Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 27 Feb 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABG2786.3                           54 END     4          33        7                (no blast hit)
     2   2.0    0Xt7.1-CAAM1754.5                            4 END     2          16       50                protein tyrosine phosphatase, receptor type, B precursor; protein tyrosinephosphatase, receptor type, beta polypeptide; protein tyrosine phosphatase beta[Homo sapiens]
     3   2.0    0Xt7.1-CAAM6142.5                            2 END     2          16      100                CG11720-PA [Drosophila melanogaster]
     4   2.0    0Xt7.1-CAAM3059.5                            2 END     1           8       50                PREDICTED: similar to Protein tyrosine phosphatase, receptor type, B [Gallus gallus]

 This cluster: approximate FL confidence score = 0%

 1012080264 Xt7.1-CABD12154.3 - 12 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500....
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD12154.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTACCCAACTATTTACTGAAGAAATGAGGACATTCCCTGAGCCACTGTATAGTGACACTTTCTTCTCCTTGCCAATCACAACGGAAGCAGAGCCTTTATTTGGTGTTATAGAAGGTGTAAGCGGTGGCATGTTCGTCATTATCATGATCATTGTGCTCACTGTGCTACTCATCTACCGGCAAAAAAAGAAGAGAGTGTATGAGCAGGATCCAATGACCACACATCTGAGTTCACAAATAGAAAGGATTCCATCAGTCCATCTAAATGTTGGCCACATACAAATAGGAGACAGAATCTCATCAAGGCCTATTCTAACTGCCCAGTTTGAAGAACATTTCAGCAAGCTTCAGACCGATTCCAATTACTTGCTTTCTCGGGAGTATGAGAACCTTAAAGATTTTGGTCGAGACCAGTCTTCTGATACTGCCCTTCTCCCAGAAAACAGAGGAAAGAATAGATATAGCAACATATTGCCCTATGATTCCACAAGAGTGAAACTTGCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGTTAGATTTTCAGTTATTTATTTGTCTTTGTCATTTTGTAAGCTATATGTAATTTAAATGTACATTTCATTCTCAGATGTATATATATATATATTTTTTTTTTCTCTCTGTTTCAAGTCTCACATTAAACCACAATC
                                                  Xt7.1-CHK-1008234030                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCAACTATTTACTGAAGAAATGAGGACATTCCCTGAGCCACTGTATAGTGACACTTTCTTCTCCTTGCCAATCACAACGGAAGCAGAGCCTTTATTTGGTGTTATAGAAGGTGTAAGCGGTGGCATGTTCGTCATTATCATGATCATTGTGCTCACTGTGCTACTCATCTACCGGCAAAAAAAGAAGAGAGTGTATGAGCAGGATCCAATGACCACACATCTGAGTTCACAAATAGAAAGGATTCCATCAGTCCATCTAAATGTTGGCCACATACAAATAGGAGACAGAATCTCATCAAGGCCTATTCTAACTGCCCAGTTTGAAGAACATTTCAGCAAGCTTCAGACCGATTCCAATTACTTGCTTTCTCGGGAGTATGAGAACCTTAAAGATTTTGGTCGAGACCAGTCTTCTGATACTGCCCTTCTCCCAGAAAACAGAGGAAAGAATAGATATAGCAACATATTGCCCTATGATTCCACAAGAGTGAAACTTGCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGTTAGATTTTCAGTTATTTATTTGTCTTTGTCATTTTGTAAGCTATATGTAATTTAAATGTACATTTCATTCTCAGATGTATATATATATATATTTTTTTTTTCTCTCTGTTTCAAGTCTCACATTAAACCACAATCACTAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     6     6     6     6     7     7     8     8     8     8     8     8     6     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     6     6     3     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Sc ---- 3e-031     NP_010051.1 phosphotyrosine-specific protein phosphatase; Ptp1p [Saccharomyces cerevisiae] ----============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 7e-051     BAB00633.1 tyrosine phosphatase [Ciona intestinalis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Bb ==== 4e-055     BAA95167.1 amPTPR3 [Branchiostoma belcheri] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     PROTEIN --- Xt ---- 6e-054     AAH89648.1 Unknown (protein for MGC:107851) [Xenopus tropicalis] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      PREDICTED = Sp ==== 1e-064     XP_001187151.1 PREDICTED: similar to Ptprd protein [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xl ---- 7e-067     AAF43605.1 receptor protein tyrosine phosphatase delta [Xenopus laevis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ce ---- 2e-071     NP_495925.1 Protein-tyrosine phosphatase with fibronectin type III domain(s) [Caenorhabditiselegans] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                PREDICTED - ?? ---- 4e-087     XP_688134.1 PREDICTED: similar to protein tyrosine phosphatase, receptor type, J precursor [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 8e-090     NP_525076.2 CG6899-PA, isoform A [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED = Dr ==== 3e-099     XP_701321.1 PREDICTED: similar to protein-tyrosine-phosphatase (EC 3.1.3.48), receptor type beta - mouse (fragment), partial [Danio rerio] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Mm ---- 0          NP_084204.1 protein tyrosine phosphatase, receptor type, B [Mus musculus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Hs ---- 0          NP_002828.2 protein tyrosine phosphatase, receptor type, B precursor; protein tyrosinephosphatase, receptor type, beta polypeptide; protein tyrosine phosphatase beta[Homo sapiens] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Gg ---- 0          XP_416095.2 PREDICTED: similar to Protein tyrosine phosphatase, receptor type, B [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABD12154.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG------------------------------------------------------------------------------------------------------ATG------------ATG------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------ATG------------------------------ATG---------------------------------------------------ATG---------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------TAA---------------------------------------------------------------------TAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       bld Fat1      out                       CABC10870.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCAAGCCTTCCTTTGCCATCATATGCAGATTATAAAACAAATAAGTCCACTAAAATTTACCAGACTAGCTACTTTCCAAGTCGATGTGCAGAGAACCCTGACTACAATATCCAGAGTTACAAAATTAAGCTGGGTACAGGAATGGAACTTTTGGGTGGCAAATGTGATCAGAATGAAAATAAATACTGTGATGGACCACTGAGTCCAAGGACATCCTACAGGATAAGTGTCAGAGCTTTTACCCAACTATTTACTGAAGAAATGAGGACATTCCCTGAGCCACTGTATAGTGACACTTTCTTCTCCTTGCCAATCACAACGGAAGCAGAGCCTTTATTTGGTGTTATAGAAGGTGTAAGCGGTGGCATGTTCGTCATTATCATGATCATTGTGCTCACTGTGCTACTCATCTACCGGCAAAAAAAGAAGAGAGTGTATGAGCAGGATCCAATGACCACACATCTGAGTTCACAAATAGAAAGGATTCCATCAGTCCATCTAAATGTTGGCCACATACAAATAGGAGACAGAATCTCATCAAGGCCTATTCTAACTGCCCAGTTTGAAGAACATTTCAGCAAGCTTCAGACCGATTCCAATTACTTGCTTTCTCGGGAGTATGAGAACCTTAAAGATTTTGGTCGAGACCAGTCTTCTGATACTGCCCTTCTCCCAGAAAACAGAGGAAAGAATAGATATAGCAACATATTGCCCTATGATTCCACAAGAGTGAAACTTGCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCG
  3  -1   2       bld Fat1      out                        CABC6597.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TTTTACCCAACTATTTACTGAAGAAATGAGGACATTCCCTGAGCCACTGTATAGTGACACTTTCTTCTCCTTGCCAATCACAACGGAAGCAGAGCCTTTATTTGGTGTTATAGAAGGTGTAAGCGGTGGCATGTTCGTCATTATCATGATCATTGTGCTCACTGTGCTACTCATCTACCGGCAAAAAAAGAAGAGAGTGTATGAGCAGGATCCAATGACCACACATCTGAGTTCACAAATAGAAAGGATTCCATCAGTCCATCTAAATGTTGGCCACATACAAATAGGAGACAGAATCTCATCAAGGCCTATTCTAACTGCCCAGTTTGAAGAACATTTCAGCAAGCTTCAGACCGATTCCAATTACTTGCTTTCTCGGGAGTATGAGAACCTTAAAGATTTTGGTCGAGACCAGTCTTCTGATACTGCCCTTCTCCCAGAAAACAGAGGAAAGAATAGATATAGCAACATATTGCCCTATGATTCCACAAGAGTGAAACTTGCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCANATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCA
  5   1   2       bld Fat1      out                        CABC1819.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTCAATTCGGCACGAGGCACACATCTGAGTTCACAAATAGAAAGGATTCCATCAGTCCATCTAAATGTTGGCCACATACAAATAGGAGACAGAATCTCATCAAGGCCTATTCTAACTGCCCAGTTTGAAGAACATTTCAGCAAGCTTCAGACCGATTCCAATTACTTGCTTTCTCGGGAGTATGAGAACCTTAAAGATTTTGGTCGAGACCAGTCTTCTGATACTGCCCTTCTCCCAGAAAACAGAGGAAAGAATAGATATAGCAACATATTGCCCTATGATTCCACAAGAGTGAAACTTGCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGA
  5   1   2       bld Lun1      out                        CABD7031.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CATCAGTCCATCTAAATGTTGGCCACATACAAATAGGAGACAGAATCTCATCAAGGCCTATTCTAACTGCCCAGTTTGAAGAACATTTCAGCAAGCTTCAGACCGATTCCAATTACTTGCTTTCTCGGGAGTATGAGAACCTTAAAGATTTTGGTCGAGACCAGTCTTCTGATACTGCCCTTCTCCCAGAAAACAGAGGAAAGAATAGATATAGCAACATATTGCCCTATGATTCCACAAGAGTGAAACTTGCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTNCACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAAATCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGT
  3   1   2       bld Te3  PIPE out                        CAAM7180.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTGAAACTTGCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCACTTTCGGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGT
  3   1   2       bld Lun1      out                       CABD12154.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GAGTGAAACTGCCCAACGTTGACGATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGTTAGATTTTCAGTCAAAAAAA
  3   1   2       bld Te3       out                       CAAM14188.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GATGACCCCTGTTCAGACTATATTAACGCCAGCTATATGCCAGGCATCACTTTTCGGAGAGAATATATTGCTACACAAGGGCCCTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGTTAGATTTTCAGTT
  3   1   2      seed Te3       out                        CAAM3013.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCAGACTATATTAACGCCAGCTATATGCCAGGCATCAACTTTCGGAGAGAATATATTGCTACACAAGGGCCTTTACCAGCAACCAAAGATGATTTCTGGAAAATGGTGTGGGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGT
  3   1   2       bld Te3       out                        CAAM1754.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGAACAAAATGTTCACATCATTGTGATGGTGACACAGTGTACAGAGAGAGGACGGGCAAAATGCGATCATTATTGGCCCATGGACCAAGACTCATACTATTACGGAGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGTTAGATTTTCAGTT
  3   1   2       bld Te3       out                        CAAM3059.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGGGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACGGGTTAGATTTTCAGTT
  3   1   2       bld Te3  5g3  out                        CAAM6142.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              AGACCTGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTCTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGTTAGATTTTCAGTTATTTATTTGTCTTTGTCATTTTGTAAGCTATATGTAATTTAAATGTACATTTCATTCTCAGATGTATATATATATATATTTTTTTTTTCTCTCTGTTTCAAGTCTCACATTAAACCACAATCACTAAGCT
  3   1   2       bld TpA       out                   TTpA054n11.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TGATAGTACAAATGCTGTCAGAATCTGTGCTTCCTGAATGGACAATAAGGGAATTTAAAATCTGCAGTGAAGATCAAATTGATGCACCACGACTAGTCCGTCATTTCCACTATACAGTGTGGCCAGATCATGGGGTGCCAGAAACCACCCAATCACTGATCCAGTTTGTAAGAACAGTCAGAGACTATATTAACAGAACTCCTGGAAGTGGCCCTACTGTGGTGCACTGCAGTGCTGGTGTTGGCAGAACTGGCACATTCATTGTACTGGACCGAATGCTTCAACAAGTTGATACAGTGGATTCAGTGGATATATTTGGAGCTGTTAGGGACCTCCGAATTCACCGGATGTACATGGTGCAGACCGAGTGTCAGTACGTCTATTTGTATCAATGTGTAAGAGACGTCTTAAGAGCCAGGAAACTTCGCAATGAACAGGACAATCCCTTGTTTCCAATATATGAAAATGTGAATCCAGAGTATCACAGAGATGCTGTTTATTTAAGGCATTAAGTATTCCTCGGAGACCATCTTTTACAGTGTTACTCTATATTTTCCAAGCAATAAACAGTGCCTGTACTGGTTAGATTTTCAGTTATTTATTTGTCTTTGTCATTTTGTAAGCTATATGTAATTTAAATGTACATTTCATTCTCAGATGTATATATATATATATTTTTTTTTTCTCTCTGTTTCAAGTCTCACATTAAACCACAATCACTAAGCTAAGAAATGTCCAGAAAAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)