Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TGas098f04.3                         10 END     1           7       10                (no blast hit)
     2   2.0    0Xt7.1-XZT56899.3                            3 END     1           7       33                (no blast hit)

 This cluster: approximate FL confidence score = 94%

 1012080116 Xt7.1-TGas115i18.3 - 13 ESTs
                                                                       ......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TGas115i18.3       ATGGCGACGCGCGCCTGCGCATGAAGCAGTTACGCGGGTTGGTTCTTTGCTGGAAGCGGAGAGTAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATACACAATTTGTTTTTTTTTACCT
                                                  Xt7.1-CHK-1008233526             ACGCGCGCCTGCGCATGAAGCAGTTACGCGGGTTGGTTCTTTGCTGGAAGCGGAGAGTAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATACACAATTTGTTTTTTTTTACCTTTACAG
                                                      consensus depths            3     3     4     4     4     4     5     5     5     5     5     5     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     9     9    10    10    10    10    10    10    10    10    10    10     9    10     9    10     9    10    10    11    10    11    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    12    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     6     6     6     6     6     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     5     5     3     4     3     3
                                               BLH ATG     249     355       
                                               BLH MIN     249      46       
                                               BLH MPR     174      46       
                                               BLH OVR     249     600       
                                               CDS MIN     249      46       
                                               ORF LNG     249      12       
                                                                                                                                                                                                                                                           PROTEIN --- Dm ---- 5e-008     NP_650989.2 Chibby CG13415-PA [Drosophila melanogaster] ======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 3e-031     XP_001196817.1 PREDICTED: similar to leucine-rich protein [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PREDICTED = Mm ==== 2e-047     NP_082910.1 RIKEN cDNA 1110014P06 [Mus musculus] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN === Hs ==== 3e-048     NP_056188.1 chibby; cytosolic leucine-rich protein; ARPP-binding protein [Homo sapiens] ================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PREDICTED = Dr ==== 2e-048     XP_695170.1 PREDICTED: similar to leucine-rich protein [Danio rerio] ===================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PREDICTED = Gg ==== 9e-050     XP_001234193.1 PREDICTED: similar to leucine-rich protein [Gallus gallus] ==============================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN === Xl ==== 8e-063     AAM73680.1 leucine-rich protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PROTEIN === ?? ==== 8e-063     NP_001082262.1 leucine-rich protein [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                      PREDICTED = Xt ==== 4e-066     NP_001016253.1 hypothetical protein LOC549007 [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TGas115i18.3       ATG------------------TGA---------------------------------------TAG---TAG---TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------ATG------ATG------------------------TAA---------------------TGA---------TGA---------------TGA---------------------------TGA------------------------------------TAA---------------------------------------------------------------------------------------------------------------TAG------TAA------ATG---------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                [ open reading frame                                                                                                                                                                                                                                                                                                                                                                  ]
  0   1   1           Gas  FL                     TGas115i18.FL-Sanger                                                                      TAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATACACAATTTGTTTTTTTTTAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld Gas  5g3  out                  TGas098f04.p1kSP6 GTTGCTATGGCGACGCGCGCCTGCGCATGAAGCAGTTACGCGGGTTGGTTCTTTGCTGGAAGCGGAGAGTAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACGACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGA
  3   1   2       bld Te5       in                         CAAO4553.3p       ATGGCGACGCGCGCCTGCGCATGAAGCAGTTACGCGGGTTGGTTCTTTGCTGGAAGCGGAGAGTAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCT
  5   1   2       bld Te5       in                         CAAO4553.5p       ATGGCGACGCGCGCCTGCGCATGAAGCAGTTACGCGGGTTGGTTCTTTGCTGGAAGCGGAGAGTAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 PIPE in                         XZG29949.5p ........GGCGACGCGCGCCTGCGCATGAAGCAGTTACGCGGGTTGGTTCTTTGCTGGAAGCGGAGAGTAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAA
  5   1   2       bld Gas  5g                        TGas027a09.p1kSP6                                  AGTTACGCGGGTTGGTTCTTTGCTGGAAGCGGAGAGTAGACATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAA
  5   1   2       bld Gas  FL   in                   TGas115i18.p1kSP6                                                                        AGAATAGCAGTAGGAGTTCGTTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGC
  5   1   2       bld Te5                                  CAAO5257.5p                                                                                            TTCAGCGGTTTGCAGTGGCAAAATACAGTATCATACCTGGTGACTTTGCATTGAAGGCAAGAGAAGAAAATACCACAAAAAAAGATAAGAAATACCACAACTGGTCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGAC
  3   1   2       bld Gas  FL   in                    TGas115i18.q1kT7                                                                                                                                                                                                    TCCATAACCCAAGGATTGTACAGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATANCACCAATTTGTTTTTTTTAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   30 seed Te1  5x3                              CBWN876.b1 ........................................................................................................................................................................................................................AGAGAACAAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATACACAA
  3   1   2       bld Gas7 PIPE in                         XZG29949.3p                                                                                                                                                                                                                                AAATCCTGGACACAACATTTTTTTCAGGCAAGATGCCCCTATTCGGGAACACATTCAGTCCCAAAAAAGTGCCACCAAGGAAATCGGCCTCCCTGTCTAATCTGCACGCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATACACAATTTGTTTTTTTTTACCTTAAAAATACAGAAATAAAAAAAAT
  5   1   2       bld Neu                            TNeu021l23.p1kSP6                                                                                                                                                                                                                                                                                                                                           GCGCTGGATCGGACAACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAACACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGG
  5   1   2       bld TbA       out                  TTbA035g08.p1kSP6                                                                                                                                                                                                                                                                                                                                                         AACTAAAGAAGTTGAATTGGGTTTAGATTATGGTTCCCCAAGTATCAACATTGCAGGCCAGAGCTTAAAATTTGAAAATGGACACTGGATCACTGAGTCAGGGGGCACTGGATCACAGAGGGAGGTTCAAAGGCTGCGCAAGCGTAACCAGCAGCTTGAAGAAGAAAACAACCTGTTGCGTATCAAAGTCGAACTCCTACTGGATATGCTCTCAGAAGCGGCAGCAGACTCCCACCTAAAGGAAAAAGAAATGGAGGAAATGAAAAATCTTACTGGCAGAAGGAAATAAATTATTGTGTTAGAGCTGGACTGACTGCAATATTGAGCAGGCACGTGGAGATGATTTACCGTTGATTTGAAAGATCATCAGTGATGTGCAGTGAGAAATACTTACCAAAAAGACCACTTCTAAAAGAGAAAGTCATATGACTTCTTTAATCTGCAAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATACACAANTTTGTTTTTTTTTACCTTTACAGTCTGTTATAATTTTTTATGATGCTTTATTTATATGATGACTACAAATTCCACATATTA
  5   1   2       bld Gas                            TGas038k17.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CTTCTTTAATCTGCAGGCTTCGTTTTTGTAGAGATTGTCCTGGAAAGTAAATCAGCTTTATATTATAAGAAGACGAATGGAAGGAGCAAGTCATAGCCCACATAAGCAGAAATGTCTTCCAATGTATCTTTTGTGGCTAACAGACAGGAAATTCAAACAGATGTGATCATAGGGCAATTTAGCATTCAATGGACTAAAGACTAATACACAATTTGTTTTTTTTTACCTTTACAGTCTGTTATAATTTTTTATGATGCTTTATTTATATGATGACTACAAATTCCACATATTACACACACGCTATAGTCTGTTTTATTTGAAACTGCTTAATGCTGTGCAGTATATAGAGCTGTGACTTGGGTGTGGTCATGGGGTAGCATGGGGTAGCAAAAAGTTAGTAGTACAAAAACCAGGAAAGACTATAAGTTACTCAGAACAGCGCACACTTTGCATACTGTGCGTAAAGTCATTGTCCAATAGAAAGTTACACATGGTCTAGATATGGTGTATGTTTCTGAACATACACCAGCGCTACAAAGGCAATAGCCAATATCCTGCAAATTTTACTTATTACTACACCAGGGCACTGTTTGTGCTCTGGTGTAGTTCATAAATAATGTATTTTAAGTATAAGCTTTGTATGTATTAACCCTTTTGGGTGCCAGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)