Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 22 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 84%

 1012080355 Xt7.1-CBXT1758.3 - 40 ESTs
                                                                       ....-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CBXT1758.3                                                                                                                                                                                                                       GAGGCTGGGGAGTTGGAGGTGCCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGCCGGTCGGATTGGGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGAGGGGACGGATTATCAGGTTTTTGATAAAAAAGACAAATGTATTTGATGAATACGTGGGTATCGCCGCCGCGTTGCCATGGCGCCCTGGTTCTGCCTCTTTATCAGTGAGCGAATAGCGAAATGTTTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATCGGAGGTTTCGATGAATATTGTTATTTTAGTGGCGTTTAGATTAAGTTTCACTATTTAATTCTTCTCGGGGAGCCATTAACTCTTCGTTAGCAGACTCTCAGCCAGCTCCCCCCCCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008226834                                                                                                                                                                                                                             GGGGAGTTGGAGGTGCCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGCCGGTCGGATTGGGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGAGGGGACGGATTATCAGGTTTTTGATAAAAAAGACAAATGTATTTGATGAATACGTGGGTATCGCCGCCGCGTTGCCATGGCGCCCTGGTTCTGCCTCTTTATCAGTGAGCGAATAGCGAAATGTTTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATCGGAGGTTTCGATGAATATTGTTATTTTAGTGGCGTTTAGATTAAGTTTCACTATTTAATTCTTxxxxGGGAGCCATTAACTCTTCGTTAGCAGACTCTCAGCCAxCxxCxCCCCCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTAAAAAAAAAxAxxAAAAACC
                                                      consensus depths                                                                                                                                                                                                                            2     4     4     8     7    12     7    12     7    12     8    12    10    13    10    13    10    13    10    13    11    14    12    14    13    14    13    14    13    14    14    15    14    15    14    16    14    16    14    16    16    17    15    16    15    16    14    16    15    16    16    16    15    16    15    15    12    14    12    14    12    14    12    14    12    14    13    14    13    15    13    15    13    15    13    15    13    15    14    15    14    15    13    15    14    15    14    15    14    15    13    14    12    13    12    13    12    13    12    12     9    11     9    10     9    11     9    11     9    11     9    11    10    11     9    11    10    11     8    11     9    11     8    11     9    11     7    10     7     9     6     9     6     9     5     8     5     8     5     8     5     8     5     8     5     8     5     8     4     6     5     7     5     7     4     6     4     6     4     6     4     6     4     6     4     6     5     8     5     8     5     7     4     5     4     6     4     6     3     6     2     6     2     5     2     5     2     5     3     7     3     7     5     8     5     8     5     8     5     8     6     8     6    10     6    10     6    10     6    10     6    11     7    12     7    12     7    12     7    12    14    14    14    14    14    14    14    14    14    14    14    14    14    14    15    15    16    16    17    17    17    17    17    17    17    17    17    17    15    16    17    17    16    16    16    17    17    17    17    17    17    17    17    17    14    16    16    16    17    17    16    17    16    18    17    18    17    18    16    17    15    16    15    16    15    17    16    17    15    16    16    16    16    16    16    16    15    15    14    14    12    13    11    11     7     9     3     6
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAAATCTCAGG
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GCAATGCAACTA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GACTCAGGTGCT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CATTTTGTTTAT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TGCCAGCTAAATACCCCCCCCCCC
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ----------C-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       -G----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   -----C------
                                               BLH ATG      37     269                                                                                                                                                                                                                       
                                               BLH MIN      37      83                                                                                                                                                                                                                       
                                               BLH MPR      16      83                                                                                                                                                                                                                       
                                               BLH OVR      37      27                                                                                                                                                                                                                       
                                               CDS MIN      37      15                                                                                                                                                                                                                       
                                               EST CLI       5      15                                                                                                                                                                                                                       
                                               ORF LNG      37       1                                                                                                                                                                                                                       
                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Ce ---- 7e-021     NP_491404.2 D1007.16 [Caenorhabditis elegans] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                             PROTEIN --- Dm ---- 3e-025     NP_610273.1 CG11166-PD [Drosophila melanogaster] =====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                   PREDICTED - Sp ---- 1e-035     XP_787179.1 PREDICTED: similar to ELL associated factor 2 [Strongylocentrotus purpuratus] =================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PREDICTED = Xt ==== 5e-073     NP_001072894.1 hypothetical protein LOC780356 [Xenopus tropicalis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PROTEIN === Mm ==== 7e-074     NP_083208.1 ELL associated factor 1; Eaf1 protein [Mus musculus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PROTEIN === Dr ==== 2e-089     NP_001002162.1 zgc:86600 [Danio rerio] ========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PROTEIN === Hs ==== 2e-090     NP_060926.2 ELL-associated factor 2; uncharacterized bone marrow protein BM040; testosteroneregulated apoptosis inducer and tumor suppressor [Homo sapiens] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PROTEIN === Gg ==== 2e-097     NP_001006525.1 similar to ELL associated factor 2; uncharacterized bone marrow protein BM040; testosterone regulated apoptosis inducer and tumor suppressor; ELL-associated factor 2 [Gallus gallus] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PREDICTED = Xl ==== 2e-133     AAH60327.1 Unknown (protein for MGC:68453) [Xenopus laevis] ===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                  PREDICTED = ?? ==== 2e-133     NP_001083163.1 hypothetical protein LOC398779 [Xenopus laevis] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CBXT1758.3                                                                                                                                                                                                                                                            ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG------ATG---------------ATG---------------------ATG------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------TGA---------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------------TAG------------------------------------------------------------------------------------TAG------------------------------------------------TAG---------------------------------------------------------------------ATG------------------------------------------------------------------------TAGTGAATG------------------------------------------------------------------ATG------------------------------------------------------------------------------ATGATG---------------------------TAA---------TAGTAG------------------------------------------------------------TAA---------------ATG------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  5   1   2       chi Hrt1      in                        CAAQ12649.5p GTTTGGGTGGGTAGGAATGCTCCGTGGATCAGACGCCTGACAGACTGGCTCTGCTGCCACGTGACTAGATATTATTATAGGATACGTGGTGCTTGGGGGTTAATGGGGCAACATGATAATGGATTGTCTGTTTTCCAGAATAAATCCAATTTTTCCACTTTAGCAGCTTTTATTGCCCGGCTTGGATACCACTATATATAGATTATTGCCCCCTGGGGGTGGGAGAGATTTGCCCCCTGTGCCCCAGTGTAACTGCTCTCCTCACACAGTATTTAGTATTATTGCCATTTCCACTCTTGGGGGGCTGCACTGCGCACCCCTCTCTATACTGTATATTCACTACATTCTTTGCAGATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCT
  5   1   2   12  bld Gas7 PIPE in                         XZG26300.5p ..............................................................................................................................................GAAGGCGCTCCGGTTGCTGGCTCCGCCCCCGGCTGGCAGGCTGAGTTGGGAGCCCCAGGCTGGTTCGGGGCAGAGGCTGGGGAGTTGGAGGTGCCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCCATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCCAGTTCGGACAGTTCTTCGGAGTCCAAAAAGCTCCTCCCT
  5   1   2       add HdA  5g3  in                  THdA040e10.p1kaSP6                                                                                                                                                                                               AGCCCCAAGCTGGTTCGGGGCAGAAGCTGGGGAGTTGGAGGTGCCCGAGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCCTTTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAAGTGACCATCTCTCTGCCCTACTTTGAGGGTTCCACCACCCCATTCACTGTGT
  5   1   2       bld HeRe 5g                          EC2CAA17BD02.g1                                                                                                                                                                                                                     GAGAGGCTGGGGAGTTGGAGGTGCCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGATCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAGGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACC
  5   1   2       add HdA                            THdA052p09.p1kSP6                                                                                                                                                                                                                            AGTTGGAGGTGCCCGGTGGGTCGGCACGAATTAATGCGCGCTGCCTGCGCCGCTGATTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCAGCTGGAGAAATTGAGCGAGCAATATTAGTGTCAAAAAAACCATGGCTGAAGGAAACAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAGAACACCCAACAGCGCCAAAAACTCGTCCTCGCCCATGGTAGAAAATGTCTCCAGCATCCCCAATGGATGAGATAGAGAGGGAACTGATGGCGGAAGCCTGCGTTATCGACCAAATGA
  5   1   2       add Neu  5g                        TNeu128h10.p1cSP6                                                                                                                                                                                                                              CCCGGGGTTGGAGGTGCCCGGGGGTCGGCACGAGGAGTGGGGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCAGAAGCAGCCCAGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTGCATTGATACTTCCTGTGAGGGGAACCTCGTAGCGGGGGAAGGTTGGCAAGTGACCATCACTCTTCCCAACATTGAGGGGTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAAGGAGTGTATCCTGATTGTGAATCACCACACCGGGGAGTGCCGGCTGGAGAAATTGAG
  5   1   2   10  bld Tbd1 5g3  in                        CBXT20279.b1 ..............................................................................................................................................................................................................................GGAGTTGGAGGTGCCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAGGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGTCGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGCCGGTCGGATTG
  5   1   2       bld Gas  5g                        TGas011a20.p1kSP6                                                                                                                                                                                                                                   TTGGAGGTGCCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCANCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGAC
  5   1   2       add Gas  5g                        TGas062i01.p1cSP6                                                                                                                                                                                                                                     GGAGGTGCCCTGTTGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTCCACACAATCCGCTCTGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTTCCTAAGGGAATGTCTCCTGTTTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCCGCTCTTTTTGTGTCCAAAAGACCAGGGCTGTAGGAAGCAGCCGGATCCAGTCCCGCTTGGAGCAGCGTCTGCTGCGGATGCGCTCCGCCCGCTAACACCCAACAGCGCCTAAAACT
  5   1   2       bld TbA  5g3  in                   TTbA033b16.p1kSP6                                                                                                                                                                                                                                      GAGGTGCCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACAACTGGAGGATTGGCGGGTCGGATTGNGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGGAGGGGACGGATTATC
  5   1   2       bld Gas  5g                        TGas004j11.p1kSP6                                                                                                                                                                                                                                         TGCCCGGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGC
  5   1   2       bld In63 5x3                        IMAGE:8961413.5p                                                                                                                                                                                                                                            CCCGGGGGTCGGCACGATGAATGGCGCTGCCTGCCCGCTGTTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGACACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGATTGCCGGTCGGATTGGGCGCACAGAGTATGAGCAGCGCCTCATTTGCACTAGACTGATTCTTCTTCGTGACGAGGGACGATTATCAGTTTTGAAAAAAAGAAAATTATTGATGATCTGGTTCGCCGCCCGTGCATGCGCCTGATTCGCCTCTTACATGACGATAGAGTTCTTTTTTCCTCCTCCCGATCGCATCGAGTTCAGAATGATTAGGCTTAATAGTTCATTAATCTCGGACATTATCTCTGT
  5   1   2       bld Mus1      in                         CABH9111.5p                                                                                                                                                                                                                                                                                    TTTGATACCAAGGAGAGGCCATTGGTGCTGGGGGAGAGCTTCGAGAAGCAGCCCAGGAGCGGGTACCACACAATCCGCTATGATTTCAAGCCGGCGTCCATTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACTGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGCCGGTCGGATTGGGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGAGGGGACGGATTATCAGGTTTTTGATAAANAAGACAAATGTATTTGATGAATACGTGGGTATC
  5   1   2       add HdA                           THdA018g04.p1kaSP6                                                                                                                                                                                                                                                                                                                                     GCCCATGAGCGGGTACCACACAATCCGCTATGATTTCAAGCAGGCGTCCTTTGATACTTCCTGTGAGGGGAACCTGGAGGCGGGGAAAGGGGAACCGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCGCAGTCACTGTGTTCTAAGAGCTCCTGAAAGCCGTACCTAACGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAACAGCTATATTATTGTCATAAAGACCTGGGCTGAAGGAAGCAGCGAGATCCGGTCCCGCTTGGAGCATCAACATCTGCAAATGCGCAACGCCAGCTCCACACCCAACAGCGCCAAAATCTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCGATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTAGCAACCATCTGAGCAGTTCGGACAGATCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGTACTACTCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCGCTCCTAGCAGCCGCTGCAGCGGCACAACTCGAGCTCCAGCGTATAGAGCGTGCATAGGTCTCACGACAACGGGGGGCAGATGATGAGTACTCTGCGCAATGACTTACAGCT
  3  -1   2       bld Ovi1      in                        CABI14354.3p                                                                                                                                                                                                                                                                                                                                                                                                        GGGGAACCTGGAGGCGGGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGCCGGTCGGATTGGGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGAGGGGACGGATTATCAGGTTTTTGATAAAAAAGACAAATGTATTTGATGAATACGTGGGTATCGCCGCCGCGTTGCCATGGCGCCCTGGTTCTGCCTCTTTATCAGTGAGCGAATAGCGAAATGTTTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATCGGAGGTTTCGATGAATATTNGTATTTTAGTGGCGTTTAGATAAGTTTCACTATTTAATCTTCTCGGA
  5   1   2       bld Lun1      in                        CABD12474.5p                                                                                                                                                                                                                                                                                                                                                                                                                        GGGAAAGGGGAACAGGTGACCATCACTCTGCCCAACATTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACTGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGCCGGTCGGATTGGGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGAGGGGACGGATTATCAGGTTTTTGATAAAAAAGACAAATGTATTTGATGAATACGTGGGTATCGCCGCCGCGTTGCCATGGCGCCCTGGTTCTGCCTCTTTATCAGTGAGCGAATAGCGAAATGTTTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATC
  5   1   2       bld Gas8      in                           st3n06.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                             TTGAGGGTTCCACCACCCCAGTCACTGTGTTCAAAGGCTCCAAAAGGCCGTACCTAAGGGAATGTATCCTGATTGTGAATCACGACACCGGGGAGTGCCGGCTGGAGAAATTGAGCAGCAATATTAGTGTCAAAAAGACCAGGGCTGAAGGAAGCAGCAAGATCCAGTCCCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGCCGGTCGGATTGGGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGAGGGGACGGATTATCAGGTTTTTGATA
  5   1   2       bld TpA                            TTpA031l20.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CCGCTTGGAGCAGCAACAGCAGCAAATGCGCAACGCCAGCAAAACACCCAACAGCGCCTAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCGAAAGCTCCTCCTCCAGCGACGACAAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCTAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCATCGTATAGAGAGTGCATAGGTCTCAAGACAACGGGAGGCAGATGATGAGTACTTTGCTCAATGACTTACAGCTCAGTCGAGTCCGGGAGCGACAGCGACGACTGAGGATTGGTCGGTCAGATTGGGCGGCACAGAGTAGAGAGCCAGCGCCCCATTTGCACTACAACTGATTCTTCTCCGTGACGGACGGGACGGATTATCAGGTTTATGATGAAAAAGACAAATGTATTTGATGAATACGTGGAGTATCGCACGCCTCGTTGCCATGGAGCCCTGGTTCTGCCTCTTTATCGCTGAGCGAATAGCGAAATGTTTCTTTTTTTTCCCCTCCTCCC
  5   1   2      shim Gas8      in                          st76f20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGCGCCAAAAACTCTTCCTCGCCCATGGAGAAAATGTCTCCGGCATCCCCAATGGATGATATAGAGAGGGAACTGATGGCGGAAGCCAGCGTTATCGACCAAATGAGCAGTTCGGACAGTTCTTCGGAGTCCAAAAGCTCCTCCTCCAGCGACGACAGCTCCAGCGACTCTGAGGACGAGCGAAACAAGTCGTCCCACTCCAAGCAGCCGCTGCAGCGGCACAACTCGGGCTCCAGCGTAGAGAGCGTGCATAGGTCTCAGGACAACGGGGGGCAGATGATGAGTACTTTGCGCAATGACTTACAGCTCAGCGAGTCCGGGAGCGACAGCTACGACTGAGGATTGGCCGGTCGGATTGGGCGGCACAGAGTAGTGAGCCAGCGCCCCATTTGCACTAGAACTGATTCTTCTCCGTGACGGAGGGGACGGATTATCAGGTTTTTGATAAAAAAGACAAATGTATTTGATGAATACGTGGGTATCGCCGCCGCGTTGCCATGGCGCCCTGGTTCTGCCTCTTTATCAGTGAGCGAATAGCGAAATGTTTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATCGGAGGTTTCGATGAATATTGTTATTTTAGTGGCGTTTAGATTAAGTTTCACTATTTAATTCTTCTCGGGAGCCATTAACTCTTCGTTAGCAGACTCTCAGCCAACGGCTCCCC
  5   1   2       bld Gas8      in                          st76e20.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GCGACTCTGANGACNANCGAAACAAGTCATCCCACTCCNAGCAGCCGCTGCAGCNNCACAACTCGGGCTCCAGCGTANANAGCGTGCATAGGTCTCAGGACNACGGGGGGCAGATGATGAGTANTTTGCGCANTGACTTACAGCTCNGCNAGTCCNGGANCGAC
  5   1   2       bld Gas       in                   TGas103l03.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCCGGGGGAAAAAGACAAATGTATTTGATGAATACGTGGGGGTCGCGGCCGCGTTGCCATGGCGCCCTGGGTCTGCCTCTTTATCAGTGAGCGAATAGCGAAATGTGTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATCGGAGGTGTCGATGAATATTGTTATTTTAGTGGCGTGTAGATTAAGTGGGGGGGGTGGAATTCTTCTCGGGAGCCATTAACTCTTCGTTAGCAGACTCTCAGCCAACGGGTCCCCCCCCAAATCTCAGGGGGGCTTTACATGTGCCTCCAAACGCAATGCAACTATGTCACCGGGG
  5   1   2       bld TbA                            TTbA055b12.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CGAATGTTTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATCGGAGGTTTCGATGAATATTGTTATTTTAGTGGCGTTTAGATTAAGTTTCACTATTTAATTCTTCTCGGGAGCCATTAACTCTTCGTTAGCAGACTCTCAGCCAACGGCTCCCCCCCCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCC
  5   1   2       bld Neu                            TNeu051h08.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CGAAATGTTTCTTTTTTTTCCCCTCCTCCCTCAGAATCCGGCAGAATCGGAGGTTTCGATGAATATTGTTATTTTAGTGGCGTTTAGATTAAGTTTCACTATTTAATTCTTCTCGGGAGCCATTAACTCTTCGTTAGCAGACTCTCAGCCAACGGCTCCCCCCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCCCCCCC
  3   1   2       bld Lun1      in                        CABD12474.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGGTTTCGATGAATATTGTTATTTTAGTGGCGTTTAGATTAAGTTTCACTATTTAATTCTTCTCGGGAGCCATTAACTCTTCGTTAGCAGACTCTCAGCCAACGGCTCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAACATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCGTTCCTTGTGCTTTGGCCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTAA
  5  -1   2       bld Ovi1      in                        CABI14354.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTTAGCAGACTCTCAGCCAACGGCTCCCCCCCCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAAT
  3   1   2       bld Mus1      in                         CABH9111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GTTAGCAGACTCTCAGCCAACGGCTCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTTTCTGCCAGCTAAATACCCCCCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAACATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCGTTCCTTGTGCTTTGGCCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTT
  3   1   2       bld Tbd1                                 CBXT1758.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GGGCTCCCCCCCCCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATATAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTAAAAAAAAAAAAAAA
  3   1   2      seed Gas8      in                           st3n06.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCCCCCCCCCCCCAAATCTCAGGGGTCCTTTACATGTTCCTCCAAACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCG
  5   1   2       bld Gas7      in                         XZG53039.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ACGCAATGCAACTATGTCACCGGGGGAGTCAGACTCCTGACTCAGGTGCTTTTACTGTCGCCCATTTTGTTTATTCTTCTTAGTGAATGGGACTGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTAAAAAAAAAGAAGAAAAAACAACTAANAAAAAAAAAAAAAAA
  3   1   2       bld Gas       in                    TGas103l03.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          CACCGGGGGAGTCAGATTCATGACTCAGGTGCTTTTTCTGTCGCCCATTTTGTTTATTCTTGTTAGAGAATGGGAATGGTTTGGGTGCGTCTCTGCCAGCTAAATACCCCCCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAACATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCGTTCCTTGTGCTTTGGCCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTACCC
  3   1   2       bld Gas7 PIPE in                         XZG26300.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GGGGAGTCAGACTCCTGACTCAGGGGCTTTTACTGTCGCCCATTTTGTTTATTTTTTTTAGTAAATGGGACTGGTTTGGGTGGGTTTCTCCCAGCTAAATACCCCCCCCCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCATTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAAAAATTAGCAAAAAAAAAAAAAAAGG
  3   1   2       bld Gas8      in                          st76f20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             GTTTNTTTTTTTTNNGGAAAGGGNATGGNTTGGGGGGGNTTTTTCCNNNTAAANNCCCCCCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAACATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCGTTCCTTGTGCTTTGGCCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGC
  3   1   2       add Gas7      in                         XZG53039.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CTTAGGGAATGGGACTGGTTTGGGTGCGTCTCTCCCAGCTAAATACCCCCCCCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGCCCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATTTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTCCCTGGGGGTTAAGGAGCTGATCATCTCTCCCCAGTGCTTGGTATTTTTTGGAGACAGTCCCATTATTTATCAACCAATCCCATCGTAACAGGGATAGTAAATGCGGAGGGATTTTGCGGCATTCCTTGTGCTTTGGGCCCCCCCCCCGTAGCCGTTTGGGCCTCCCCCCGGTCCCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGCCAAATAAATCTATTTACCATTTAAAAAAAAAGAGGAAAAACCACCTaaaaaaaaaaaaaaaaaaaataaaaaaaaaaaaaaaaaaaaaaaaaG
  3   1   2       bld TbA  5g3  in                    TTbA033b16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        CCCCCCCCCAAGTGCCATCACCCTTACGCTTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTTTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTAAACAAAAAAAAAAAAAAAAAA
  3   1   2       bld Mus1      in                         CABH8588.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAACATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCGTTCCTTGTGCTTTGGCCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTT
  5   1   2       bld Mus1      in                         CABH8588.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCCAAGTGCCATCACCCTTACGCCTCATGAACTTGTACCAAAGTGCATTAGTCAGTGTGCTGATTGGCTGTAATTGGACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAACATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCGTTCCTTGTGCTTTGGCCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTAAAAAAAAAAAAGAAAAAAAAA
  3   1   2       bld Hrt1      in                        CAAQ12649.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTTGCCCTTTTAACTCAGACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTTTGCAGTTGGTCTTTTTTGTCGTTTAAGGTTAAAAAATATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTCTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAAG
  3   1   0       add Gas8      in                          st76e20.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACCTAAAAGGAATGATGATAGATTTTAAAGGGGAAGTTGACCTTTAAATCAAGTTTTAGTAGGAAACATGCCGATCTAAGCTNTGCAGTTGGTCTTTTTTGTCNTTTAAGGTTAAAAAACATTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATNTCTCCGCAGTGCTTGGTATTTCTTGGAGACAGTCACATTATTTATCAACCAATCACATCGTAACAGGGATAGTAAATGCGGAGGGATTNTGCGGCGTTCCTNGTGNNTTGGCCCCCCCCGCCGTAGCCGTTTGGGCCTCCCCCCGGTAGCCGGGGCCAAAGAC
  3   1   2       add HdA  5g3  in                    THdA040e10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   AAAGGAATGATGATAGTTTTTAAAGGGGATGTTGACCTTTAAATCAAGTTTTAGTTGGAAACATGCCGATTTAAGCTTTGCAGTTGGTTTTTTTTTTCGTTTAAGGTTAAAAAATTTTAAAAAGACCAACTGCAAATGTTGCCTGGGGGTTAAGGAGCTGATCATCTTTCCGCAGTGCTTGGTATTTTTTGGAGACAGTCACTTTATTTATCAACCAATCACTTCGTAACTTGGATAGTAAATGCGGGGGGATTCTGCGGCATTCCTTGTGCTTTGGGCCCCCCCGCTGTAGCCGTTTGGGCCTCCCCCCGGTACCGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTAAAAAAAAAAAAAAAAAG
  3   1   2       add Tbd1 5g3  in                        CBXT20279.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TTTCAAATGATCACATTGTAACAGGGATAGTAAATGGGGAGGGATTTTGGGGCGTTCCTTGTGCTTTGGGCCCCCCCCCCCCCGCTGTAGCCGTTTGGGCTTCCGCCCGGTACCGGGGGCCAAAGACGGACTGTTGCATCGTTTCTTTGTTTGTTGCAGGAGTCGCAATCGGTCGCACTGAAATGTGAAGACAAATAAATCTATTTAACATTTACTCAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)