Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 04 Jul 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     1 579.0    0Xt7.1-CAAR10064.3.5                       106 PI      76        560     1583                smad2 [Xenopus tropicalis]
     2 198.0    0Xt7.1-CAAN2037.3.5                         21 PI      79       1318     1583                smad5-prov protein [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 98%

 1012080198 Xt7.1-CABD3625.3 - 19 ESTs
                                                                       .........-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD3625.3                    GGGGGGAGAGTGGTTAGAAAGTTAGAGGCGAAGAGAAGGGGTTGAGTGCTGAAGCACAGAGAGGGACAGGGAGCGACTGAGGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTGGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTTAACCAACGTGTGGGGGAGACCTTCCACGCTTCCCAACCCTCCATGACAGTGGATGGATTCACCGATCCTTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATTAAAAAA
                                                  Xt7.1-CHK-1008230862                          AGAGTGGTTAGAAAGTTAGAGGCGAAGAGAAGGGGTTGAGTGCTGAAGCACAGAGAGGGACAGGGAGCGACTGAGGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTGGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTTAACCAACGTGTGGGGGAGACCTTCCACGCTTCCCAACCCTCCATGACAGTGGATGGATTCACCGATCCTTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATTAAAAAAAAATAA
                                                      consensus depths                         2     2     2     2     2     2     2     2     2     2     3     3     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     8     6     8     6     8     7     8     7     8     7     8     7     8     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10     9     9     9     9     8     9     8     8     8     8     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     6     5     6     6     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     4     4     3     3     3     3     3     3     4     5     4     5     5     5     5     5     5     5     6     6     7     7     7     7     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9    10    10    10    10    10    10    10     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     6     7     2     2
                                                                   SNP                                                                                                                                                                                ------A-----
                                               BLH ATG     339    1545                    
                                               BLH MIN     339     307                    
                                               BLH MPR     336     307                    
                                               BLH OVR     339    1093                    
                                               CDS MIN     339     307                    
                                               ORF LNG     339     102                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Ce ---- 7e-105     NP_498931.2 SMAll body size SMA-2, dwarfin; affects body size and the arrangement ofperipheral sense organs in the male tail; transforming growth factor betapathway component (47.9 kD) (sma-2) [Caenorhabditis elegans] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Dm ==== 3e-164     NP_511079.1 Smad on X CG2262-PA [Drosophila melanogaster] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                      PROTEIN === Ci ==== 0          BAE06692.1 Smad2/3b [Ciona intestinalis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ==== 0          NP_001075435.1 hypothetical protein LOC577345 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN === Dr ==== 0          NP_571646.1 MAD homolog 3 [Danio rerio] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Mm ==== 0          NP_058049.2 MAD homolog 3 [Mus musculus] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Hs ==== 0          NP_005893.1 MAD, mothers against decapentaplegic homolog 3 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Gg ==== 0          NP_989806.1 TGF beta response effector Smad3 [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xl ==== 0          CAC38118.1 SMAD3 [Xenopus laevis] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === ?? ==== 0          NP_001079320.1 MAD, mothers against decapentaplegic homolog 3 [Xenopus laevis] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN === Xt ==== 0          NP_001008436.1 smad3-prov protein [Xenopus tropicalis] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CABD3625.3                                                              TGA---------------------------------------------------------------TAA---------------------------------------------------------------TGA------------------------------------------TGA---------------TGA---------TGA---------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------ATG------------------ATG---------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------ATG---------------------------------------------------------------------------------------------------------------------ATG---------------------------------TAA---------------TGA---------------------------------------TAA------------------------------TAG------------ATG---------------------TGA------------------------------------------------------------------------------------------------------ATG---------TAA---------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                       [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ]
  5   1   1                FL                     IMAGE:7029074.FL-MGC                                                                     GGAAGCACAGAGAGGGACAGGGAGCGACTGAGGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTGGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTTAACCAACGTGTGGGGGAGACCTTCCACGCTTCCCAACCCTCCATGACAGTGGATGGATTCACCGATCCTTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATTAAAAAAAAAAAAAAAA
  5   1   2       bld Te5  5g3  in                        CAAO13008.5p GTAAGTCGGCGAAGAGGGGGGGGGGAGAGTGGTTAGAAAGTTAGAGGCGAAGAGAAGGGGTTGAGTGCTGAAGCACAGAGAGGGACAGGGAGCGACTGAGGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTGGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGATTCCCTTCACTCGATGGATACAGC
  5   1   2   14  bld Met5 5g3  in                          CACX754.5p ...................GGGGGGAGAGTGGTTAGAAAGTTAGAGGCGAAGAGAAGGGGTTGAGTGCTGAAGCACAGAGAGGGACAGGGAGCGACTGAGGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTAGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCA
  5   1   2       bld      FL                         IMAGE:7029074.5p                                                                     GGAAGCACAGAGAGGGACAGGGAGCGACTGAGGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTGGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAANATACAATTTCCCGGCAGCATG
  5   1   2   14  bld Te3  5g3  in                         CAAM4244.5p .........................................................................................GAGCGACTGAGGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTGGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATT
  5   1   2   10  bld Te1  5g3  in                         CBWN5020.b1 ...................................................................................................GGCCACAGTACGGGCAGAGAGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTAGTAATAGCTGCTGAGTAAAGTGTGTGCGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTC
  5   1   2   10  bld Lun1 5g3  in                         CABD3625.5p ......................................................................................................................AGTGCACAGTAAGAAGTATATATATATCTAGAGAGAGAGAGAGAGGGCAAAAGAGAGAGTCGTAGTAATAGCTGCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCG
  3  -1   2       chi Int1      in                        CAAP13732.3p                                                                                                                                                                                                                                                                               GCTGAGTAAAGTGTGTGTGCGCCAGTGGGGAAGAGTCCCAAGGAGCCTGAGTGACAATAGGTGTGTGAGCTGCAGCCTGACAGGGATTGTCCCCTTGTCTCCCCCGCGGCCCCCCAGCTCCTGTCCTTTCTCTCCTATTATATCTCTGTTCTGCTTGGGGGGCTGTCATGTCCTCGATTCTTCCCTTCACTCCCCCCATCGTGAAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTTAACCAACGTGTGG
  5   1   2       bld Te4       ?                         CAAN10529.5p                                                                                                                                                                                                                                                                                                                                                           GGTCGGATTCCGGGATTCGTCGACCCCGCGTCCGCGGAGACACATTGGGAGAGGCTGCTGGGATGGAAGAAGGGAGAGCAGAATGGGCAAGAGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTT
  5   1   2       bld Ski1      in                        CABJ10467.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGAGAAATGGTGTGAGAAGGCAGTGAAGAGTCTGGTGAAGAAGCTGAAGAAGAGTGGGCAGCTGGACGAGCTGGAGAAGGCACTGACCACCCAGAGCATCAGCACCAAGTGCATCACCATCCCCAGGTCTCTGGATGGAAGGCTCCAGGTGTCCCATCGCAAGGGTTTGCCCCATGTCATATACTGCCGCCTTTGGAGGTGGCCAGATCTACACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTTAACCAACGTGTGGGGGAGACCTTCCACGCTTCCCAACCCTCCATGACAGTGGATGGATTCACCGATCCTTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCA
  5   1   2       bld Te1       in                        CBWN13876.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCACAGTCACCACGAACTTCGAGCCATGGAGGTGTGTGAATATGCCTTCAACATGAAGAAAGACGAAGTGTGTGTGAATCCTTATCACTACCAGAGAGTGGAGACTCCAGTTCTACCTCCAGTGCTGGTTCCACGAAACACCGAAATTCCGGCAGAATTCCCTTCACTCGATGATTACAGCCATTCCATTCCAGAAAATACCAATTTCCCGGCAGGCATTGAGCCACAGATAAACTACATTCCAGAAACTCCTCCTCCTGGTTACTTGAGTGAAGATGGGGAAACAAGCGACCAAATGAACCACAGCATAGATACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTTAACCAACGTGTGGGGGAGACCTTCCACGCTTCCCAACCCTCCATGACAGTGGATGGATTCACCGATCCTTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAGATTCCAC
  5   1   2       bld Neu                            TNeu050m05.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCCCGGAGGCCCGGGGNAATCCCCGGGACAGGGTCTCCAAATTTGTCTCCAAACTCTATGTCCCCTGCTCATAGCAACATGGACCTGCAGCCTGTTACATACTGCGAGCCGGCCTTTTGGTGCTCCATCTCCTACTATGAGCTTAACCAACGTGTGGGGGAGACCTTCCACGCTTCCCAACCCTCCATGACAGTGGATGGATTCACCGATCCTTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACT
  3   1   2       bld Lun1 5g3  in                         CABD3625.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          AACCCTNCATGACAGTGGATGGATTCACCGATCCTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATTAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTAT
  5  -1   2      seed Int1      in                        CAAP13732.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATGACAGTGGATGGATTCACCGATCCTTCCAACTCCGAACGTTTCTGCCTGGGACTGTTGTCCAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTG
  3   1   2       bld Ski1      in                        CABJ10467.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CAATGTAAATCGGAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCCAGTGGACCTGGCCTGTATTAAA
  3   1   2       bld Met5 5g3  in                          CACX754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GAATGCGGCTGTGGAAATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATTAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATT
  3   1   2       bld Te3  5g3  in                         CAAM4244.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ATGACACGGAGACACATTGGGAGAGGCGTGCGGCTGTATTACATCGGAGGGGAAGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATT
  3   1   2       bld Te5  5g3  in                        CAAO13008.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGTGTTTGCTGAGTGCCTCAGTGACAATGCCATATTTGTACAGTCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATT
  3   1   2       bld Te1       in                        CBWN13876.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATATTTGTACAGTCCCCCAAATTGTAACCAGCGCTACGGTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATTAAAAAAAAAAAAAAA
  3   1   2       bld Te1  5g3  in                         CBWN5020.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GTTGGCATCCTGCCACGGTCTGCAAGATTCCACCAGGCTGTAACCTGAAGATATTTAATAACCAGGAGTTTGCTGCTCTTTTGGCTCAGTCAGTAAATCAAGGCTTTGAGGCTGTGTATCAGCTCACTAGGATGTGCACCATACGCATGAGTTTTGTCAAGGGCTGGGGAGCCGAATACAGGCGACAGACTGTGACTAGCACCCCCTGCTGGATCGAGCTGCACTTGAACGGGCCCTTGCAATGGCTGGATAAAGTTCTCACTCAGATGGGGTCTCCAAGTATCCGCTGCTCCAGTGTTTCTTAAAGAGAAGCAGCTTGGTGACGGGATATAGCATTCTGTGGGCCAAGCGATGAAAGAGACTAAGCTTTAGGACTAAACAAGTCTATTGCGTCTTAGTCCATTCAGACCATGCTTAGACCAGAGACAGCCAACTGAAGCCAAGTAACTGAAGTACGCAAACTTATCAGTGGAACAACATCTCATTGGCCAAGTTCAAGGACTTGTAATCTAGAACTTACCAGCACTCCAATATCCAGTATGGTGGTGCAATAAAAGCTGGCTCTTACTGCACACCATTATCCAGGATAACCAAACTGCTGCTGTCCTTGTACACCTCACTTGCAGACGCATGACTTAGAGCCAGTGGACCTGGCCTGTATTAAAAAAAAATAAATAACACAAAACCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)