Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 335.0    0Xt7.1-CABH8866.3                            9 PI      75        758     1386                homeodomain transcription factor Pitx-3 [Xenopus laevis]
     2 389.0    0Xt7.1-TTbA052m02.5                          8 PI      76        746     1447                pitx1-prov protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012080176 Xt7.1-TNeu089h08.3 - 30 ESTs
                                                                       -10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TNeu089h08.3           GCGGCTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCACCACCACCAGCACCACCAACAGCACCAGCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTGTAAGGCAAGGCTAGAGGTGCACACCATCTCAGACACCTCCAGCCCAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGCCAGAGTCAGGGTCTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTAGTTTTGGCTATGCCAGCGTTCAGAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGCAAAAAAAATAAGGGAAAAAATAAATGTATTTCTTGGGAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008228229                 GAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCACCACCACCAGCACCACCAACAGCACCAGCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTGTAAGGCAAGGCTAGAGGTGCACACCATCTCAGACACCTCCAGCCCAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGCCAGAGTCAGGGTCTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTAGTTTTGGCTATGCCAGCGTTCAGAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGCAAAAAAAATAAGGGAAAAAAxxAATGTATTTCTTGGGAAAAAAAAAAAAAAAAAAAAA
                                                      consensus depths                2     2     7     8     7     8     7     9     7     9     7     9     7     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     8     5     8     5     8     4     8     3     7     3     7     3     7     3     6     3     5     3     5     3     6     4     6     4     6     6     7     6     7     6     7     6     8     6     7     6     7     6     7     7     8     6     8     6     7     6     7     6     6     6     6     5     5     4     4     4     4     4     4     4     4     5     5     4     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     6     4     5     4     5     4     5     4     5     5     5     5     5     7     7     7     7     6     7     6     7     6     8     6     8     6     8     6     9     6     9     9    11     9    12    10    12    10    13    10    13    10    13    10    13    10    13     9    12     9    12     9    11     9    11     9    11     9    11     9    11     9    12    10    11    10    11    11    12    11    12    11    12    11    12    11    12    10    11    10    11    11    11    11    11    11    11    11    12    11    12    11    12    12    12    12    12    12    12    12    12    12    13    12    13    12    13    12    13    12    13    13    13    13    13    13    13    13    13    13    13    13    13    13    13    12    13    13    13    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    10    12     9    12     6     8     3     7     3     7     2     6     5     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -----G------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ------CA----
                                               BLH ATG     472    1230           
                                               BLH MIN     430     182           
                                               BLH MPR      43     182           
                                               BLH OVR     472    1383           
                                               EST CLI       0      35           
                                               ORF LNG     472      74           
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Sc ==== 2e-010     NP_010177.1 Regulation of phosphate metabolism; Pho2p [Saccharomyces cerevisiae] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN === Br ==== 3e-017     ABD62780.1 Rx homeobox protein [Branchiostoma lanceolatum] =============================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Cs ---- 2e-017     BAB68341.1 Cs-OTX [Ciona savignyi] ---------------------------------------------------------------------------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN --- Ce ---- 7e-026     NP_001021276.1 UNCoordinated family member (unc-30) [Caenorhabditis elegans] ------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN --- Dm ---- 2e-056     NP_733410.2 CG1447-PA [Drosophila melanogaster] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                            PROTEIN --- Ci ---- 9e-061     AAU93886.1 pituitary homeobox pitx isoform a/b [Ciona intestinalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN === Bf ==== 4e-062     CAD27489.1 paired superclass homeobox transcription factor [Branchiostoma floridae] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED - Sp ---- 2e-067     XP_787549.2 PREDICTED: similar to paired superclass homeobox transcription factor HpPitx [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Bb ---- 1e-075     AAF03901.1 bicoid type transcription factor Pitx [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 3e-111     NP_001007500.1 pitx1-prov protein [Xenopus tropicalis] -------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Dr ==== 5e-154     NP_571050.1 paired-like homeodomain transcription factor 2a; pitx2c [Danio rerio] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Gg ==== 7e-155     NP_990341.1 transcription factor Pitx2 [Gallus gallus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Mm ==== 3e-155     NP_001035967.1 paired-like homeodomain transcription factor 2 isodorm c [Mus musculus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Hs ==== 1e-156     NP_000316.2 paired-like homeodomain transcription factor 2 isoform c; solurshin;all1-responsive gene 1; rieg bicoid-related homeobox transcription factor 1;pituitary homeo box 2 [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === ?? ==== 0          NP_001081756.1 homeodomain transcription factor Pitx2 [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN === Xl ==== 0          CAA06696.1 XPtx2a [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TNeu089h08.3                                                                     TGA------------------------TGA------------------------------------------------ATG------------------ATG---------------------------------------TAG------------------------------------------------------------------------------TAA---------TAG---------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------ATG---------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------ATG---------------------------------------------------------------------------------------ATG---------------------------ATG---------------------------ATG---ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------TGA---------------TAA---TAA---------------------------------------------------------------------TAA------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------TAA------TAGTGA------------------------------------------------------------------------------------ATG------------------------------------------------------------TGA---------------------------------------TAA------------------------------------------TAA---------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            ]
  0   1   1           Neu  FL                     TNeu083k20.FL-Sanger            CGGCTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCACCATCACCAGCAGCACCAGCAGCACCAGCACCATCACCAGCAGCACCATCACCAGCAGCACCAGCAGCCCCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTGTAAGGCAAGGCTAGAGGTGCACACCATCTCAGACACCTCCAGCCCAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGCCAGAGTCAGGGTCTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTAGTTTTGGCTATGCCAGCGTTCAGAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGATATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCGAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGCAAAAAAAATAAGGGAAAAAAATAAATGTATTTCTTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Gas  FLq                    TGas113n21.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCCGGGGCTCACACAGTTCATATTTACTGGGGTTAATATAGCAAGTCACACAGGAGGAAGAGGGATTCAAACTGAGTCCAGACATAGGAAATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGCCAGAGTCAGGGTCTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTAGTTTTGGCTATGCCAGCGTTCAGAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGCAAAAAAAATAAGGGAAAAAAATAAATGTATTTCTTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2   12  bld Gas7 PIPE in                          XZG5606.5p CAACGGGGAAGCGGCTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCACCATCACCAGCAGCACCAGCAGCACCAGCACCATCACCAGCAGCACCATCACCAGCAGCACCAGCAGCCCCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTGTAAGGCAAGGCTAGAGGTGCACACCATCTCAGACACCTCCAGCCCAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCA
  5   1   2       bld Neu  5g3  in                   TNeu074i24.p1cSP6           GCGGCTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCTCCATCACCAGCACCACCACCAGCACCACCAACAGCACCAGCAGCCCCAGGCA
  5   1   2       bld Neu  FL   in                   TNeu083k20.p1cSP6            CGGCTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCTCCCATCACCAGCACCATCACCAGCAGCACCAGCAGCACCAGCACCATCACCAGCAGCACCATCACCAGCAGCACCAGCA
  5   1   2       bld TbA  5g3  in                   TTbA017b07.p1kSP6            CGGCTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCACCACCACCAGCACCACCAACAGCACCAGCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTGTAAGGCAAGGCTAGAGGTGCACACCATCTCAGACACCTCCAGCCCAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCC
  5   1   2       bld Neu  5g                        TNeu070j07.p1cSP6              GCTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAACATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTATCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTATGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTATCAAGGGACTTATCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCAGCACCATCACCAGCACCACCAACAGCACCAGCAGCCCCATGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCT
  5   1   2       bld Neu  5g                        TNeu029j23.p1kSP6               CTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAACATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCAGCACCATCACCAGCACCACCAACAGCACCAGCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTG
  5   1   2       bld TbA  5g                        TTbA069h16.p1kSP6               CTGAGCCTTCGCTGGGTCTCCATTGCCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCCTTGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCACCACCACCAGCACCACCAACAGCACCAGCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTGTAAGGCAAGGCTAGAGGTGCACACCATCTCAGACACCTCCAGCCCAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGC
  5   1   2       bld Neu       out                  TNeu074h24.p1cSP6                       TTACATTTTGACAGTTTAGAAAACTGGCAACCTCACTTAAAAGTGTAGTATATATACGCTCCCTTGTGCGGTCCTGGCCTGGATACAGGGGCATTTATTCGCCCAGTGGCCCTTGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATGGGGCGGGCAAGAAACGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCTCTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTGCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATCGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGCTATCTGTTCACTGGGCTTGGATATTTTGGGAG
  5   1   2       bld HdA  5x3  out                  THdA031p19.p1kSP6                                      CCTGTTGGCAGAGCTCTGCTATAAGTGAATGAGAGCAGCATCCCTTGTGCAAGTCCTGAGCCTGGATACAGGGGCATCTATTCGCCCAGCTGGCCCTATGCTTAGCCTAATGCCCCTGCTCCACCGTGCAATGCCTGCAAGCTCTTTAGGAGGATTTCTTTCCATCATCTTGTAGGCAGGAGAGGGGAGGGCGAGCCCAGCAGCCTTCATTATTACTCTAGTGGACCCAAAAGGACTTACATGTAAGGCACCTTAAGCCTGCACTTAGCAAGGGACTTAGCCAGACCGCTGCTCCTGTCCTGCTCTCCTACATACCCTGGTGCCATCACTCGGACACATAGTGGCATTGAATTTCATTGCGAGTTGTGGGCGTTTTGATCCAGTTATCTGTTCACTGGGCTTGGATATTTTGGGAGCCTACTGTATTATACCCCCACCATCCTCCATGAACTCTATGAAAGAGCCTTTACATTTGGATCACTTGGTTGGGAGTAAATTGGCTACAGCTTCCTCCCATCACCAGCACCACCACCAGCACCACCAACAGCACCAGCAGCCCCAGGCAGTGACTCTTGTATCCATGGCTTCCTCTCTGGGCCAGCGCTCTGGGGAGTGTAAGGCAAGGCTAGAGGTGCACACCATCTCAGACACCTCCAGCCCAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCA
  5   1   2       bld Gas  FLq  in                   TGas113n21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCGGGGCTCACACAGTTCATATTTACTGGGGTTAATATAGCAAGTCACACAGGAGGAAGAGGGATTCAAACTGAGTCCAGACATAGGAAATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGCCAGAGTCAGGGTCTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGG
  5   1   2       bld HeRe      in                     EC2CAA30BE07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CATTATGGCCGGGATCTCAGACACCTCCAGCCCACAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTACCCCGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCCACCCTGATATGTCCACCAGGGAGGAGATCGC
  5   1   2       bld Eye       in                         CCAX8540.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGAAGCAGCAGATAAAGACAAAAGCCACCAGAGCAAAAACGAGGACAGCAGTACTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGCCAGAGTCAGGGTCTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTTCCAGCCTGGCAAGCCTGAGGAC
  5   1   2       bld In63                            IMAGE:8958181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAGCATGTACTTGACGATCCCTCCAAGAAGAAGAGGCAGAGGCGACAAAGGACTCACTTCACTAGCCAGCAACTGCAGGAGCTGGAAGCCACTTTCCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGCCAGAGTCAGGGTCTGGTTTAAGAACCGCAGGGCCAAGTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTAGTTTTGGCTATGCCAGCGTTCAGAACCCAGGATCCAACCTCAGCGCCTGCCAATTTGCAGTGGACAGACCCGTGTGAATACTTGTATATAAGTGTGAGCCTTGTATAATACGTGTCCTGGTACGGGAGTACTTCTGAAACTTCTCTTTAACAAATCTTGGTTCACTACGAAAGAGGAATCGACATGGAAGAAAACATGCAGAACGCGATGTATTTTTTATTCAGCGGATGTTCTTGCCAGTGAACTTACCTACGAAACGGTGTTATATACTCTCGAGAATTAT
  5   1   2       bld Eye                                  CCAX3839.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GACGAAGGACTCACTTCACTAGCTCGCAACTGCAGGAGCTGGAAGCCACTTTTCAGAGGAATCGCTACCCTGATATGTCCACCAGGGAGGAGATCGCAGTCTGGACCAATCTGACAGAGGGCAGAGTCACGGTCTGGATTAAGAACCGCAGGGTCTAGTGGAGAAAGAGTGAGAGGAA
  5   1   2       bld TbA       in                   TTbA065d13.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGTCTGGTTTAAGAACCGCAGGGCCATTTGGAGAAAGAGGGAGAGGAACCAACAGGCAGAGCTCTGCAAAAACGGCTTTGGCCCCCAGTTTAATGGACTGATGCAGCCATACGATGACATGTACCCCAGTTACTCGTACAACAACTGGGCAGCCAAGGGCCTGACTTCAGCATCTCTTTCTACTAAGAGCTTCCCCTTCTTCAACTCTATGAATGTCAACCCACTGTCCTCCCAGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTAGTTTTGGCTATGCCAGCGTTCAGAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTA
  5   1   2       bld Neu       in                   TNeu089h08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTAGTTTTGGCTATGCCAGCGTTCAGAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTCTAATTTTAATTCAGCATCA
  5   1   2       bld Neu                            TNeu112p01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AGAGTATGTTCTCCTCGCCCAATTCCATTTCTTCAATGAGCATGTCCTCTGGCATGGTACCCTCTGCTGTTACTGGGGTGCCAGGCTCTGGTCTAAATAGTTTGAATAATCTGAACAATCTGAGCAACCCTTCTCTCAATACTGCAGTGCCAACGTCGGCCTGCCCCTATGCCCCCCCAACACCTCCCTATGTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCTATTTTTGGCTATGCCAGCGTTCAGAACCCATGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGATAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCATCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTC
  5   1   2       bld Gas7      out                        XZG61010.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GTCTACAGAGACACATGTAACTCCAGCCTGGCAAGCCTGAGACTCAAAGCCAAACAACACTCAACCCAGGATCCAACCTCAGCGCCTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACCCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCANAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCCAGATTTCTCTTTTTTCCCCNATGTTTCCCA
  3   1   2      seed Neu       in                    TNeu089h08.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CTGCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTGGCAAAAAAAATAAGGGAAAAAAATAAATGTATTTCTTGGGAAAAAAAAAAAAAAAAAA
  3   1   2       bld Neu  5g3  in                    TNeu074i24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCAATATGCAGTGGACAGACCCGTGTGATACTTGTATATAAGTGTGAGCCTGTATATACGTGTCCTGTACGGGAGTACTCTGAAACCTCTCCTTTACAAATCTGGGTCACTACCAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTCTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCGAACTATCTGGATGTAAAATAAAACTAATGTATTGTTTAAGGTTATTGGCAAAAAAAATAAGGGAAAAAAATAAATGTATTTCTTGGGAAAAAAAAAAAAAAAAAA
  5  -1   2       bld HdA                           THdA017d10.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAACAAACTGTGGTCTTGACCACATGCAACTTGAATCAGCTTGTGGCATTTTATTACATAAATTACAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAATCTAATGTATTGTTTAAGGTTATTGG
  5  -1   2       bld HdA                           THdA017m15.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTAGCTTGTGGCATTTTATTACATAAATTACAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTGG
  3   1   2       bld TbA       in                    TTbA065d13.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATTTGGGTCACTACCAAAAGAGAATTGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATTTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTTTTTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGCAAAAAAAATAAGGGAAAAAAATAAATGTATTTCTTGGGAAAAAAAAAAAAAAAAAAAAGCGCC
  5  -1   2       bld HdA                           THdA018b01.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACATAAATTACAAAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTTCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTATAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACTACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTGT
  3   1   2       bld Gas  FLq  in                    TGas113n21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AAAGAGAATCGACATGGAGAAACATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAATTTTTTTTTTTTTCTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAAACTAATGTATTGTTTAAAGGTTATTTGGCAAAAAAAATAAGGGGAAAAAAATAAAGTNGTATTTCTTT
  3   1   2       bld Gas7 PIPE in                          XZG5606.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CATGCAGAAACGCCAAATGTATTTTTATTCCAGCGGAATGTCCTGCAGTGAAACTACCACAGACAGTGTAATACTCAGATATAAAGATTTGGGCACCAAAGACTGGACGTGGCATTTTAATATTATTTCTGGCTTGAAATTTTTTTTTTTTTAATTTTAATTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGCAAAAAAAATAAGGGAAAAAAATAAATGTATTTCTTTGG
  3   1   2       bld TbA  5g3  in                    TTbA017b07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTAATTTAATTTCAGCATCAATCGTCAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTGGCAAAAAAAATAAGGGAAAAAAATAAATGTATTCTTGGAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Neu  FL   in                    TNeu083k20.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CAAAAAGGACTGAAAGGCTGTATATATATATATGGAAATGTCAAATTAATTTTATAAAAACAGTTGTCAGTTAATATCTTTACAGTGTTAATACCACACCTTAGGCTTGAGAGTAAAGCATGCAAACGAAAGCCCAGCAAGAAGAATGTATATAATAAATTAGAACATTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCACTACATCTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCGAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGCAAAAAAAATAAGGGAAAAAAATAAAATGTATTTCTTTGGGAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld HeRe      in                     EC2CAA30BE07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCAGCAAGAGGAATGTATATAATAAATAAGAACATTTGTATTTTAAAGATATCCTTGTCCTGGGGTGCCTCAGTACATGTATAGAGTGCGCTCTCAAAAATAATAACGGACAAATACATCTACAATTGGAAGCCATGTTCCCCCCCATCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCACAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCGAACTATCTGGTTGTAAAATAAAACTAATGTATGTTTAAGGTTATTGGCAAAAAAAAT
  3   1   2       bld Eye       in                         CCAX8540.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCTATAGAGTGCGCTCTCAAAAATAATAACGGGACAAATACATCTCCAATTGGAAGCCATGTTCCCCCCCCCACCCTAAAGGGAGTAGTGAAATGCTCAGCAAAATAATTGGACGAAATCACCCACAAATATCCCCAGGACACGAAATCCATCCAAGATTTCTCTTTTTTCCCCAATGTTTCCCAACAAGGTCAACTCGCTGGACTTTTTAAATTCAGAAGTGTCATTATTTATTTGTTGAATTCCATTCTGGTTCATATATAACCTAACTATCTGGTTGTAAAATAAAACTAATGTATTGTTTAAGGTTATTTGGC

In case of problems mail me! (mike.gilchrist@crick.ac.uk)