Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 30%

 1012080406 Xt7.1-TTbA022n04.3 - 21 ESTs
                                                                       .-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TTbA022n04.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    GGGAGCTACCAACTAGTTAATCACTGGCAAGTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAGCACAAGGAAATGATATTCACATCAGAGATCAAAGCTTCCATTATACTTGCACCACTTTAGAATGAACCACACTTAGGTGATCAGGGTAGCTAAAAAGGGATGGTCAAAAGAATTGTGTATACTTGGCTACCTCAATTCTTATTTTCTTATCTTTCATAGATAAGAAAATTGGGGGGTTCATAAATGGAAATATTAGATATTGCCTACGTAAGCAGCATTTAGTGGATATTACAATGCTACCTTTTAAAATAATCTGGAAGAGGACATTTGTTGTTTTTGGTAGATAAGGTACACACAGTGTCCATGGCACAACATGCTGGAAAGAGAAATAGGCTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGGGATATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATATATTTTTATAATTGTACGTTGTGTGTTTCATTGTTTTTAAACTTTTACATAAGATTTGTAATATATATTGGTCTTTTTTTAAATGTATTAAAAAGTAAAGA
                                                  Xt7.1-CHK-1008230144                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TACCAACTAGTTAATCACTGGCAAGTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAGCACAAGGAAATGATATTCACATCAGAGATCAAAGCTTCCATTATACTTGCACCACTTTAGAATGAACCACACTTAGGTGATCAGGGTAGCTAAAAAGGGATGGTCAAAAGAATTGTGTATACTTGGCTACCTCAATTCTTATTTTCTTATCTTTCATAGATAAGAAAATTGGGGGGTTCATAAATGGAAATATTAGATATTGCCTACGTAAGCAGCATTTAGTGGATATTACAATGCTACCTTTTAAAATAATCTGGAAGAGGACATTTGTTGTTTTTGGTAGATAAGGTACACACAGTGTCCATGGCACAACATGCTGGAAAGAGAAATAGGCTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGGGATATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATATATTTTTATAATTGTACGTTGTGTGTTTCATTGTTTTTAAACTTTTACATAAGATTTGTAATATATATTGGTCTTTTTTTAAATGTATTAAAAAGTAAAGATCAATT
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         3     4     5     7     5     7     6     7     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     7     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     7     9     6     8     6     8     6     8     6     8     6     8     5     7     5     7     5     7     6     7     5     6     5     6     5     6     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     7     7     7     7     7     7     7     7     6     6     6     6     6     6     6     6     7     7     7     8     7     8     7     9     7     9     8    10     8    10     7     9     7     9     7     9     7     9     7     9     7     9     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9    10    10    10    10    10     4     6     2     3     2     2     2     2     2     2     2     2     2     2     2     2     2     2
                                               BLH MIN     157      35                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               BLH OVR     169      28                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               EST CLI       5      11                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                               ORF LNG     169       1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Cs ---- 1e-007     BAD18073.1 bHLH transcription factor HAND [Ciona savignyi] ================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 5e-009     AAF81766.1 basic helix-loop helix transcription factor AmphiNeurogenin [Branchiostoma floridae] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PREDICTED - Ce ---- 8e-008     NP_508725.1 Predicted CDS, helix-loop-helix putative DNA-binding protein [Caenorhabditiselegans] ----------------===============================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            PROTEIN --- Bb ---- 2e-011     AAD10038.1 twist protein [Branchiostoma belcheri] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------========================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 4e-011     BAE06630.1 transcription factor protein [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 PROTEIN --- Xt ---- 2e-010     AAD53290.1 twist transcription factor [Silurana tropicalis] --------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Dm ---- 1e-019     NP_525055.1 CG2655-PA [Drosophila melanogaster] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================
                                                                                                                                                                          PREDICTED - Sp ---- 5e-021     XP_792477.1 PREDICTED: similar to T-cell acute lymphocytic leukemia 1 [Strongylocentrotus purpuratus] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================
                                                                                                           PROTEIN --- Xl ---- 4e-025     AAH72130.1 LOC398028 protein [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- ?? ---- 4e-025     NP_001081746.1 stem cell leukemia protein SCL [Xenopus laevis] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Dr ==== 2e-026     NP_958496.2 T-cell acute lymphocytic leukemia 2 [Danio rerio] ==========================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Mm ==== 6e-031     NP_033343.1 T-cell acute lymphocytic leukemia 2 [Mus musculus] ====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN === Hs ==== 2e-033     NP_005412.1 T-cell acute lymphocytic leukemia 2 [Homo sapiens] ====================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PREDICTED = Gg ==== 2e-035     XP_424886.1 PREDICTED: similar to T-cell acute lymphocytic leukemia 2 [Gallus gallus] ====================================================================================================================================================================================================================================
                                                    Xt7.1-TTbA022n04.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TAG------------------------------------------------------------TGA------TGA---------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------TAA---TGA---------------ATG---------------------------------------------ATGTAA---------------------------TAA---------------ATG---------------------------------------------------TAATAG---------------ATG------------------------------------------------------TAA---------------------------TGA------TGA------------------------------ATG---------------------------------------------TAG------------------------------TAA------ATG------------------------------------------------------TAG---------------------TAAATG---------------------------------TAG---------------------------TAA---------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------ATGTAA------TGAATG---------------------------------------------------TAG---------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------------TGA------------------------------TGA---------------------------TAATGA------------TAA------------TGATGA---------------------------TAA------------------TAATAA------------------------------------------------------------------------------------ATG
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             [ open reading frame                                                                                                                                                                                                                                                                                                                                    ]
  5   1   2       chi Tad5      in                         XZT16050.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGTTATCACAAATGAAGGGAAAAGGCTGTTAAAAAGGGGGTTGTATCAAAGAAACCCTGATTTTACTCATAATTATAAAATTACAAGTTAAAGAGAAAGTTCCAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGGTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACA
  5   1   2       bld TpA  5g                        TTpA057d11.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACAAAGGATCTNGTTTTTCTATAAATGAAGGAGAAGTCTGCCCATTTGCTGAGCTACCAACTAGTTAATCACTGGCAAGTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACT
  3   1   2       bld BrSp      in                     EC2BBA33DF02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGGGAGCTACCAACTAGTTAATCACTGGCAAGTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGGGAGATGGAGGCAGCAGAATGTTAATAGTGCAATGCTGAGCTAAGGAAG
  5   1   2       bld BrSp      in                     EC2BBA33DF02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGGGAGCTACCAACTAGTTAATCACTGGCAAGTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGGGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld TbA  5g3  in                   TTbA022n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCCGGGGCTAGTTAATCACTGGCAAGTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAGCACAAGGAAATGATATTCACATCAGAGATCAAAGCTTCCATTATACTTGCACCACTT
  5   1   2       bld TpA  5g3  in                   TTpA058c15.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AACTAGTTAATCACTGGCAAGTCTGCNCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAAGCACAAGAAATGATATTCACATCAGAGATCAAAGCTTCCATTATACTTGCACCACTTTAGAATGAACCACA
  5   1   2       bld TbA  5g3  in                   TTbA025f16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CTAGTTAATCACTGGCAAGTCTGCCTTCCTCCAGCAGCAACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCATTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAGGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTAAGGGGTCTGTTGTCACACGCTAAATGCCATTCCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAGCACAAGGAAATGATATTCACATCA
  5   1   2       bld HdA  5g3  in                  THdA027m12.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CCTCCAGCAGCACTCTTGTGTGCTCTATTGTATATCTGACTGCAGTGAGCACACTGGGAAACTCATCTGGTAACAGAGATTTCTGCCTTTCTTCATCATAAGGTTTTCTTAAAAGAGCTGCGGATTAAAATGACACGCAAGATTTTCACTAACACCAGAGAGAGATGGAAGCAGCAGAATGTTAATAGTGCATTTGCTGAGCTAAGGAAGCTTATCCCAACCCACCCACCAGACAAGAAACTAAGCAAGAATGAAACATTGAGACTGGCTATGCGGTACATCAACTTCCTAATTGATATCCTTGGGGATCAAGAAATAAGGAAAACTGGAGGAAATTCTCGAAGAAATATTTTAGGTCTGTTTGAGTCAGAACACTCAGGTGTGGAAGACTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAGCACAAGGAAATGATATTCACATCAGAGATCANAGCTTCCATTATACTTGCACCACTTT
  5   1   2       bld Tad5                                 XZT51601.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGGACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAGCACAAGGAAATGATATTCACATCAGAGATCAAAGCTTCCATTATACTTGCACCACTTTAGAATGAACCACACTTAGGTGATCAGGGTAGCTAAAAAGGGATGGTCAAAAGAATTGTGTATACTTGGCTACCTCAATTCTTATTTTCTTATCTTTCATAGATAAGAAAATTGGGGGGTTCATAAATGGAAATATTAGATATTGCCTACGTAAGCAGCATTTAGTGGATATTACAATGCTACCTTTTAAAATAATCTGGAAGAGGACATTTGTTGTTTTTGGTAGATAAGGTACACACAGTGTCCATGGCACAACATGCTGGAAAGAGAAATAGGCTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGNGATATCGGGA
  5   1   2       bld HdA       in                  THdA030p07.p1kaSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ACTGCTATGGGTCACAGCAATGACTCTTCCCCAGGGATGAGCAGTGACACACAGGACTGCTGGTCATTGGCCCCCTCACCATAAAGCTGAGAAAATGGGCGTATTATGCGCCATTTAGGTGTATGTGCGTTAACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAGCACAAGGAAATGATATTCACATCAGAGATCAAAGCTTCCATTATACTTGCACCACTTTAGAATGAACCACACTTAGGTGATCAGGGTAGCTAAAAAGGGATGGTCAAAAGAATTGTGTATACTTGGCTACCTCAATTCTTATTTTCTTATCTTTCATAGATAAGAAAATTGGGGGGTTCATAAATGGAAATATTAGATATTGCCTACGTAAGCAGCATTTAGTGGATATTACAATGCTACCTTTTAAAATAATCTGGAAGAGGACATTTGTTGTTTTTGGTAGATAAGGTACACACAGTGTCCATGGCACAACATGCTGGAAAGAGAAATAGGCTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAG
  5   1   2       bld Tad5      in                         XZT55027.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ACCTATTGTGCTGAATTAGTTATGTAATGGGGACATATTGATATTGTTTTCAAATAACTTATTTTTAAATACATGGTTCTATACAAGCCAAGACTGTCTGACATACCTGCAGTGAGACAGTTGTCTTAATAGCATGCTTTAAATGTAATGTTGATAGTACAGCTCTTATTATGGTTCTGTTGTCACACGCTAAATGCCATTTCATAAGGCTGTCTTTGCAGCAGATGCTTTCATTGACCACACTGACAAGGTGCAGAACTGGGCAAGCACAAGGAAATGATATTCACATCAGAGATCAAAGCTTCCATTATACTTGCACCACTTTAGAATGAACCACACTTAGGTGATCAGGGTAGCTAAAAAGGGATGGTCAAAAGAATTGTGTATACTTGGCTACCTCAATTCTTATTTTCTTATCTTTCATAGATAAGAAAATTGGGGGGTTCATAAATGGAAATATTAGATATTGCCTACGTAAGCAGCATTTAGTGGATATTACAATGCTACCTTTTAAAATAATCTGGAAGAGGACATTTGTTGTTTTTGGTAGATAAGGTACACACAGTGTCCATGGCACAACATGCTGGAAAGAGAAATAGGCTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGGGATATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTANATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCT
  3   1   2      seed TbA  5g3  in                    TTbA022n04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           GTAGATAAGGTACACACAGTGTCCATGGCACAACATGCTGGAAAGAGAAATAGGCTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGGGATATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATAAAAAAAAAAAAAAAA
  3   1   2       bld Brn1      in                          CABL618.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGGGATATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATATATTTTTAT
  5   1   2       bld Brn1      in                          CABL618.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CTGTATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGGGATATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATATATTTTTATAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA  5g3  in                    TTpA058c15.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TATATTTTACCTTCTTTAATTAAACATGCTTCAGATGCAGATTTGTGTCTTGAAAAGACCACTCGTAGATGGGGATATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAATAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATTAAAAAAAAAAAAAAAAAAAAAG
  5   1   2       bld TpA                            TTpA040n04.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                ATCGGGAGAAGATCTTACCGTGTATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATAT
  3   1   2       bld HdA  5g3  in                   THdA027m12.q1kaT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TATGGCCACCTTTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATAAAAAAAAAAAAAAAAAAAAGCG
  3   1   2       bld Tad5      in                         XZT55027.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAGTGTAAAACTTACAATAGTAATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATATATTTTTATAATTGTACGTTGTGTGTTTCATTGTTTTTAAACTTTTACATAAGATTTGTAATATATATTGGTCTTTTTTTAAATGTATTAAAAAGTAAAGATCAATTGC
  3   1   2       bld TbA  5g3  in                    TTbA025f16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         ATTTTGATAATGTAAATTAAATGAATGAACCTAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCGACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTCATAAAAAAAAAA
  3   1   2       bld Tad5      in                         XZT16050.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       TAAAATATTTGATTGATTGGTCATGGCCATTCTCTCGCAGAAATGCTTAGCAAATATATGGAGGCTGTGTAAATGGAGAGACTTTTGGTTTATTTTGGGAGTTGTTTAATTGTTGAAACACTGGGTCAAAATGGCAAAAACTTGACCTCCATTTGTCCTGCCAATCTGCACTGCCTTATTGTCAAATAAGAACTGACAGAAGTGCGCAAGGGCTGTGAATTCTCACAGGGGCTGTTTTGACACCCAAAGTAAAAAAAAAGCCACCCAAAATCTCCCAAATCTCCCTTAAAACTCAACAGCAAGCCCATATAGCTGGACTTGGAACCCTCTGAAGTGATATCTGTTTTTTGTTCTTCCATTTGTGAATATATTTTGTCTGCAAAAATTACTCCTAATGAAATAAGACTCTCTAAACTTGTTTATGTTGATGACTGGATTTGATTTCCACCCGTATTTATTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATATATTCCAATAAATTATTGAATTATGTTTTTCATATATATTTTTATAATTGTACGTTGTGTGTTTCATTGTTTTTAAACTTTTACATAAGATTTGTAATATATATTGGTCTTTTTTTAAATGTATTAAAAAGTAAAGATCAATTGC
  3   1   2       bld HdA       in                    THdA030p07.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TGATGACTGGATTTGATTTCCACCCGTATTTGTTAAGATGATTTTGTAGGTTGGTAATAAAATAATTGTGAGCTTTTCCAACATATATTTATAGTTAGTCGCACCAACCAAAGAATTTTTTTTCAGGGTTTCAAAATTTGTGAAATGTATACTTGTATTTATTTGTTAATAAAAGGCAATAAATTATTGAATTATGTTTTTCATATAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)