTGCTCGTTCTCGTGGTCTTCATGGAAAATTTGTTCCTCCAGTTCCTAGGCAGGAGGATGTCCAGGATAGCAACAGGAAAGTATATGGCCAGGGCAACAGTGAGATGAATGCACCTTCTGATGAACGTTTAAAAAACATAGAGCCAAAGATGATCGAACTGATAATGAGTGAGATAATGGATCACGGGCCTCCACTGAACTGGGATGACATTGCTGGCCTCGAGTTTGCTAAAACAACTATCAAGGAAATAGTGGTGTGGCCAATGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGCAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCTGTGATATTCATTGATGAAATAAATTCCCTTTTATCC
  5   1   2       bld Gas7      in                         XZG40036.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTGATATTAAGCCAAACCCCTTAGTTCAAAGGCAGCTTACTAACAAAGAAGCTACATGCGAAAGTGGCTTTAAAACAGCAAAAGAGCAGTTGTGGGTTGATCAGCAGAAGAAATACAGTAATCAACCTCAACGTAATCCAAGTCCTCTGTATGGTGGTGCCAAAAAGTCATTGGGAGCTGCTCGTTCTCGTGGTCTTCATGGAAAATTTGTTCCTCCAGTTCCTAGGCAGGAGGATGTCCAGGATAGCAACAGGAAAGTATATGGCCAGGGCAACAGTGAGATGAATGCACCTTCTGATGAACGTTTAAAAAACATAGAGCCAAAGATGATCGAACTGATAATGAGTGAGATAATGGATCACGGGCCTCCGCTGAACTGGGATGACATTGCTGGCCTCGAGTTTGCTAAAACAACTATCAAGGAAATAGTGGTGTGGCCAATGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTA
  5   1   2       bld Gas7                                 XZG41246.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGTGAGATGAATGCACCTTCTGATGAACGTTTAAAAAACATAGAGCCAAAGATGATCGAACTGATAATGAGTGAGATAATGGATCACGGGCCTCCGCTGAACTGGGATGACATTGCTGGCCTCGAGTTTGCTAAAACAACTATCAAGGAAATAGTGGTGTGGCCAATGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCT
  5   1   2       bld Tail      in                         CBSW4378.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTGAGATGAATGCACCTTCTGATGAACGTTTAAAAAACATAGAGCCAAAGATGATCGAACTGATAATGAGTGAGATAATGGATCACGGGCCTCCGCTGAACTGGGATGACATTGCTGGCCTCGAGTTTGCTAAAACAACTATCAAGGAAATAGTGGTGTGGCCAATGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGG
  3   1   2      seed Ova1      in                         CABE9629.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCTCAGGCCAGATATTTTTACTGGCTTGCGGGGACCCCCTAAAGGAATCCTACTTTTTGGTCCACCAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGACTTC
  3   1   2       bld TbA  5g3  out                   TTbA049d15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CAGGGACAGGGAAAACTCTGATAGGTAAGTGTATTGCTTGCCAGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTTTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCTTTTTCCTGAAGCATTTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTTTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTTTCAGGTGCAGATATGATTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCCCAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTTTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTTTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGACTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGC
  3   1   2       bld Gas7      in                         XZG40036.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTCCGGTGCCACATTTTTTAGCATAAGTGCATCATCTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGACTTCAAAAAAAAAAAAAAGCTAATAAAAAAAAACATAAAG
  3   1   2       bld Tail      in                         CBSW4378.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTTTGACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGACTTCAAAAAAAAAAAAAAA
  3   1   2       bld Tail                                CBSW12058.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACATCCAAATGGGTTGGAGAAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCTTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCTCTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAACAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGTTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGT
  3   1   2       bld Tad5      out                        XZT26563.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 AAGGTGAAAAAATGGTTCGAGCCCTCTTTACAGTGGCAAGGTGTCACCAGCCAGCCGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGATGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCCCAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGCCTTC
  3   1   2       bld Gas7 5g3  out                        XZG31202.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGAAAAAATGGTTCGAGCCCTCTTTCCAGTGGCAAGGTGTCACCAGCCAGCTGTGATATTCATTGATGAAATAGATTCTCTTTTATCCCAGCGTGGTGAAGGGGAGCATGAGTCATCAAGGAGGATCAAAACTGAGTTTTTAGTTCAGCTTGATGGTGCTACAACATCTTCAGATGATCGCATACTAGTTGTTGGTGCTACTAACCGTCCCCAAGAAATTGACGAGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCACTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGGTTTCTCAGGTGCAGATATGACTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATCCAGCTTATGGATATTTCCCCAATAACCCCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCCCAAAAAGATTTGGAATTATATGAGAACTGGACCAAACCATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCGGCCTTC
  3   1   2       bld HdA       out                   THdA039c22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGTTTTTTGTTCAGTTTGGGGGGGGTGCACCATTTTCAGTTGATGGCATACTAGTTGTGGGGGGTACTACCCGTCCCCAAGAAATTAATGGGGCGGCTCGCCGAGGGCTTGTTAAAAGAATTTATTTTCTTTTTCTTGAGGCTTTGCCAGGGAAGCAAATCGTTTTCTGCTTAATGGAAAAAGAGCAGTGCATTTTTGTGGAACAAGAGGTGGGGGCCATGTTTTTGCGGGGGGGGGGTTTTTCTGGTGCGGATATGATTCAGTTTTGCGGGGAAGGGGCACTGGGTCTTTTCCGAAGTATACAGTTTAGGGTTTTTTCCCCAATAACCCCTGACCAGGTTCGCCTTTTTGCTTTTTTTGATTTCCAAAGGGTTTTTTTGTTGGGGGGGCCTGGTTTTTCACAAAAAGATTGGGATTTATTTGGGAAGGGGACCAAAACATTTGGTTGGGGCGGGGAGTTATATTTGATGGGAAAAAAAAGAAGAGTTTTTCTTAAAATAGTTTTGTGAAAAATAAAGATTTAAGTTAGGGGGACTTCaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGC
  3   1   2       bld Egg                             TEgg031a11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTCAGATGATCGCATATTAGTTGTTGGTGCTACTACCCGTCCCCAAGAAATTGATGGGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATATTCCTCTTCCTGAAGCATCTGCAAGGAAGCAAATCGTTGTCAGCTTAATGGCAAAAGAGCATTGCAGTCTCGCAGAACAAGAGGTAGAGGCCATAGTTTTGCAGGCTGATGTTTTTTCAGGTGCAGATATGATTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCCCAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTTTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGCCTTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Gas7      in                         XZG19386.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CGCATACTAGTTGTTGGGGCTACTAACCGTCCCCAAGAAATTGATGGGGCAGCTCGCAGAAGGCTTGTTAAAAGACTCTATTTTCCTCTTCCTGAGGCTTCTGCAAGGAAGCAAATCGTTGTCAGCCTAATGGCAAAAGAGCCCTGCAGTTTCGCAGAACAAGGGGTGGGGGCCATAGTTTTGCAGGCTGATGGTTTTTCAGGGGCAGATATGACTCAGCTTTGCCGGGAAGCTGCCCTTGGTCCTTTACGAAGTATCCAGCTTTTGGATTTTTCCCCAATACCCCCTGAACAAGTTCGCCCTTTTGCCTATATTGATTTCCAAAGGGCTTTTCTGGTAGGGCGGCCTAGTGTTTCCCAAAAAGTTTTGGATTTTTTTGGGAACGGGACCAAACCATTTGGTTGTGGCGGGTAGTTATTTGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGGGATAAAATAAAGATTT
  5   1   2       bld Tbd1      in                        CBXT20919.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGACTTCAAAAAAAAAAAAAAA
  3   1   2       bld Tbd1      in                        CBXT20919.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CTCAGCTTTGCCGGGAAGCTGCACTTGGTCCTATACGAAGTATACAGCTTATGGATATTTCCACAATAACACCTGAACAAGTTCGCCCTATTGCCTATATTGATTTCCAAAGTGCTTTTCTGGTAGTGCGGCCTAGTGTTTCACAAAAAGATTTGGAATTATATGAGAACTGGAACAAAACATTTGGTTGTGGCAGGTAGTTATATGTGCTGTGGAAAAGAAAGCTGCTGTTCTCCTAGAATTGTTTTGTGATAAAATAAAGATTTAAGATTAGCTGACTTCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)