Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CBST7543.3                           23 END     2          14        8                (no blast hit)

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 480.0    0Xt7.1-CABE1189.3                           38 PI      81        373      930                hippocalcin [Xenopus tropicalis]
     3 324.0    0Xt7.1-TGas054a12.3                         21 PI      76        370      953                neurocalcin delta [Homo sapiens]

 This cluster: approximate FL confidence score = 97%

 1012080304 Xt7.1-CABE12196.5 - 14 ESTs
                                                                       -240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABE12196.5                                                                                                                                                                                                                                                 CAGGGGACCCTCCGTGTAAGCCTCTCGGCACTGTGTGACACCCGGGCTGCAAACTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCAAATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAATAGATATAT
                                                  Xt7.1-CHK-1008233327                                                                                                                                                                                                                                                       ACCCTCCGTGTAAGCCTCTCGGCACTGTGTGACACCCGGGCTGCAAACTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCAAATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAATAGATATATCTATAC
                                                      consensus depths                                                                                                                                                                                                                                                      2     3     2     3     2     3     2     3     2     3     3     4     3     4     3     4     3     4     3     4     3     4     3     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     7     7     7     7     7     7     7     7     8     8     9     9    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     5     7     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     6     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     2     2
                                               BLH ATG     373    1102                                                                                                                                                                                                                                                 
                                               BLH MIN     373     110                                                                                                                                                                                                                                                 
                                               BLH MPR     373     110                                                                                                                                                                                                                                                 
                                               BLH OVR     373    1100                                                                                                                                                                                                                                                 
                                               CDS MIN     373     110                                                                                                                                                                                                                                                 
                                               ORF LNG     373      32                                                                                                                                                                                                                                                 
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               PROTEIN --- Bf ---- 4e-058     AAP78742.1 frequenin-like [Branchiostoma floridae] -----===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Ce ==== 4e-062     NP_508186.1 neuronal Calcium Sensor (22.0 kD) (ncs-1) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Sp ==== 4e-097     XP_783112.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ==================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Dm ==== 2e-097     NP_788543.1 Neurocalcin CG7641-PA [Drosophila melanogaster] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PREDICTED = Dr ==== 3e-105     NP_957017.1 hypothetical protein MGC73126 [Danio rerio] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Mm ==== 2e-106     NP_057886.1 hippocalcin-like 1; neural visinin-like protein 3; visinin like 3; neuralvisinin-like 3 [Mus musculus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Hs ==== 2e-107     NP_002140.2 hippocalcin-like 1; visinin-like protein 3; calcium-binding protein BDR-1 [Homosapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Gg ==== 4e-109     NP_990565.1 hippocalcin-like 1 [Gallus gallus] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xl ==== 1e-109     AAH77976.1 Hpcal1-prov protein [Xenopus laevis] ====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === ?? ==== 1e-109     NP_001087067.1 hippocalcin-like 1 [Xenopus laevis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN === Xt ==== 8e-110     CAJ82665.1 hippocalcin-like 1 [Xenopus tropicalis] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CABE12196.5                                                                                                                                                                                                                                                                 TAA---------------------------------------------------------------------------------------------------------------------------------TAG------------------------------------------TGA------------------TAA------------------------------TAA---ATG---------------------------------------------------------TAA------------------------------------------TAA------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATG---------------------------ATG------------ATG---ATG---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------TAG---------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------TGA------------------------TGA---------------------TAA------TAA------------------TGA------------------------------------------------------------------TAATAATAAATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ]
  0   1   1           Brn3 FLsh                        CAAK7002.FL-MGC ATCGCTGAGCGCTGCTTCAGTCTAGCTTACCTCCTACAGGAGGAAGGCGGCTATTTCTACAAGTGATTTACCCCCCTCCGCTGGGCATTGGGGTTGGGACGCACTATTGTAATATTCCATTGCGCGTAGGGCGCTGTTGGTCCGCTCCGGTGTCTCCTCCTCACTATGCAAAGTGCCCGGACTGGCCGCTGCCAGCGCTTGTACGAACTATGTGCTCAGTGAGAGAGAGCAGCCAGCCAGCAGGGGACCCTCCGTGTAAGCCTCTCGGCACTGTGTGACACCCGGGCTGCAAACTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGATAGGGCAATTATTGGGGCAGGTTTTTTACTTAAAAATTTTTACTGTTACTTTTCCTTTAAAGACACAAGGAAATTCATAAATTTCATATTTACAGCGCCTCTGGCTGGAAGTGCCTGCTGCTGACTTAGCTGAGAGGGCCCTTAGCCGACGCACAGCAAATCAACCTGCAGAAATTGTAACATAAATATATGTATAAAATGTAAACTTGATAGTGAAACACGAGATTAATAAAAATGGAGGATAATTCCATGACCGCTCCCAGTTAGTGAGTAAATATACTTTAAACTGAACCCCCTTGACTTCTTCTTATGCTGAAAATCATGTGCACTTAGTGTTGTTAGGCCTGGCTTGAGAGATGCAGACTAGAACGGTAACTAAAGTAGCGCACGTGATTCTGTGTAAGGAGCAATCAATGGAGCCAATGACAGCGCCCCATTAGAAAGTGTTTATAGGGGACCTGTCACCCTAAGAAATAATTCCCAATCCTTTTTTATCATGTTATGGTGCCCATACACGTGAAGATCTGCTCGCTTGGCGAAGTCGCCAAGCGAGCGGATCTTCTGCCGATATCCCCATCTACAGGTGGGCGATATTGGGAAAATGTAGGCTAAATTGATCATTTGGCCCTGGGGCCAAACAATCGAATTACAATGGTGGCAATGGGGCAGTCGGTTTGGGGACTGCATCAACGAGCCAATGCGGTTCCCGATCCGACTAAATCTTTTAACCTGCCCGATCGATATCTGGCCAATTTCAGGCCAGATATTGGTCGGCCACGCCCCACGTTCCTGTCTCTACACGGGCAGATAAGCTGCTGAATCGTTCCAAGGGACCAATATCGGCAGCTACAATCGGCCCGTGTATGGGGACCTTAAGTTGAGTAAAATAAACTTTACTTACACTATGTAAATATTTTTTTTTCGTTTTCCCTTTAGTCTTGGAACTTACAATCATAGCCAGCAGGCCGGCGCCATTTTAAAGATAATGTTATTAAGGCAAGATTTTTATCGCCCCAAAATTGCATGCATTTGCCATGTAGGTGATATCTAGGAAGTGCTAAATGGAAAGTAATTGTAATTAAAAGTCTGAGCTGTCAATCATGTGTTGCCTGCCCCGCCTCTATGCCGAAGGCATGGAGGCGGGGCAGGCAGTGTGTGATTGACAGTTCAGATTTTTAGATATATTTAGAACAGGTATAGATGATTTAATTAAAAAACTTATTATACAGCTTTTTATGTGTGGGCGACAGGTTCCCCTTTAAAGACACAAACATTTGTTTTAACACCAGGATAGAAAGATGCCGACTAGAAAAGTATCTAGAACAAGTCCCAAGGAGCAGTGAAGAAAGGTATATAGTTGTACAGTGAGTCTGAAGGAATTCATTTTTAGCTGAAATTCCCTTTACTGCTGGATTTAGTTGTACAGCGCCCCCTTGTGTTTGTTCCCATAATGAGCCCAATCAGGATCGCACACTGTCGCTGTGATGATTCATGTACATTGGGCGTTATCGCTGCATGAGTGTTTGTGTCAGTACTGAATGCTAACGTTTTGCTGAACGGACAGTTTTGTCACTTTCCGGAGCCAATTACGCTTGAGAATATAAAGATATTCCGCCAGGTGCTTCTCTGTAACACTTACACCCCTTTCCTCCCCCCCCTCCCCTATGAATTGTGACTCGGAAATGAACTGGATCAATTCCACAGCTTTTACTGTCATAAACTTTGCTTTAAATCGCGATGCTCTTGCTGTCAGAATTAACAAACAAAAGAGAAAAAACCTAAAAAAATACAAATGTCTTGTGCATTCCAGTGTTACGTAATAACTGCCTGATGCCAAGAACTAATATTGTTTTAAATAAAATACCGTTGGATGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  0   1   1           Neu  FL                     TNeu142p12.FL-Sanger                                                                                                                                                                                                                                             CCAGCAGGGGACCCTCCGTGTAAGCCTCTCGGCACTGTCTGACACCCGGGCTGCAAACTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTCCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCAAATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAATAGAAAAAAAAAAAAAAAAAA
  5   1   2       bld Brn3 FLsh out                        CAAK7002.5p  ATCGCTGAGCGCTGCTTCAGTCTAGTTACCTCCTACAGGAGGAAGGCGGCTATTTCTACAAGTGATTTACCCCCCTCCGCTGGGCATTGGGGTTGGGACGCACTATTGTAATATTCCATTGCGCGTAGGGCGCTGTTGGTCCGCTCCGGTGTCTCCTCCTCACTATGCAAAGTGCCCGGACTGGCCGCTGCCAGCGCTTGTACGAACTATGTGCTCAGTGAGAGAGAGCAGCCAGCCAGCAGGGGACCCTCCGTGTAAGCCTCTCGGCACTGTGTGACACCCGGGCTGCAAACTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTA
  5   1   2       bld Egg  5g                        TEgg093p05.p1kSP6                                                                                                                                                             TCCTCACTATGCAAAGTGCCCGGACTGGCCGCTGCCAGCGCTTGTACGAACTATGTGCTCAGTGAGAGAGAGCAGCCAGCCAGCAGGGGACCCTCCGTGTGAGCCTCTCGGCACTGTGTGACACCCGGGCTGCAAACTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCGTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACGCAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCAGCGGGCACTTAACCGTCGAAGAATTTAAAAAGATGTATGCCAACTTCTTCC
  5   1   2       bld Neu  FL                        TNeu142p12.p1cSP6                                                                                                                                                                                                                                             CCAGCAGGGGACCCTCCGTGTAAGCCTCTCGGCACTGTCTGACACCCGGGCTGCAAACTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTCCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCCAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACA
  5   1   2   10  bld Te1  5g3  in                        CBWN17020.b1 .....................................................................................................................................................................................................................................................................................................CTTGCCTGTACCGCCTGTACTCTCCCAGCCCTGCCTGCCTGCCTCTGGGTGTGTGGGGGGAGCCTGTCCGACCGCAGGTGGAACTCTGGGCGCCATAGAGTGGAAGTCAGACACATCGCAGTGACTGCTGGAGGGACGAGTGAACTTACCGGCAACTGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGTAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAA
  5   1   2   14  bld Brn3 5g3  out                       CAAK11050.5p ................................................................................................................................................................................................................................................................................................................................................................................CATCGGTCCGGGGGCCGCCGGGCTCCTTAGGGGCGAAACAGGGGATTCATGAGTTGTAGTTTAACAACAGCTGGAAGTTACAGACATAAGCGCATTATTTACAAGAGGGAACTGAGTTCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTANAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATG
  5   1   2   10 seed Ova1 5g3  in                          CABE687.5p .....................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTAATGCATGAGAGCACCCTATCTGCATGTACGGATCATTGTCCCTTCCGGCATCCAGCTAACTTTCTAACTACCAGACGTCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTAT
  5   1   2   10  bld Ova1 5g3  in                        CABE12196.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................TCTTCATCTGCATTACATTTAGACTTGGGCACTAAATAAGCTGCAGAATGGGGAAACAGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCCTGCCTGNATCTCTACACGTGA
  5   1   2       bld Brn4      in                        CAAL18311.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AGAACAGCAAGCTACGGCCTGAGGTGCTGCAGGATCTCCGGGAAAACACAGAGTTCACAGACCACGAACTGCAGGAATGGTACAAAGGGTTCCTGAAGGATTGTCCCACCGGGCACTTAACCGTCGAAGAATTTAAAAAGATCTATGCCAACTTCTTCCCGTACGGAGATGCCTCGAAGTTTGCAGAGCACGTGTTCCGTACGTTCGACACTAACGGGGATGGGACAATAGACTTCCGGGAATTCATCATCGCCCTTAGTGTCACCTCCAGGGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGAACTATGTTTACATGCAGATACAAAGGACTTGTACCCCT
  3   1   2       bld Ova1 5g3  in                        CABE12196.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGGAAGCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCAAATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAATAG
  3   1   2       bld Ova1 5g3  in                          CABE687.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GCTGGAGCAGAAGCTGAAATGGGCGTTTAGCATGTACGACCTCGACGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCAAATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAATAGATATATCTATACAC
  3   1   2       bld Brn4      in                        CAAL18311.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGGCAACGGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCAAATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAAT
  5   1   2       bld Gas7      out                        XZG62818.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGCTACATCAGCCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCANATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAATAGATATATCTATACATATTTGTTTATTGTATATTTC
  3   1   2       bld Te1  5g3  in                        CBWN17020.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    CCGCGGGGAGATGCTGGAAATTGTGCAGGCAATATACAAGATGGTCTCATCAGTGATGAAAATGCCAGAAGATGAATCCACTCCAGAGAAAAGAACAGACAAAATATTTAAGCAAATGGACACAAATAATGATGGTAAACTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTACAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTTGTAACAAAAATTAACCAATCTAAGTGATATGGACTCAATTTTGAAAGCACAAGAGTATAACGTTTTGGATTTTTTGCTTCTTTTTTGAAGCAAATTGCTTCAAAGTTCTTTAATAATAAATGTCTTATATATATAGAAATAGAAAAAAAAAAAAAAA
  3   1   2       bld Gas0                                 dad18f04.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TCATCAGTAATGAAAATGCCAGAAGATGGACCCATTCCAGAGAAAAGACCAGCCAAAATATTTAAGCAAATGGACACACATAATGATGGTAACCTTTCCCTTGAAGAATTTATTAAAGGTGCCAAGAGCGACCCTTCGATTGTACGATTGCTCCAGTGTGATCCAAGCAGTACCAGCCAGTTCTAACCCACCCCCAGCCATACGGACTATTGCTACAGGCCAAGTGGCTTGTCATTCAAGCTTTGCTTGCAAGTGGATGCCTTCTCCATCGTCCCTCTACTTGTAGTGGAGACCAACCCCCCCGTCGCCAGATTGTTTTCTCTGTATTAGAAAGGAAACAGCCTTTCCCCTCTCTCTATTACTCCGGTAGCCGGCGTTCCTTCTCTCGCATCCCGTCCCACTCAGACCTATGTTACATGCAGATACAAAGGACTTGTACCCCTGCCCTGGATTCTCTACACGTGGAATATGGCGGAGGTGCCACCACACTACGTTGAACTCTGAATATAATAAGCAGATCGTGATTTTCGCTTATAAAAAAAAAACAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)