Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 23 Oct 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-XZT10934.5                           10 END     1           5       10                hypothetical protein 6820408C15 [Mus musculus]

 This cluster: approximate FL confidence score = 97%

 1012080147 Xt7.1-CAAP3251.3 - 18 ESTs
                                                                       -1160.....-1150.....-1140.....-1130.....-1120.....-1110.....-1100.....-1090.....-1080.....-1070.....-1060.....-1050.....-1040.....-1030.....-1020.....-1010.....-1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAP3251.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACATATTGATCTGTAGTGGAATAGAGACATCAGGGATAGACGCTGGGCTGGTTACACCAATAGGACACACAACCCAAAGATGTGCGCCTCACGAGCTCCCCTGAGGAGGCGGGCCAGCACCCCATTACCTTGTGCCCATCAGAACCGCCAGCGAGGAGCAACTCCCATAAGGAAGCTATACTCACCTTCTAAAGCTGCTGGGAGTGCCCACTGCAGTGGCTCCTTAGACTCAGGGGTCTCGGATGGGAGAAACGAGGCCCATTTAAGAGTGGTACTACTTGGAGACCCAGGGGTTGGAAAGTCCAGTCTTGTGGCCATCTTTCGAAGGGAGCAGGATAGAGAAGCAGCAGAACAGCAGCTAGAAGTGTTTGATTGCACCCTGATGGTGGACGGCAAGGAGACCACCCTGCTGGTCATGGATACGGATGAACGCAACATGAAGAAAGCCATCGAGAGCAGTGATAGCCCCATGCGCCTCGGCAACGCCTACATCATCGTGTACTCAGTCACTGATAGGGCCAGCTTTGAGAGCGCGTCAGAACTTCGAATACAGCTTAGAAGAACTCGTCAGGCTGAAAATATCCCAATAATCCTTGTTGGCAACAAGACGGACCTTGTCCGCAGCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCCTACAGCACAATGTCCAAGAATTGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGA
                                                  Xt7.1-CHK-1008231046                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGATCTGTAGTGGAATAGAGACATCAGGGATAGACGCTGGGCTGGTTACACCAATAGGACACACAACCCAAAGATGTGCGCCTCACGAGCTCCCCTGAGGAGGCGGGCCAGCACCCCATTACCTTGTGCCCATCAGAACCGCCAGCGAGGAGCAACTCCCATAAGGAAGCTATACTCACCTTCTAAAGCTGCTGGGAGTGCCCACTGCAGTGGCTCCTTAGACTCAGGGGTCTCGGATGGGAGAAACGAGGCCCATTTAAGAGTGGTACTACTTGGAGACCCAGGGGTTGGAAAGTCCAGTCTTGTGGCCATCTTTCGAAGGGAGCAGGATAGAGAAGCAGCAGAACAGCAGCTAGAAGTGTTTGATTGCACCCTGATGGTGGACGGCAAGGAGACCACCCTGCTGGTCATGGATACGGATGAACGCAACATGAAGAAAGCCATCGAGAGCAGTGATAGCCCCATGCGCCTCGGCAACGCCTACATCATCGTGTACTCAGTCACTGATAGGGCCAGCTTTGAGAGCGCGTCAGAACTTCGAATACAGCTTAGAAGAACTCGTCAGGCTGAAAATATCCCAATAATCCTTGTTGGCAACAAGACGGACCTTGTCCGCAGCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCCTACAGCACAATGTCCAAGAATTGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTC
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     5     4     5     4     5     6     7     6     7     6     7     4     7     6     9     5     9     8     9    10    11    11    11     9    11    10    12    11    12    11    12    10    12    11    12    10    12    11    11    12    12    11    11    11    11    11    11     9    11    10    10    10    10    10    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9    11    11    11    11    11    11    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    11    10    10    10    10    10    10     9    10     9    10    10    10    10    10    10    10     9    10     9    10     9    10    10    10     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9
                                               BLH ATG      79     161                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN      79      79                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH OVR      79    1091                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               ORF LNG      79      54                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Br ---- 6e-008     ABB85359.1 Ran [Branchiostoma belcheri tsingtaunese] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN --- Bb ---= 1e-008     BAE95627.1 GTP binding protein Rho [Branchiostoma belcheri] ========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Ci ==== 6e-020     BAC57522.1 ras-related protein RAP-1B homologue [Ciona intestinalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---= 5e-021     NP_497689.1 v-ral simian leukemia viral oncogene homolog like (3E405) [Caenorhabditiselegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Sc ==== 7e-022     NP_011668.1 Gtp-binding protein of the ras superfamily involved in bud site selection; Rsr1p[Saccharomyces cerevisiae] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Dm ---- 2e-026     NP_611411.1 CG9811-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PREDICTED - Sp ---- 2e-045     XP_785320.2 PREDICTED: similar to Rad and gem related GTP binding protein 1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Xl ---- 1e-065     AAH74340.1 MGC84175 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- ?? ---- 1e-065     NP_001086219.1 MGC84175 protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PREDICTED - Gg ---- 2e-067     XP_414151.1 PREDICTED: similar to Ras like G protein Rad [Gallus gallus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Hs ---- 6e-072     NP_054731.2 RAS-like GTP-binding protein REM [Homo sapiens] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Mm ---- 1e-073     NP_033073.1 RAS-like GTP binding protein Rem [Mus musculus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dr ---- 2e-078     NP_957468.1 rad and gem related GTP binding protein 1 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Xt ==== 2e-154     AAI35454.1 Unknown (protein for MGC:121535) [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAP3251.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TAG---------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------ATG------------------ATG------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------TGATAA---------------------------TGA------------------------TGA---ATG---------ATG---------------------------------TAG---------------------ATG---TGA------------TGA---------------------------TGA---------TGA------------------------TAA---------------------------------TGA------TGA------------------------------------------ATG---------------------------TGA---TGA------------------------------------------------------ATG------------TAA---------TGA---------------------------------------------------------------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           Tad5 FL                          XZT41476.FL-MGC                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACATATTGATCTGTAGTGGAATAGAGACATCAGGGATAGACGCTGGGCTGGTTACACCAATAGGACACACAACCCAAAGATGTGCGCCTCACGAGCTCCCCTGAGGAGGCGGGCCAGCACCCCATTACCTTGTGCCCATCAGAACCGCCAGCGAGGAGCAACTCCCATAAGGAAGCTATACTCACCTTCTAAAGCTGCTGGGAGTGCCCACTGCAGTGGCTCCTTAGACTCAGGGGTCTCGGATGGGAGAAACGAGGCCCATTTAAGAGTGGTACTACTTGGAGACCCAGGGGTTGGAAAGTCCAGTCTTGTGGCCATCTTTCGAAGGGAGCAGGATAGAGAAGCAGCAGAACAGCAGCTAGAAGTGTTTGATTGCACCCTGATGGTGGACGGCAAGGAGACCACCCTGCTGGTCATGGATACGGATGAACGCAACATGAAGAAAGCCATCGAGAGCAGTGATAGCCCCATGCGCCTCGGCAACGCCTACATCATCGTGTACTCAGTCACTGATAGGGCCAGCTTTGAGAGCGCGTCAGAACTTCGAATACAGCTTAGAAGAACTCGTCAGGCTGAAAATATCCCAATAATCCTTGTTGGCAACAAGACGGACCTTGTCCGCAGCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCCTACAGCACAATGTCCAAGAATTGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCTACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   0       add Ski1      in                         CABJ1494.5p CTCTCACTGACTTCCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCCGGGCCCCTCTCACTGACTCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCAGAGGGGTGTTTAGAGAACATACCTAGCTGCACAGGGGCCCTTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCAGAGGGGTTTTTAGAGAACATACCTAGCTGCACAGGGGCCCTTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATATCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGTCCCTCTCACTGACTCCCCAGAGGGGTGCTTACACACATGGAATTATTACTGGTGAGGGCTAAGCAGGGCTGGGGGGTTGATGGGCTCCTTTCTGTTTATAGGATGCAGGTTTGGGGTAGTTAGTGAGCCCAGTGGCAGTTTGCAGGGTGCACTATAAGTTATGGGCCGGGGAAACCTAAAGGGTAAATCCTGCCCTAAGAGGCGACACAGAGCGTGTAGCTGCCATACAGACGTCTCTGGGTGGGGGGAGTTTAACTTAGCTGA
  5   1   0       add Brn2      in                        CAAJ14321.5p                                                                     CTCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCAGAGGGGTGTTTAGAGAACATACCTAGCTGCACAGGGGCCCTTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCAGAGGGGTTTTTAGAGAACATACCTAGCTGCACAGGGGCCCTTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATATCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGCCCCTCTCACTGACTCCCCCAGAGGGGTGCTTAGAGAACATACCTAGCTGCCCAGGGGTCCCTCTCACTGACTCCCCAGAGGGGTGCTTACACACATGGAATTATTACTGGTGAGGGCTAAGCAGGGCTGGGGGGTTGATGGGCTCCTTTCTGTTTATAGGATGCAGGTTTGGGGCAGTTAGTGAGCCCAGTGGCAGTTTGCAGGGTGCACTATAAGTTATGGGCCGGGGAAACCTAAAGGGTAAATCCTGCCCTAAGAGGCGACACAGAGCGTGTAGCTGCCATACAGACGTCTCTGGGTGGGGGGAGTTTAACTTAGCTGAAGGAAATCATCCAGAGATATGTACAGACTGCTCCAGACAGGACCCAGAGAGAGATGCTTCTAGAGACTGCACCCAGAGAGACACTGCTGATAGCAAAGAGGCTGAACTAGAAACAACATACAGAAGAGACTGC
  5   1   2   30  bld Brn3 5g                              CAAK1855.5p ...................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGCTTACACACATGGAATTATTACTGGTGAGGGCTAAGCAGGGCTGGGGGGTTGATGGGCTCCTTTCTGTTTATAGGATGCAGGTTTGGGGTAGTTAGTGAGCCCAGTGGCAGTTTGCAGGGTGCACTATAAGTTATGGGCCGGGGAAACCTAAAGGGTAAATCCTGCCCTAAGAGGCGACACAGAGCGTGTAGCTGCCATACAGACGTCTCTGGGTGGGGGGAGTTTAACTTAGCTGAAGGAAATCATCCAGAGATATGTACAGACTGCTCCAGACAGGACCCAGAGAGAGATGCTTCTAGAGACTGCACCCAGAGAGACACTGCTGATAGCAAAGAGGCTGAACTAGAAACAACATACAGAAGAGACTGCTCCGGAGCCAGGTCACAGAAAGAGACAGAAAGATACTGAGCTGTAGATTGCATAGAAACTTTTGGTGAGACTGAACAATGCAAAAGACTGGTGGTAAGAGAACACAGAAATAGACTGCTGATGAGACAGAGCACAGCAAGGGACTACTTTAGAAACTGGATACAAAAAGAGACTTCTGAGAAAGGAGACAGCACGGTGCCACTGGTAAAAGAGGACACAGAAAAAGACCGCTGTTATGAGTGAGTGCACATATTGATCTGTAGTGGAATAGAGACATCAGGGATAGACGCTGGGCTGGTTACACCAATAGGACACACAACCCAAAGATGTGCGCCTCACGAGCTCCCCTGAGGAGGCGGGCCAGCACCCCATTACCTTGTGCCCATCAGAACCGCCAGCGAGNAGCAACTCCCATAAGGAAGCTATACTCACCTTCTAAAGCTGCTGGG
  5   1   2       bld In54 5g                         IMAGE:8943217.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGCACATATTGATCTGTAGTGGAATAGAGACATCAGGGATAGACGCTGGGCTGGTTACACCAATAGGACACACAACCCAAAGATGTGCGCCTCACGAGCTCCCCTGAGGAGGCGGGCCAGCACCCCATTACCTTGTGCCCATCAGAACCGCCAGCGAGGAGCAACTCCCATAAGGAAGCTATACTCACCTTCTAAAGCTGCTGGGAGTGCCCACTGCAGTGGCTCCTTAGACTCAGGGGTCTCGGATGGGAGAAACGAGGCCCATTTAAGAGTGGTACTACTTGGAGACCCAGGGGTTGGAAAGTCCAGTCTTGTGGCCATCTTTCGAAGGGAGCAGGATAGAGAAGCAGCAGAACAGCAGCTAGAAGTGTTTGATTGCACCCTGATGGTGGACGGCAAGGAGACCACCCTGCTGGTCATGGATACGGATGAACGCAACATGAAGAAAGCCATCGAGAGCAGTGATAGCCCCATGCGCCTCGGCAACGCCTACATCATCGTGTACTCAGTCACTGATAGGGCCAGCTTTGAGAGCGCGTCAGAACTTCGAATACAGCTTAGAAGAACTCGTCAGGCTGAAAATATCCCAATAATCCTTGTTGGCAACAAGACGGACCTTGTCCGCAGCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGGGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCCTACAGCACAATGTCCAAGATTGTTTGAGGGGATGGGTGCGCCAGATCAGATGGCTTAGAGAGGGGGGCAGACCCAGCTGAGGTTTCGCATGCTAGCAACGCACGGAAGTCCTGAACAGAAGGCACGGAGGTTCTTGGAACGGGCTGTGTACA
  5   1   2       bld Tad5 FL   in                         XZT41476.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CACATATTGATCTGTAGTGGAATAGAGACATCAGGGATAGACGCTGGGCTGGTTACACCAATAGGACACACAACCCAAAGATGTGCGCCTCACGAGCTCCCCTGAGGAGGCGGGCCAGCACCCCATTACCTTGTGCCCATCAGAACCGCCAGCGAGGAGCAACTCCCATAAGGAAGCTATACTCACCTTCTAAAGCTGCTGGGAGTGCCCACTGCAGTGGCTCCTTAGACTCAGGGGTCTCGGATGGGAGAAACGAGGCCCATTTAAGAGTGGTACTACTTGGAGACCCAGGGGTTGGAAAGTCCAGTCTTGTGGCCATCTTTCGAAGGGAGCAGGATAGAGAAGCAGCAGAACAGCAGCTAGAAGTGTTTGATTGCACCCTGATGGTGGACGGCAAGGAGACCACCCTGCTGGTCATGGATACGGATGAACGCAACATGAAGAAAGCCATCGAGAGCAGTGATAGCCCCATGCGCCTCGGCAACGCCTACATCATCGTGTACTCAGTCACTGATAGGGCCAGCTTTGAGAGCGCGTCAGAACTTCGAATACAGCTTAGAAGAACTCGTCAGGCTGAAAATATCCCAATAATCCTTGTTGGCAACAAGACGGACCTTGTCCGCAGCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCCTACAGCACAATGTCCAAGAATTGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGAACCAGAGGGCACGAAGGTTCTTGGACGGGCTTGTGACCAGAAACAGTAGGTCATCTTTG
  5   1   2       bld Int1      in                         CAAP3251.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAAGCTATACTCACCTTCTAAAGCTGCTGGGAGTGCCCACTGCAGTGGCTCCTTAGACTCAGGGGTCTCGGATGGGAGAAACGAGGCCCATTTAAGAGTGGTACTACTTGGAGACCCAGGGGTTGGAAAGTCCAGTCTTGTGGCCATCTTTCGAAGGGAGCAGGATAGAGAAGCAGCAGAACAGCAGCTAGAAGTGTTTGATTGCACCCTGATGGTGGACGGCAAGGAGACCACCCTGCTGGTCATGGATACGGATGAACGCAACATGAAGAAAGCCATCGAGAGCAGTGATAGCCCCATGCGCCTCGGCAACGCCTACATCATCGTGTACTCAGTCACTGATAGGGCCAGCTTTGAGAGCGCGTCAGAACTTCGAATACAGCTTAGAAGAACTCGTCAGGCTGAAAATATCCCAATAATCCTTGTTGGCAACAAGACGGACCTTGTCCGCAGCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCCTACAGCACAATGTCCAAGAATTGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCA
  3   1   2       bld Ovi1                                 CABI5741.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TCATCGTGTAGTCAGTCACTGATAGGGCCAGCTATGAGAGCGCGTCAGAACTTAGAATACAGCTGAGAAGAACTGGTCAGGCTGAAAATATCACAATAATCCTTGTTGGCAACAAGACGGACCTTGTGAGCAGCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATTGAGACGTCTGCTGTCGTTCAGCACAATGTTCAAGACTTGTTTGAGGGGATGGTGCTCCAGATCAGATTGTGTAGAGAGGGGGCAGACACAGTTGAGGGTTTTGGCATGCAGAGCCAACGCAAGGAGAGTCTGTCCAAGAGGGCACGAAGGTTCTTGGACCGGTTTGTGGCCAGAATCAGTAGGTCATCTTTGAAGGTCCACTCCCGATCATGCCATGATCTGTCCGTGATCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCACCTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGTTAGCATGAAGGACACTT
  3   1   2       bld Te3       out                        CAAM9269.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCAGAGAAGTTTCTGTGGAAGAAGGTCGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCCTACAGCACAATGTCCAAGAATGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCT
  3   1   2       bld Int1      in                         CAAP3251.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAGCGTGTGCTGTGGTGTTCGACTGTAAGTTCATCGAGACCTCTGCTGTCNTACAGCACAATGTCCAAGAATTGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCC
  3   1   2       bld Tad5 FL   in                         XZT41476.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCGTGTGCTGTGGTGTTCGACTGTAGGTTCATCGAGACCTCTGCTGTCTTACAGCACAATGTCCAAGAATTGTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCTTCT
  3   1   2       bld Brn2 5g3  out                       CAAJ15751.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CAGCACAATGTCCAAAGAATGTTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCT
  3   1   2       bld Ski1      in                         CABJ1494.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AGCACAATTTCCAAGAATTTTTTGAGGGGATGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTTTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTTTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCT
  3   1   2      seed Brn2      out                       CAAJ20403.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGGTGCGCCAGATCAGATTGCGTAGAGAGGGGGCAGACACAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTC
  3   1   2       bld Te5       in                         CAAO2030.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGATCAGATTGCGTAGAGAGGGGGCAGACTCAGCTGAGGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTGTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTGTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTGTACCATTTCTGACTGTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTTTATGGAATTAGGCCAAGCTCCCACTAAATTCAGCACTGAGCAACCAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCT
  5   1   2       bld Te5       in                         CAAO2030.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CACAGCTGAAGGTTTTCGCATGCAGAGCCAACGCAAGGAGAGTCTGACCAAGAGGGCACGAAGGTTCTTGGACCGGCTTGTGACCAGAAACAGTAGGTCATCTTTGAAGGTCCACTCCCGATCCTGCCATGATCTGTCCGTGCTCTGATAAGCTCCTCAGGGAGAAGGCCACCCAGAATGAGCTCAGATATCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGACACTGATGGGACACTGTACTGGCTGGACAGCTAGCATGAAGGACACTTACCACTCATGAACTGATTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCGATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGAGGCTTTT
  3   1   2       bld Brn2      in                        CAAJ14321.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGAAACAGTAGGTCTTCTTTGAAGGTCCCCTCCCGATCCTGCCATGATCTGTCCGTGTTTTGATAAGCTCCTCAGGGAGAAGGCCCCCCAGAATGAGCTCAGATTTCAACTAAATGCTTTTGAGCCATGCAGAACATAATGGCCCCTGATGGGCCCCTGTTCTGGCTGGACAGCTAGCATGAAGGACCCTTCCCCCTCATGAACTGATTTTTTGTGCCCTGATGGACAGTTTCCCCCCCAAGCCCAGGATGAAGCCTCCAATGAAGTTCTTCCCAACTGATCCCTTTTTAATGTCAGCCTAATACCTACTTGCCCCAAGCTCATTGATGTTTTTGAAATGCCATTTTGCCCCATTTTTGGGGCTTTTGTGTAAGTAGAATGAAATTTTTGGGGGGGTTTTCCCATTTTTGACTTTGAGAGAATGTAGAAAGTCAGGAAATTTTCCCTCCCCCTCCAAGGTTTTTTGGAATTTTGCCAAGCCCCCCCTAAATTCAGCCCTGGGCAAACAGTGGAAATTTTGAGCAGAATTTTTTTGGATGGAGGCTGAGAGAGGCTCCCCGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACC
  3   1   2       bld Brn2      in                        CAAJ24566.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCT
  5   1   2       bld Brn2      in                        CAAJ24566.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTATTTGTGCACTGATGGACAGTTACCACCCCAAGACCAGGATGAAGCCTGCAATGAAGTTCATCACAACTGATACCTTTCTAATGTCAGCCTAATACCTACTTGCACCAAGCTCATTGATGTATTTGAAATGCCATTCTGCCCCATCTCTGTGGCTTTTGTGTAAGTAGAATGAAATATCTGGTGAGGTTCTACCATTTCTGACTCTGAGAGAATGTAGAAAGTCAGGAAACTCTCCCTCCCCCTACAAGGTTCTATGGAACTATGCCAAGCACCCACTAAATTCAGCACTGAGCAAACAGTGGAAAATCTGAGCAGAATGTTTATGGATGGAGGCTGAGAGAGGCTGCACGGAGAGATGGGGAGTGGGGGGCGTAAATGGATAAGAATAAACATCATGATCATTCTAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)