Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   0.0    0Xt7.1-CABD11518.3                          10 END     1           2       10                Haghl protein [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 185.0    0Xt7.1-XZG36032.5.5                         25 PI      81       1490     1689                (no blast hit)
     3 176.0    0Xt7.1-CAAJ727.3.5                           6 PI      89       1483     1611                (no blast hit)
     4 183.0    0Xt7.1-XZT55151.5                            3 PI      90       1489     1618                (no blast hit)
     5 181.0    0Xt7.1-XZT47276.5                            3 PI      90       1490     1618                (no blast hit)

 This cluster: approximate FL confidence score = 91%

 1012080275 Xt7.1-TTpA011l22.5 - 35 ESTs
                                                                       .........-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720......2730......2740......2750......2760......2770......2780......2790......2800......2810......2820......2830......2840......2850......2860
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTpA011l22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CTAGAGTGCAGCCCCGCCCTCCCAGGATGATGCTGTTTGGGTGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTCTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTTACCCCCATATGTAATAAAAGGCACTAAGTTTGCCCAGTAGCAGTAACCCATAGCAACCAATAAGATGTTTGTTTTTAAACAGGTGACTAGTAAATTCTACCTACTGATTGCTGTGGGTTACTGCTCCTGGCCACTTAGGGGTGTATTTATTAACACTGGAGACAAACCTCACCAGTGATGTTGCCCATAGCAACCAGTCAGCAATTAGATATGGACGATCACCTACAAGCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTTTAGGAAACAAAGGCAAAGATCTGATTGGTTGCAATGGGCAACATCACCGATGATGTTTGTGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGTAAAAAAAAAAA
                                                  Xt7.1-CHK-1008227366                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TGCAGCCCCGCCCTCCCAGGATGATGCTGTTTGGGTGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTTTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTTACCCCCATATGTAATAAAAGGCACTAAGTTTGCCCAGTAGCAGTAACCCATAGCAACCAATAAGATGTTTGTTTTTAAACAGGTGACTAGTAAATTCTACCTACTGATTGCTGTGGGTTACTGCTCCTGGCCACTTAGGGGTGTATTTATTAACACTGGAGACAAACCTCACCAGTGATGTTGCCCATAGCAACCAGTCAGCAATTAGATATGGACGATCACCTACAAGCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTTTAGGAAACAAAGGCAAAGATCTGATTGGTTGCAATGGGCAACATCACCGATGATGTTTGTGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         3     4     3     4     3     4     3     4     4     5     4     5     4     5     4     6     3     5     5     6     5     6     5     6     5     6     5     6     5     7     5     7     5     7     5     7     5     7     6     8     6     8     6     8     6     8     6     8     6     8     7     9     7     9     7     9     8    10     8     9     9     9     8     9     9     9     9     9    10    10    10    10    10    10     9    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    10    12    10    12    10    12    12    13    12    13    12    12    11    11    11    12    12    12    11    11    11    11    11    11    11    11    11    11    11    11    12    12    10    10    10    11    10    11    10    11    10    11     9    10     9    11     7    11     7    11     8    11     9    11     8    11     8    10     8    10     8    10     7     9     7     9     8    10     8    10     7    10     7    10     7     9     7     9     8    10     8    10     8    11     9    11     9    10     9     9     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     7     9     7    10     7    10     7    10     7    10     9    11     9    11     8    12     8    11     9    11     9    11    10    12    11    13    11    13    11    13    11    13    11    12    10    11    11    12    12    12    13    13    13    13    13    13    11    11    11    11    12    12    12    12    12    12    12    12    11    12    12    12    12    12    13    13    13    13    13    13    13    13    13    13    11    13    12    13    13    13    12    13    12    13    12    13    11    13    11    13    12    13    11    12    12    13    11    12    12    12    12    12    12    12    12    12    11    12    12    12    12    12    12    12    12    12    12    12    12    12    11    12    11    12    11    12    11    12    12    13    11    12    12    13    12    13    11    12    10    11     8    10     7     9     7     9     7     9     6     9     2     2
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                -------T----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            -T----------
                                               BLH ATG      29     111                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MIN      29     119                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH MPR      29     119                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR      26     132                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG      26      13                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 7e-016     CAJ81741.1 ethylmalonic encephalopathy 1 [Xenopus tropicalis] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Sc ---- 1e-042     NP_010558.1 Cytoplasmic glyoxylase-II; Glo2p [Saccharomyces cerevisiae] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                PROTEIN --- Ce ---- 5e-065     NP_496556.1 Hydroxyacylglutathione hydrolase (28.9 kD) [Caenorhabditis elegans] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Dm ---- 2e-091     NP_730569.1 CG4365-PB [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Sp ==== 4e-097     XP_783848.2 PREDICTED: similar to hydroxyacyl glutathione hydrolase [Strongylocentrotus purpuratus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 9e-127     NP_077246.1 hydroxyacyl glutathione hydrolase; glyoxylase 2; glyoxalase II; round spermatidprotein RSP29 [Mus musculus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Dr ==== 4e-130     NP_956337.1 hypothetical protein LOC336977 [Danio rerio] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 6e-132     NP_005317.2 hydroxyacyl glutathione hydrolase isoform 1 [Homo sapiens] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN === Gg ==== 1e-142     NP_001012807.1 hydroxyacyl glutathione hydrolase [Gallus gallus] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Xl ==== 5e-148     AAI08581.1 MGC131075 protein [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = ?? ==== 5e-148     NP_001089873.1 hypothetical protein LOC734940 [Xenopus laevis] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                    Xt7.1-TTpA011l22.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ATGATG---------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------ATG---------------------------------------------TGA---------------------------------------------------------------------------------TAA---------------------------------------------TGA------------------------------------------------------------------------------------------TGA------------TAA------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------TAAATG------------------------------------------------------------------------ATG---------------------------ATGTAATAA---------------------------------TAG------------------------------TGA------------------TGA---------------------------------------------------------------------------------------------------------------------------TAA------------------------------------ATG---------------------------------------------------------------------------------TGA------------------ATG---------------------------------------------------------------ATGATG---------------------------------------------------------TGA---------------------------------TAG------------------TGA---------ATG---------------------------------------------TAA---------------TAA------TAA---TAATAA---------------------------------------------TGA---------------------------ATG------------------------------TAA---------------------------------------------------TAATGA---TAG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Egg  FL                     TEgg086m16.FL-Sanger                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTCTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTTACCCCCATATGTAATAAAAGGCACTAAGTTTGCCCAGTAGCAGTAACCCATAGCAACCAATAAGATGTTTGTTTTTAAACAGGTGACTAGTAAATTCTACCTACTGATTGCTGTGGGTTACTGCTCCTGGCCACTTAGGGGTGTATTTATTAACACTGGAGACAAACCTCACCGGTGATGTTGCCCATGGCAACCAGTCAGCAATTAGATATGGACGATCACCTACAAGCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTTTAGGAAACAAAGGCAAAGATCTGATTGGTTGCGGTGGGCAGCATCGCCGGTGATGTTTGTGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAAAAAAAAAAAAAAAAA
  5  -1   0       add Te5       out                       CAAO11530.5p CGTTGTTGGAACGCACACTTTTGGATCTGCGGTCCATTCATTGACGTGAGTGGAATATGCTTAGGCGGCCATTTTTGTTTGGGGCAAAAGCCGCTTACTGTAGTTTAGTTTGTGAAGCGATAGACTCAAACCCGATTCTAATTATTCCCACGATACAGCGACAGATCAATTTGTCTGTTGTCAGGCGACACAACAACAAACAAATTCCCAAGTAAAAAAAAAGTAATGTTCCCATTTTTTTTGTTTCACGTTTCCATTTTTTTATCATATTTTTGTGAGGCGTTAGTTGTTATTGACGTAGTTATAACACATATTGGGCATTTTCCCTTACGATGCATGGCGGAATGAGGCTTAAGGCATTTTGCGCTTCCGGCATCTTTTAAGGCGTTCGGCGACTTGATTGGTTGGTTTCGGTAAGACGTCAGCCTGGTTGGCAACATGTGCCCTTTCTGGTGTAGCGGGCCCGTTTGGTTGGCGGAGGATATCTCGCTGCTGATTGGCTGCCTCTGGAACGGCGAGACAGATAAAAACCCACGCGTGTGGAAAAACCCACCCGAAACGAGAAGCGTTTTCAATTGGCTAGAGTGCAGCCCCGCCCTCCCAGGATGATGCTGTTTGGGTGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGTATGTGGCTGTGGGGCAGGAAGTAACCCAATTCACACTTTATATAATGCACAGGCGGCCCCCCTGCTGCTATGGCGCT
  5   1   2       bld Spl1 5g3  in                         CABK4337.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AAAAACCCACCCGAAACGAGAAGCGTTTTCAATTGGCTAGAGTGCAGCCCCGCCCTCCCAGGATGATGCTGTTTGGGTGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTCTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCG
  5   1   2       bld TpA  5g3  in                   TTpA043c07.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 GAAGCGTTTTCAATTGGCTAGAGTGCAGCCCCGCCCTCCCAGGATGATGCTGTTTGGGTGCACGACAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCTGCTCATCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAAAAACTCCTAGGTGGTCACTCATTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAATAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAATAAAGAAACATGGAGTTAAATTGTACCACTCGTCCTTACAACACACCACCGCTGGGATCACGCTGGCGGAAATGACAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCATAATTGGGGCACTAACACATAAAGTTTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCATGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGATACGAGAGTCTACTGTGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATG
  5   1   2   12  bld Gas7 PIPE in                         XZG58645.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................AGCGTTTTCATTGGCTAGAGTGCAGCCCCGCCCTCCCAGGATGATGCTGTTTGGGTGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTTTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGANACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTNTATCCTTTTATGAGAGTG
  5   1   2       bld Brn4      in                        CAAL12221.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TGCAGGAGAAGTCTGTGGTGCGCACTGTCCTTCCTGGGTGCTGCGGCTGGCTACAGAGTCGGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTTTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGTGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTG
  3  -1   2       bld Liv1      in                         CAAR4355.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CAAGGTGGAAACCTTCCTTGGTAAGAGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTCTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTA
  5   1   2       bld Egg  FL                        TEgg086m16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TCGGCTCAGCCTATTTAGGGACTAGTGTCCTGCAGAATCAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGTTGTGGACGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTCTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGATAAGACGATAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGC
  5   1   2       bld TbA       in                   TTbA041b21.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCTCAGCCTATTTAGGGACTAGTGTCCTGCATAATAAACGCCGTTTGAGCTCAGAAACTCCAAGGTGGTCACTCAGTGCACCATGAAGGTCGAGCTGATCCCGGCCCTCACTGACAACTACATGTACCTGCTCATTGATGAGGAGAGCAAAGAGGCAGCCATTGTGGATCCCGTGCAGCCCCAAAAGGGATCTCGCTGGCGGAAATGAGAATCTTGTGAAGATGGTGTCTGGTTTATAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTTTCTCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCTACAGCACCGAGCCACCCTCAGTGTTCACAGGTGATACCCTCTTTGTGGCATGATGCGGGAAGTTCTTCGAATGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGTGGCCACGAGTACACAATCAACAATCTCTAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAANAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTA
  5   1   2       bld TbA       in                   TTbA018g22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTACATGTACCTGCTCATTCATTACGAGAGCAAATAGGCAGCCACTGTGGATCCCGTGCATACCCAAAATGTTCTGGACCCATTATAGAAACATAGACTTAAATTGAGCTCTGACCTTACAACTACACCAC
  3   1   2       bld Gas7 PIPE in                         XZG58645.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGCAGTAAAGAAACATGGAGTTAAATTGACCACTGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTTTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAAT
  3   1   2       bld Spl1 5g3  in                         CABK4337.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TGTCCTTACAACACACCACCACTGGGATCACGCTGGCGGAAATGAGAAGCTTGTGAAGATGGTGTCTGGTTTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTCTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGCCCTCAGCTTCCCGGCTGTAGTGAGAACCACCAGTGCCTACAATAAACTGCCTCGACTCCTGCAGTCTTCACGGTCCGTCCTTCCGTCCTGGGCTAACTGGCAGCCTTATCCATAACCCAAGCTACGACAGAGGATTCGCTCTGACCTGGGCGCTGACAGAAGGAACACATCGATGATTCCGTCTACTTAATAATTGCACTGGAAATTCATTTTGTTTCTTTGTAAATAAATTCAAATTTGCCCTT
  5  -1   2       bld Liv1      in                         CAAR4355.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TTAAAAGTATACGGAGGGGACAGCAGAATTGGGGCACTAACACAGAAAGTCTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGCGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGCCCTCAGCTTCCCGGCTGTAGTGAGAACCACCAGTGCCTACAATAAACTGCCTCGACTCCTGCAGTCTTCACGGTCCGTCCTTCCGTCCTGGGCTAACTGGCAGCCTTATCCATAACCCAAGCTACGACAGAGGATTCGCTCTGACCTGGGCGCTGACAGAAGGAACACATCGATGATTCCGTCTACTTAATAATTGCACTGGAAATTCATTTTGTTTCTTTGTAAATAAATTCAAATTTGCCCTTTT
  5   1   2      seed TpA       in                   TTpA011l22.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CTAAACAGAAAGTTTCCCATCTAACCACCTTCCAGGTGGGATCCCTCCACGTGAAATGTCTCTATACCCCATGCCACACGTCGGGGCACATCTGCTACTATGTCACAAAGCCCAACAGCACCGAGCCACCCGCAGTGTTCACAGGTGATACCCTCTTTGTGGCAGGATGCGGGAAGTTCTTCGAAGGGACACCAGAGGAGATGTACGCTGCCTTGATTGAGGTCTTGGGCCGCCTTCCACCTGAAACGAGAGTCTACTGTGGCCACGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGC
  5   1   2       bld In60                            IMAGE:8950756.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTCATTCTTACCCCCAAAAAAAAAAAAAAAAAACGTCCCCGAGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGAAACGTTCTTCCGGTCGTGTCAGTCGCTTGACTTGACTGTCTGAGCGTGCTGCTAGATGTAAGTCTGAACACTTTTACCCCCATTTTGTAATAAAAGCACTAGTTTGGCCAGTAGCAGTAACCCATAGCACCATAAGATGTGCTTTTAACAGTGACTAGTAGTCACTACTGGATGCTAGTACTGCTCTGGCACTAAGGTCTATTATAACCTGGAAACAAAACCGTTAGCACAGAAT
  3   1   2       bld Gas       ?                     TGas115l19.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     AGTACACAATCAACAATCTCAAGTTTGCGCGGCACGTGGAACCATGCAATGACGCAATAAAACAAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTTTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTTACCCCCATATGTAATAAAAGGCACTAAGTTTGCCCCCAGTAGCAGTAACCCATAGCAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       in                   TTpA066h11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCGGGATAAACAAAGTTGGCTTGGGCGAAGGAGACTTACAACAGTGGAGAGCCTACTATCCCTTCTACTCTTGCCGAAGAATTCACATTTAATCCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTtacccccatatgtaataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgactagtaaattctacctactgattgctGTGGGTTACTGCTCCTG
  5   1   2       bld Tad5      in                         XZT48136.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCTTTTATGAGAGTGAGAGAGAAGTCGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTtacccccatatgtaataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgactagtaaattctacctactgattgctgtgggttactgctcctggccacttaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCTA
  5   1   2       bld Int1      in                        CAAP12915.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CGGTGCAGGAGCATGCTGGGGAACGAGACCCCATCTCTACGATGGGAGCGATCCGTAAGGAAAAAGATCATTTCAAGGTGCCAAAAGACTGAAAAAAAAACAGAATTTCCTTTTTGTGTCTCACCAGCAGCTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTGCACTAATTATTTGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTtacccccatatgtaataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgactagtaaattctacctactgattgctgtgggttactgctcctggccacttaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCT
  5   1   2       bld TpA       in                   TTpA066h08.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AAAATATCATTTCAAGGTGCCGTATGACGTGAAAGATATCTGATTTTCCTTTTTGTGTCTCACCTTCTACTCTACCCCCCCTTATTTTGTGGGACGCTGACCCTCTCTTG
  5   1   2       bld BrSp                             EC2BBA35BF05.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GGGTTATTTATCCTCCCTTTTAGAACATTTATTTTGCTATTGAATTACAAAAGCAGGGGAAAAGCATTGGTCGGACCGACTGGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTtacccccatatgtaataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgactagtaaattctacctactgattgctGTGGGTTACTGCTCCTGGCCACTTAGGGGTGTATTTATTAACACTG
  5   1   2       bld AbdN      in                       IMAGE:7007233                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGATGCCAATCCCTGGCCTGTGCATACAGTGGGGAGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTtacccccatatgtaataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgactagtaaattctacctactgattgctgtgggttactgctcctggccacttaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTGTTAGGCATGATGTTGCCCCACCCAANGTGGGGCATAATCAGGGGTAAGAATTCGCCTCGTTTTGTCCCTTGNCAAAAT
  3  -1   2       bld Neu       in                    TNeu092e01.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TTCTCTGGATTTTCCCCTTTCCTGGGTGATTGCTGTTCAGATAACAATTAGGGCGGGTGGAGAATCCAGTAAGCCAAGGACTGCAGGGCATTGGCCCAAGTACACAGGCCACTGTGATGCCATTGCTGGCCCGAGGGCTAAACACTCAGCAATATGCGTCCCAAACAAGTTCCAAACAAGGATGCCTATATATCAGCTTGGATTTCATTCAGACCAAACCATTATAAATGCTACTTCAGGGAACGTTCTTCCGGTCGTGGTCAGTCGGCTTGACTTGGACCTGTCTGAGCGTGGCTGCTAGGATGTTAAGGTCTGAACACTTTtacccccatatgtaataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgactagtaaattctacctactgattgctgtgggttactgctcctggccacttaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGNGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCT
  3   1   2       bld AbdN      in                       IMAGE:7007233                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TTTGGACCCTGTCTTTAGCGTGGGCTGCTAGGGATGTTAAAGGTTTGAAACACTTTTACCCCCCCATATGTTAATAAAAGGCACTAAGTTTTGCCCAGTATGCAGTAACCCCATAGCAAACCAATAAGGATGTTTGTTTTTAAACAGGTGACTAGTAAATTCTACGTACTGATGGCTGGGGGTTACTGCTACTGGCCACTTaggggtgtatttattaacactggagacaaccctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTGTTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTATGCG
  3   1   2       bld Brn4      in                        CAAL12221.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GAGCGTGCTTGCTAGGATGTTAAGGTCTGAACACTTTtacccccatatgtataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgactagtaaattctacctactgattgctgtgggttactgctcctggccacttaggggtgtatttattaacactggagacaaacctcaccggtgatgttgcccatggcaaccagtcagcaattagatatggacgatcacctacaagCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGT
  3   1   2       bld TpA       in                   TTpA066h11.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         catatgtaataaaaggcactaagtttgcccagtagcagtaacccatagcaaccaataagatgtttgttnttaaacaggtgactagtaaattctacctactgattgctgtgggttactgctcctggccacttaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGTAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA041b21.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               tttgcccagtagcagtaacccatagcaaccaataagatgtttgtttttaaacaggtgagtagtaaattgtacataaagattactgtgggataaagctcctggccacttaggggtgtatttattaacactggagacaaacctcaccaggtgatgttgcccatggcaaccagtcagcaattagatatggacgatcacctacaagGTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATATGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGGTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACGTATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAAATAATTAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Tad5      in                         XZT48136.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ACAGGTGACTAGTAAATTCTACCTACTGATTGCTGTGGGTTACTGCTCCTGGCCACTTaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGT
  3   1   2       bld Int1      in                        CAAP12915.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            AGTAAATTCTACCTACTGATTGCTGTGGGTTACTGCTCCTGGCCACTTaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacaagCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGT
  3   1   2       bld TpA  5g3  in                    TTpA043c07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     TGGGTTACTGCTCCTGGCCACTTaggggtgtatttattaacactggagacaaacctcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctCCAAGCTAAGGTGGCCATCCAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCTTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtTTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGGTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACAGTATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Neu                            TNeu024p20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GAGACAAACCtcaccagtgatgttgcccatagcaaccagtcagcaattagatatggacgatcacctacAAGCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTGTATTAATTAAACTGTAATTTATGTCTTTTGCTTAA
  3   1   2       bld TpA       in                    TTpA011l22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GCCCATGGCAACCAGTCAGCAATTAGATATGGACGATCACCTACAAGCTAAGGTGGCCATACAAGGGCAGTTTTCAGCTGCCCGTGTATGGGGCCCTCCAACAGGCCTCCCCGACCAATATCTGGCCTAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCCTATGCCCTTCATTGGCCCTAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGTAAAAAAAAAAAAAAAAAA
  5  -1   2       bld Neu       in                   TNeu092e01.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CAGTTTTCAGCTGCCCGTGTATGGGGCCATCCAACAGGCCTCCCCGACCAATATCTGGCATAAAATTGGCCAGATGTCGATCAGATAGGCTTGTTTTTTTAGTGTGATTGGGGACCACATCATTGATGCGGCCCTTGCTCCAAATTTTCATATGCCCTTCATTGGCCATAGGGCCAAACGATTGTATTAGCATGATGTTGCCCACCCAAGGTGGGCATATCAGGGGTAAGATTCGCTCGTTTGTCCTTGCCAAATGAGCAGATCTTACCGTGTATGGCCACCTCCCCCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTAGTCTTTT
  3   1   2       bld TbA       in                    TTbA018g22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGATCAGATAGGATTGTTTTTTTAATGTGAGTGGGGATCACATCATTGATGTGGCCCTTGCTTAAAATTTTCATTTTCCCTTCATAGGCCTTGGGGCCAAATTATTGTATTAGCATGATGTTCACCACCCAAGGGGGACAAATCAGGGGTTAGATTAACTAATTTTTCCATCCCAAATGAGCATATAATGCAGTGTGTAGCCTCCTCACCCATTAGGAAACAAAGGCAAAGATCTGATAGGTTGCAATGGGCAACATCACTGATGAAGTTCGTGTCCAATGGGTTGGCAGTATATAAATTACAGAAAAGAAGATAATAAAATGATGTTATTAAATACACCCCGGAGTAAGCCACAATAGCTTGTATAACCGTGGAGGAGATGAACCTCTTTGCGGATGATCAAATTTGGAATGAATGCGCGGACATAGATCTGCTTTATTAATTAAACTGTCATTTAAGTATTCGTTTATATAAAGCACATACAAAGATATTTATATATAATGAGGGTAGGGGAATGGTCAAAATAATGTAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TpA       ?                    TTpA063j04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCTTACCGTGTATGGCCACCTCCCCNCTttaggaaacaaaggcaaagatctgattggttgcaatgggcaacatcaccgatgatgtttgtGTCCAATGTGTTGGCAGTATATAAATAACAGAAAAGAAATAAATAAAATAATGTTAATAAATACACCCCCGAGTAACCCCAATAGTGTGTGTGACCCGGAGGTGCTGAACCCTTTGGCGGCTGAACAAATCTGGCATGACTGCGCGCACATATATATGCTTTATTAATTAAACTGTAATTTATGTCTTTTGCTTAATAAACATATATATAAATATTTATATATAATGAGGGTAGGAGAATTGTCAAAATAATGTAAAAAAAAAAAAAAAATGCTGCCTTTGAAAATTCAGCATTGTGGGGGGTTTTGATTGTGTAATTGCTCCATGCGTCTCATTGGCTCATCTCTTTTTCATTGTTCTTTTATATTAGTGCTCATATAGTGAATTAGGGGCAAATCACCTCTATTTCTGCTTACAGCTTATTTCCAAAGGCAGAAAGCTGTGTGACAGTCAGTAGCACCGCGGGTACAGTTTGTGCCTGGCAACTGGGGGCCACAGTGTGTACCCCCTTATGCTTTATCACAAGGCAATAGCTGCCTATACCAGTGCACATGGGTGCAGCAGGGGCAGGGCACAGGGTGGCAATGCCCAGGCACAAGAACTATTTATTACCATTTGCCCCACGGCATAGTCACTCAGTCCCCCATGTCCTACACCAGCAGCGTTTGCTCAGCCAGAACGCCACGTTTGATTGTATGCCATTATTCTTTCTTTACTTGAATGTATAGGAGCCAGAGGCAGTGCCCAGGGGATTCTCTCTAACCCTCTATACCACTTC
  3   1   0       add TpA       in                   TTpA066h08.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ATAAAATAATGTGAAAAAATACACCCCCGAGTAACCCCAATAGTGTGTTGACCCGGAGGTGATTACCCTTTGGCGGATGAACAAATCTGGCAAGAGTGAGCGCACATATATATGCTTTATTAATTAAACCGTAAATTATGTCTTTTCCTTAATAAACATATATATAAATATTATATATAATGAGGGTAGGGGAATTCTCTAAATCATGTAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)