Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 95%

 1012080194 Xt7.1-CABG6308.3 - 26 ESTs
                                                                       ....-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860......2870......2880......2890......2900......2910......2920......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABG6308.3                                                                                                                                                                     TTACCTCAGTTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAGGAGATTGTGGCAGAGGAAGGTGTTATCCGTGGTCTCTACAAGGGTCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACCACCTTTGATTTAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATTAAAGCAGGAATTAAATCATCGCCAACAAATCGGAGTGGAAAAACATGCCCTCTATAATAAGACACCAAAGTATTTACTAATTACTAAAGTAATTACTAAAGAAAGAATGATAATAGGTGAGGTTTTAGATTAACTCCTTAACAACCACGATGCTGCTCAAATGTAGAGTGTATGACACTCCAGTTTGTAAGTACAGATTACAATGCAACAAAGTCTCCAGTGAAATTTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTCCAAGCTAACAGGTCAATTAAATGTGCCACACACACTATCTGACACCACTGTTTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAA
                                                  Xt7.1-CHK-1008229078                                                                                                                                                                           CAGTTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAGGAGATTGTGGCAGAGGAAGGTGTTATCCGTGGTCTCTACAAGGGTCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACCACCTTTGATTTAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATTAAAGCAGGAATTAAATCATCGCCAACAAATCGGAGTGGAAAAACATGCCCTCTATAATAAGACACCAAAGTATTTACTAATTACTAAAGTAATTACTAAAGAAAGAATGATAATAGGTGAGGTTTTAGATTAACTCCTTAACAACCACGATGCTGCTCAAATGTAGAGTGTATGACACTCCAGTTTGTAAGTACAGATTACAATGCAACAAAGTCTCCAGTGAAATTTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTCCAAGCTAACAGGTCAATTAAATGTGCCACACACACTATCTGACACCACTGTTTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAACTCTGT
                                                      consensus depths                                                                                                                                                                          2     3     4     5     4     5     5     6     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     5     7     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7     9     7    10     9    10     9    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    11    11    11    11    11    11     7    11     7    10     7    10     7    10     7     9     7     9     7     9     7     9     6     8     6     8     6     8     6     8     6     8     6     8     4     6     4     6     4     6     4     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     5     4     5     5     6     5     6     5     6     4     5     4     5     4     5     3     4     3     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     6     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     9     6     8     8     8     9     9    10    10    10    10    10    10     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7
                                               BLH ATG      28     643                                                                                                                                                                     
                                               BLH MIN      28     176                                                                                                                                                                     
                                               BLH OVR      28     196                                                                                                                                                                     
                                               ORF LNG      28      14                                                                                                                                                                     
                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Bb ---- 1e-011     ABK54275.1 Slc25A21 [Branchiostoma belcheri] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Br ---- 6e-030     AAQ17207.1 ADP/ATP translocase [Branchiostoma belcheri tsingtaunese] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                              PROTEIN --- Sc ---- 2e-038     NP_011865.1 mitochondrial carrier protein, involved in the accumulation of CoA in themitochondrial matrix; homologue of human Graves disease protein; LEU5 does notencode an alpha-IPM synthase, as was first hypothesized.; Leu5p [Saccharomycescerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                           PROTEIN --- Dm ---- 9e-081     NP_650891.1 CG4241-PA, isoform A [Drosophila melanogaster] ---------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                         PROTEIN === Ce ==== 3e-081     NP_492333.1 mitochondrial carrier protein (1J190) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                PREDICTED - Sp ---- 3e-097     XP_781807.1 PREDICTED: similar to CG4241-PA, isoform A [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PREDICTED = Hs ==== 5e-138     NP_848621.1 hypothetical protein MGC26694 [Homo sapiens] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PREDICTED = Mm ==== 2e-140     NP_001007571.1 hypothetical protein LOC73095 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PREDICTED = Dr ==== 1e-145     NP_001038918.1 hypothetical protein LOC751743 [Danio rerio] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                        PREDICTED - Gg ---- 4e-146     XP_424684.2 PREDICTED: similar to LOC496002 protein [Gallus gallus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === Xl ==== 1e-175     AAH87392.1 LOC496002 protein [Xenopus laevis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PREDICTED = Xt ==== 0          AAI24066.1 Hypothetical protein MGC149061 [Xenopus tropicalis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PROTEIN === ?? ==== 0          Q05AQ3 Solute carrier family 25 member 42 [(unknown)]  ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABG6308.3                                                                                                                                                             TAA---------------------------------ATG---------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------ATG------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------------------------------------------------------ATG------------------------------------------------------------------------------------------------------TAGATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------TAA---------------------------ATGTAG------TGA------------TAA------------ATG---------------TGA---------------------TGA---TGA------TAA---------------------------------------------------------------TGA---------------------------------------------------ATG---------TGA------------------------------------------------------------TAG---------------------------------------------------------------------------------TAA---------------------TGA------------------------------ATG---------------------TAA---------------------------------------------------------TAA---------TAGTAA---TAG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------TAA---------------------------------------ATG---------------------------------------------------TGA------TAG---TGA---------------------------------------------------TAA------------------TGA------TAA------------------------------------------------------TGA---------TAA---------------TGA------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------------TGATAAATG---------------TAA---------------------------------TGA------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------TAG------------------TAA------------------------------------------------------------------------------TAA---------------ATG---------------------------ATG
                                                                   ORF                                                                                                                                                                                                 [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ]
  0   1   1           Ski1 FL                          CABJ6548.FL-MGC                                                                                                                                                                         CTCAGTTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAGGAGATTGTGGCAGAGGAAGGTGTTATCCGTGGTCTCTACAAGGGTCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACCACCTTTGATTTAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATTAAAGCAGGAATTAAATCATCGCCAACAAATCGGAGTGGAAAAACATGCCCTCTATAATAAGACACCAAAGTATTTACTAATTACTAAAGTAATTACTAAAGAAAGAATGATAATAGGTGAGGTTTTAGATTAACTCCTTAACAACCACGATGCTGCTCAAATGTAGAGTGTATGACACTCCAGTTTGTAAGTACAGATTACAATGCAACAAAGTCTCCAGTGAAATTTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTCCAAGCTAACAGGTCAATTAAATGTGCCACACACACTATCTGACACCACTGTTTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAA
  5   1   2       add Ski1      in                         CABJ7469.5p CATTAGTGGCCCTCCACCACATAAGCCAGAAAAATTTCCGCTCTGAAAGAAGTTGGACTTAAGTTGTTCACTTAATGGCACCTCCCATATCCATCCTATTTGTTAATGTTTCCCCTCCCATCTCTGGCATTACCATAGTGGGTGGGTCAGGTATGGTTATAGGTACTGAAAATAATAAGACCTCTCAAGCCAAGTCAGGTGCAGGTTGGAAATGGATGATGGTCACTAGCATCTTTTCCCTGTCTGAATTCTGTTCTGCATCACTTCTTTAAACTTTGGATTGATTAATGAACTGTGGCTTCTATTTCACAGTGACGCTAGGTATCTCCCTTATCGTACGAATGCTATTATGTTATAAAAATGATTTGCTAAATAAATAGACCAGGTAAGTATGTATAGACCAGCTATTGCATTTTGAAAGTATTTTTAGGGTATAAGATGAGACTTGATAATGGTGAATTTCACTTGCTAGGAAAGTACTGGTGGCTGAAAAAGAGGGGGGTGTTAAACTAATACATATTGGTAGAATGTGAATCGATTAATTGCCATTTTTAAATTCTCACAGGATTATTCCTAACATATAACTAAAATATGTGTTGTGGTTTTGAATGGGAAGTTATTCTTGTTCAGAGTTGAAGAACTCTTAACTTAATGGAATTAACTGTACTCTCCAATCCTTTCTATTTTTATCATAAAAGGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGGTGAGTAAACCCCTAAATCAGACTGTAAAGTTTTTTAAAAGCTTTGGTCT
  5   1   2   14  bld Te4  5g3  in                         CAAN2412.5p ................................................................................................................................CGGGTAACGGGGCCAGCAAGCAGAGGTGTAAACTTTTTACCTCAGTTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGANACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTG
  5   1   2       chi Lun1      in                        CABD13217.5p                                                                                                                                                             TAAACTTTTTACCTCAGTTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGCTCACCTTGGTGCAAGAAATATAAATAATACATAAAGTGCTGCAAAGGAAGGTCTAGGCAAGTAAAACATATTTTATTATCTTTGTGACAGTCAGAATACAACTAAAATAATTTTGGACGTTTCCATTGCTGNTACTTTTTTTTTACACATTTGTGATGCGTAAATAATCCCCTTTAGAAATCTATTTCCACTGTAAATAGC
  3   1   2       chi Lun1      in                        CABD13217.3p                                                                                                                                                                       ACCTCAGTGGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGAAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGCTCACCTTGGTGCAAGAAATATAAATAATACATAAAGTGCTGCAAAGGAAGGTCTAGGCAAGTAAAACATATTTTATTATCTTTGTGACAGTCAGAATACAACTAAAATAATTTTGGACGTTTCCATTGCTGTAACTTTTTTTTTACACATTTGTGATGCGTAAATAATCCCCTTTAGAAATCTATTTCCACGTAAATAGCAAAAAA
  5   1   2       bld Ski1 FL   in                         CABJ6548.5p                                                                                                                                                                         CTCAGTTGGGTGAAGAAGTGTGGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCA
  5   1   2   10  bld Liv1 5g3  in                         CAAR7637.5p .............................................................................................................................................................................................GGTATGGAGAATGGTATTAAGGAAAGTCAAGTGGGTCTGAACAAGAATGGCACCCATGCTATCTTACCCTCACCTGTGGTGTCCGAAGGGCATAAAAATCACAAAAGTATCCTCAACTCTCTGATGTCTGGGGCTCTTGCTGGAGCTGTAGCTAAAACAGCTGTTGCTCCACTGGACAGAACCAAAATCATATTCCAAGTGTCTTCAAACAGATTTTCTGCTAAGGAAGCCTACAGACTAATTTACCGTACTTATTTAAATGAAGGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAATGGTGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAG
  3   1   0       chi Ski1      in                         CABJ7469.3p                                                                                                                                                                                                                                                                                AACTTTGGATTGATTAATGAACTGTGGCTTCTATTTCACAGTGACGCTAGGTATCTCCCTTATCGTACGAATGCTATTATGTTATAAAAATGATTTGCTAAATAAATAGACCAGGTAAGTATGTATAGACCAGCTATTGCATTTTGAAAGTATTTTTAGGGTATAAGATGAGACTTGATAATGGTGAATTTCACTTGCTAGGAAAGTACTGGTGGCTGAAAAAGAGGGGGGTGTTAAACTAATACATATTGGTAGAATGTGAATCGATTAATTGCCATTTTTAAATTCTCACAGGATTATTCCTAACATATAACTAAAATATGTGTTGTGGTTTTGAATGGGAAGTTATTCTTGTTCAGAGTTGAAGAACTCTTAACTTAATGGAATTAACTGTACTCTCCAATCCTTTCTATTTTTATCATAAAAGGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGGTGAGTAAACCCCTAAAATCAGACTGTAAAGTTTTTTAAAAAGCTTTGGTCTAATGGGACTACCATTGCCATACATTAGCTGCTTTCCCTTCTTCAGCTCACCTTGGTGCAAGAAATATAAATAATACATAAAGTGCTGCAAAGGAAGGTCTAGGCAAGTAAAACATATTTTATTATCTTTGTGACAGTCAGAATACAACTAAAATAATTTTGGACGTTTCCATTGCTGTAACTTTTTTTTTACACATTTGTGATGCGTAAATAATCCCCTTTAGAAATCTATTTCCACTGTAAATAGC
  5   1   2       bld Te4       in                         CAAN3824.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATTTAAATGAACGTTTCCTAAGTTTATGGAGAGGTAACTCTGCCACAAAGGGGCGTGTGATTCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAGGAGATTGTGGCAGAGGAAGGTGTTATCCGTGGTCTCTACAAGGGTCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACCACCTTTGATTTAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATAAAAGCAGGGAATAAATCATCGCCAACAAATC
  5   1   2       bld Sto1      in                         CABG9139.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCTATGCAGCCATACAGTTTTGTGCTCATGAACAATACAAGAAACTGCTTGGCAGTTATTATGGCTTCCAGGGAAGTGCTTTGACACCCATTCCTCGACTTCTTGCAGGAGCTTTAGCTGGTACAACAGCTACTATAATAACCTATCCCTTGGATCTGGTGCGTGCACGCATGGCAGTTACTCCAAAGGAAATGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAGGAGATTGTGGCAGAGGAAGGTGTTATCCGTGGTCTCTACAAGGGTCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACCACCTTTGATTTAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATTAAAGCAGGAATTAAATCATCGCCAACAAATCGGAGT
  5   1   2       bld Sto1      in                         CABG6308.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCCTTTCTATTTTTATCATAAAAGGTATAGTAATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGNCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAGGAGATTGTGGCAGAGGAAGGTGTTATCCGTGGTCTCTACAAGGGTCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACCACCTTTGATTTAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATTAAAGCAGGAATTAAATCATCGCCAACAAATCGGAGTGGAAAAACATGCCCTCTATAATAAGACACCAAAGTATTTACTAATTACTAAAGTAATTACTAAAGAAAGAATGATAATAGGTGAGGTTTTAGATTAACTCCTTAACAACCACGATGCTGCTCAAATGTAGAGTGTATGACACTCCAGTTTGTAAGTACAGATTACAATGCAACANAGTCTCCAGTGAAATTTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCAC
  5   1   2       bld Tad5      in                         XZT46910.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AATATCATTCACGTGTTTATGCGAATGTCAAGAGAGGAGGGTCTTAAGTCACTTTACAGAGGATTCACACCTACAGTGCTTGGTGTCATCCCATATGCAGGAATCAGCTTTTTCACATATGAAACGCTAAAAAAGCTACATGCAGAACATAGTGGCAGGACACAGCCATACCCCTTTGAGCGATTGCTATTTGGGGCCTGTGCAGGACTGTTTGGACAGTCCGCTTCATACCCATTGGATGTGGTGAGGAGGCGAATGCAAACTGCGGGAGTGACAGGACATGCATATGGATCAATCATTGGCACAATGCAGGAGATTGTGGCAGAGGAAGGTGTTATCCGTGGTCTCTACAAGGGTCTTAGCATGAACTGGGTGAAAGGACCGGTGGCAGTGGGAATAAGCTTCACCACCTTTGATTTAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATTAAAGCAGGAATTAAATCATCGCCAACAAATCGGAGTGGAAAAACATGCCCTCTATAACAAGACACCAAAGTATTTACTAATTACTAAAGTAATTACTAAAGAAAGAATGATAATAGGTGAGGTTTTAGATTAACTCCTTAACAACCACGATGCTGCTCAAATGTAGAGTGTATGACACTCCAGTTTGTAAGTACAGATTACAATGCAACAAAGTCTCCAGTGAAAATTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTCCAAGCTAACAGGTCAAATAAATGTGCCACACACACTATCTG
  3  -1   2       bld Sto1      in                          CABG432.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TAACACAGATCCTTCTGAAAAAGCTGCAGCGACTGTCTGATATCCAGAGGTAGATGAATGAGGAGAAAGGACTGACCCTCAACCTCTTCCCTTTTGGTGGGGCATCACCACCATTAAAGCAGGAATTAAATCATCGCCAACAAATCGGAGTGGAAAAACATGCCCTCTATAATAAGACACCAAAGTATTTACTAATTACTAAAGTAATTACTAAAGAAAGAATGATAATAGGTGAGGTTTTAGATTAACTCCTTAACAACCACGATGCTGCTCAAATGTAGAGTGTATGACACTCCAGTTTGTAAGTACAGATTACAATGCAACAAAGTCTCCAGTGAAATTTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTCCAAGCTAACAGGTCAATTAAATGTGCCACACACACTATCTGACACCACTGTTTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGNNCATGTCTACGACCTCGCTT
  5  -1   2       bld Sto1      in                          CABG432.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCAGTGAAATTTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTCCAAGCTACAGGGTCAATTAAATGTGCCACACACACTATCTGACACCACTGTTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAG
  5   1   2       bld Tad5                                 XZT54444.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAGTGAAATTTCAAGGTGGTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTCCAAGCTAACAGGTCAATTAAATGTGCCACACACACTATCTGACACCACTGTTTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCANATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAAATACATAGCATTGAAACTGCCAG
  3   1   2       bld Ski1 FL   in                         CABJ6548.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTCATCATATGATCCTGAAGTAGTTAATCAGTGGCTTACAAAGGAGCACTNCAAGCTAACAGGTCAATTAAATGTGCCACACACACTATCTGACACCACTGTTTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAA
  3   1   2       bld Tad5      in                         XZT46910.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTAACAGAAATGCCAAATCAGAAAAATGTCATTCTAACCTAATGTTTACTACATGAAATTCATTTCGACATAGAAAACCTTGCTATCACTCCTTTCCTCCCAGTGAGACCGTGACATAGTTTTATTCTGCACTTGTTACCTGGGAGATAGCCTGGAACAGCACAAGCCAAACTAACAGCAGTTTTGCTCTGTTAGATTTTTAAGCTACGTCAGCTTTATGCCAATGAGTGAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTAC
  5   1   2       bld Tad5                                 XZT22968.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAGAAATTTGCAGTCTTTTGCACTTGAAATGCGTGTAATTGCTTTTTGCCTTTAAGAACAAAACAGAACTTCTTGCAGCAGCAGAGTTTTTACAGTGCATTGTTTGGGCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCCAGACAAT
  5   1   2       bld Mus1      in                        CABH11556.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACATAACCATGTGTGTAGTAACACTAGTGTATTCATGCATGTGCAGGACATATTGCTGCACACATTACACAAACCTTGCATGTTCTACGGACCTCGCTTACCAATGTTCGTTTAAGGAATATCTTTTTGGTGCATCTGTGGAGGAAGTGTAGAAAAACCAGTAACCCCAAGAGATTACAACATATTATATGTATTTATACATAATCTGTTTGCACTACTAAAAAGTTTGCAGCCTTTTAAAAAAATACTGATATTTTAATTATTAAAGTTAACTATCAAATGTTAGGGCTTTTGGGGCCAAGTCATATAAATATACATTATCCAAACCTCTGCTGAATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTA
  3   1   2       bld Sto1      in                         CABG6308.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AATACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAACTCTGTGGTC
  3   1   2       bld Liv1 5g3  in                         CAAR7637.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGACNAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAACTCTGTGGTC
  3   1   2       bld Sto1      in                         CABG9139.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TACAATAGCATTGAAACTGCCAGTTGTTTTTTTTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAACTCTGTGGTC
  3   1   2      seed Mus1      in                        CABH11556.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTTTTATCCAGGAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAACTCTGTGGTC
  5   1   2       bld Hrt1      in                         CAAQ8815.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GAGTTAAAAGATGTCTGCCATTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAACTCTGTGGTCAAA
  3   1   2       bld Te4       in                         CAAN3824.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTAAGGAACAAATAAGCAAAATTGATTACAATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATG
  3   1   2       bld Te4  5g3  in                         CAAN2412.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATAAAAAAAAAAAAAAACCAGAAGCAAAAGAAAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCAAGAAATTGTATATTTAATAAAGATGAACTCTG
  3   1   2       bld Hrt1      in                         CAAQ8815.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAACAAACCAGAAGCAAAAGATAAGGAGCAAAGAAAGGCCTTACCCTATGATGTATTTGTTAAAATTGCAGTAAACTATGAGGATGTATTGAAATTTACTATTATAGTTTCTCCCTGCATGCCAAGCAAATCATTTGGGTATCAATTACAAAAGGACTAGGCAGTAAACCAAAGCAAGCAATCAATAATTAGCAATTGTTAGCAAGCTGCAGCTGCCAGGACAATGAAAGCAAACATCTGATTGGTTGCTATAGGTTACTGCTCAGGTGGAAATTTGCCAAGTGTTGATAAATGTTAAATCATATCTTCTAACTTGTAGTGGGGTTCTCATTGAATTTCACAGTGTGAATTGCACATTGGGAGCACGCCTTGCCTTTACTGTTCTATAGGTGGTGGTTCATAGCACAGCTATGTGCTCACCAATTGCTGCTTATAGTGGTTTATTCAGTAAATTTGATCACTTACAAAAGTGAAAGAACAATGATTCGGGGAGTGGCACACTCACAAATCACTTTAATAAATAGCAAATTATATGTCTTTGCATCATGGGTACACTACTACACTGCATGGTAGACAACTCTGTTGCTGAAATAAGCCAAAAGTATATGCTTTCTGTCCAGTGTTCAGTTGTGTTGCAGTGGCAGCACGTTTAGTAAGTATGTTTATATAATATAAAAATATATTTTAAATATGTGCCACGAAATTGTATATTTAATAAAGATGAACATACTGTGGTCAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)