Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 90%

 1012080547 Xt7.1-CAAO4090.3 - 22 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CAAO4090.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         AAAGTCAGAGGCACAAAGTGCGGGGAGTCAGTCTCTGTCCGCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACACACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGCACCTGGGTGAATGGGAAACAAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCAAGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTGGTACCGGTCTCTCCCTGTACGTCAGTACCGGCCTCTCCCTGTACGTCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTACGTCGGTACCGGCCCC
                                                  Xt7.1-CHK-1008229985                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AGAGGCACAAAGTGCGGGGAGTCAGTCTCTGTCCGCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACACACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGCACCTGGGTGAATGGGAAACAAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCAAGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTxGxxxxGGTCTCTCCCTGTACGTCxGTACxGGCCTCTCCCTGTACGTCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     4     3     5     4     6     5     6     5     6     5     6     6     7     6     7     6     7     6     7     6     7     6     7     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     8     7     9     6     8     6     7     6     7     6     7     6     7     6     8     7     9     7     9     7     9     9    11    10    12    11    13    13    15    13    14    13    14    13    14    11    12    10    11    10    11    10    11    10    11    10    11    10    11     8     9     8     9     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    11    10    12    10    12    10    12    10    12    10    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12     9    12    10    12     9    12     9    12     9    13     9    13    10    13    10    12    10    13    10    13    10    13    10    13    10    13    10    13    10    13    10    13    10    13    10    13     9    13     9    12     9    12     9    12     8    11     2     3     3     3     2     3     3     3     3     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3     2     3
                                               BLH ATG     233     522                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                               BLH MIN     227      89                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PREDICTED < Sp <<<< 7e-009     XP_001175659.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    PREDICTED = Bf ==== 1e-011     AAM18893.1 unknown [Branchiostoma floridae] ==========================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PROTEIN -== Ce ==== 1e-012     NP_492193.2 JunctoPHilin (83.1 kD) (jph-1) [Caenorhabditis elegans] =======================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Xt ---- 8e-016     AAI23948.1 Unknown (protein for IMAGE:7692845) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Ci ---- 7e-023     FAA00235.1 TPA: zinc finger protein [Ciona intestinalis] -----------------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  PREDICTED - Dr ---- 2e-022     NP_001017666.1 hypothetical protein LOC550359 [Danio rerio] -----------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   PROTEIN --- Dm ---- 1e-037     NP_609609.1 CG5458-PA [Drosophila melanogaster] ==============================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PREDICTED - Sp ---- 6e-067     XP_790120.1 PREDICTED: similar to testis specific gene A2 (predicted) [Strongylocentrotus purpuratus] ==============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = Gg ==== 5e-091     XP_416745.1 PREDICTED: similar to testes specific A2 homolog; meichroacidin; testes specific gene A2 (mouse) homolog [Gallus gallus] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Mm ==== 9e-102     NP_079566.1 testis specific gene A2 [Mus musculus] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Hs ==== 9e-102     NP_543136.1 testis-specific gene A2 [Homo sapiens] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PROTEIN === Xl ==== 2e-162     AAH87458.1 LOC496054 protein [Xenopus laevis] =======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        PREDICTED = ?? ==== 2e-162     NP_001088789.1 hypothetical protein LOC496054 [Xenopus laevis] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-CAAO4090.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA------------------------------TGA---------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  5   1   2       bld Te5       in                         CAAO4090.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   CCAGCTGCCAGCACTAAACATGGCGGAATGTCAGTCACATGGGCGGGACGGTCTCCATGGGAACAGGACGCCTCACCCCAGCGGCTGCTCTGTCGCTATGGAGAGGACGCGGTGCGTGTCGGGTAATATCTCCATGGAAACTGGACGCTCGGATTCGAAACAGTGAAAAGTCAGAGGCACAAAGTGCGGGGAGTCAGTCTCTGTCCGCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACACACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGC
  5   1   2       bld Te4       in                        CAAN11572.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     CTGCTCTGTCGCTATGGAGAGGACGCGGTGCGTGTCGGGTAATATCTCCATGGAAACTGGACGCTCGGATTCGAAACAGTGAAAAGTCAGAGGCACAAAGTGCGGGGAGTCAGTCTCTGTCCGCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACCGGCCCCTCAGCCTCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACATACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCATCCTGTGTCGGTGCCAGGCGCCGGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGGCACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATTGGAGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAAGCACGGGCAGGGGGTGTACACTTACGCTGAGACCGGATCAAGTATGTCGGCACCTGGGTGAAT
  5   1   2       bld 1030 5x                         IMAGE:7026225.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ACCCCCCCGGAAACAGTGAAAAGTCAGAGGCACAAAGTGCGGGGAGTCAGTCTCTGTCCGCTCCGGGTCCGACCCCTCAGCCCTGACCCCTCTACTCACCGCCCCCTCAGCCTCTCCGCTCCGAGTCCGACCCCTCAGCCCTGACCCCCCTACTCACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCGAACCCCCTACTCACCGGCCCTCAGCCTACACTCACCCCGGGCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCGGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTATGAGGGGGAGCGTAATGAGGCCGGGGAGCGGCACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAGGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAAGGGGACTGGGTGGATGATCAACGCCCGGGACAAGGGGTTTTACTATTACCCCCATGGGGGAACCCCTTACACCGGGGGAACTGGCTGTCTCACCAGAAGGCACGGGCCAGGGGGGTGTTACACCCTTACCCTGAGTACCGGGATTCCCCCTAATTTCTTAGAAGCGGGCCGGCCCCCCCCCCGGGGTGGGAAACTTTGGGCCCATTGGGCCCCAAACTTTGTTTTATATTTGGCACGCTTTAAAAAATGGGGGGTTCACAAATTATAAACGCGCAATTAGTCCTCTCTCCTAAAAATTTTTCCT
  5   1   2       bld Te5       in                         CAAO7604.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      TGAAAAGTCAGAGGCACAAAGTGCGGGGAGTCAGTCTCTGTCCGCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACACACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGCACCTGGGTGAATGGGAAACAAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCAAGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGT
  5   1   2       bld Te5       in                         CAAO4661.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GCACAAAGTGCGGGGAGTCAGTCTCTGTCCGCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACACACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGCACCTGGGTGAATGGGAAACAAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCAAGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAG
  5   1   2       bld Te5  5g3  in                        CAAO12730.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CGGGGAGCAGTCTCTGTCCGCTCCGCTCCGCACCGGGTCTGCCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACACACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGCACCTGGGTGAATGGGAAACAAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCAAGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGACCAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAG
  5   1   2   14  bld Te4  5g3  in                         CAAN8998.5p ......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................CCCGAACCCCCACACACCGGCCCCTCAGCCTCTCCGCTCCGGGTCCGACCCCCACACACCGGCCCCTCAGCCCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGCACCTGGGTGAATGGGAAACAAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCAAGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGGAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTC
  5   1   2       bld Te5       in                         CAAO3777.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CCTGACCCCTCTACTCACCGGCCCCTCAGCCTACACTCACCCCGGCCCCAGGGCTCCCCATTCCCAGCCTGTGTCGGTGCCAGGCGCCCGAACCCCGGACATGTCGGACATCGGTTCTGAGGAGTTTGAAGAGGAAGCGGAACCCGATCTGGGGGAGTACGAGGGGGAGCGTAACGAGGCCGGGGAGCGACACGGGCAGGGGAGAGCGCGGCTGCCCAATGGAGACACCTACGAGGGCCAATACGAGGGGGGCAAGAGACACGGGCAGGGAACATATCGATTCAAGAACGGGGCCCGATACATCGGGGAGTATCAGCAGAACAAGAAGCACGGGGCGGGCACCTTTATGTACCCCGATGGCTCCAAGTATGAAGGGGACTGGGTGGATGATCAGCGCCAGGGACAAGGGGTTTACTATTACCCCAATGGGGACACCTACAGCGGGGACTGGCTGTCTCACCAGAGGCACGGGCAGGGGGTGTACACCTACGCTGAGACCGGATCCAAGTATGTCGGCACCTGGGTGAATGGGAAACAAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCAAGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCCACTGCAGAGGCCATGCCCCCTGCCCCAG
  5   1   2       bld Te1       in                        CBWN16705.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               ACTGGATCCAGTATGTTGGCACCTGGGTGAATGGGAAAATAGAGGGATCCGGGGAACTCGTTCACCTCAATCATCGTTACCATGGAAAGTTTGTTGGCAACTCACTCCTTGGACCAGGTAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGTATGAAGAAGAGGAGCCTCTGGGAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGGCGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGTCCAACTCACCTCTAGGATTTCTGAAAAGTGAGGGAGACATTTGCTGAAGAATTGGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTTAGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACGG
  3   1   2       bld Te1       in                        CBWN16705.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ATCGCTTACCCAAGGAAAGTTTGTTGCCAACTCACTCCTTGGACCAGAGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGGCGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGATTTTGTTACTTTAAAAAAAAAAAAAAAAA
  3   1   2      seed Te5       in                         CAAO4090.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AAAGTTTGTTGGCAACTCACTCCTTGGACCAGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTTGTT
  3   1   2       bld Te4  5g3  in                         CAAN8998.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  AGGGAAATACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTTGTT
  3   1   2       bld Te5       in                         CAAO3777.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ACATTTTCGACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTTGTT
  3   1   2       bld Te5       in                         CAAO4661.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ACATTGGATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTTGTT
  3   1   2       bld Te5  5g3  in                        CAAO12730.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ATGTGAGCAGCACGGCGCCTATGAACAGACAGAGCAGGAGAAAGACGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTT
  3   1   2       bld Te4       in                        CAAN11572.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TCCCTGTGTATCGGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCTGTACCGGCCCCACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCCTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTTGTT
  3   1   2       bld Te5       in                         CAAO7604.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GAACAGACAGAGCAGGAGAAAGCCGAGGATGAAGAAGAGGAGCCTCTGGCAGTGCCAGTCACCAGATGGAAAGCTGAGAATATCACTGGCATTACCTACTTATCCCCAACTGCAGAGGCCATGCCCCCTGCCCCAGTGGTCGGAGAGCCCGACGAGGCCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTTTGAAAGTGAGGAGACATTTGCTGAAGAATGAATTTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTTTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTTTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTTGTT
  5   1   2       bld TpA                            TTpA019h10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             CCGAAGCAGCAAGCTCTGAGCCTGTGCCCACGGGAGGTGCCCCTCTGCCAGCAGACCAGGAGGCGGAGCTTGCACTACCGTTAGTGAGTGAAGCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACAC
  5   1   2       bld Te3                                 CAAM15608.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TACAGGCTCCTCCCTGTGTTTGGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACAGGCTCCTCCCTGTGTTTGGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTGTATCGGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCTGTACCGGCCCCACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCAGCCCCTCCCTGTGTATCAGCCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACTGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCNCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACT
  5   1   2       add Gas1                               IMAGE:6988848                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCGAGGCAGTGGGCGTGCCCTCGGAATCCCTAGAAGAAAAAGCCCAACTCACCTCTAGGATTTCTGAAAGTGAGGAGACATTTGCTGAAGAATGAATCTCATCTAACGACCCGAAACCCCAGGACTGAGTGGCAGGTACTGAGATCCCTATAGTGATGGAAACTACAGTCAGTGCCAGCCCGTCGGACCTTAATGCACATCTGTGCCGACCCCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTACGTCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCCCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTACGTCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCCCTCCCTGTGTATCGGTACCGGCCCCTCCCTGTGTATCAGCCTCTCCCTGTGTGTCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGTCTCTCCCTGTGTATCAGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTGTATCGGTACCGGCCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTGTATCGGCCTCTCCCTGTACGTCGGGTACCGGCCCCTCCCCGTGTATCGGCCTCTCCCTGTACGTTGGTACCCGCCCCCTCCCTGTGTATCGGCCTCTCCCTGTAGGTGGGTACCGGCCCCTCCCTGTGTATCGGCCTCCCCCTGGTACATTGGGACCCGGCCCCTCCCTGTGGATCGGCCCCCTCCCGTGTACGGTCAATTACCCGGGCCCCCCAGTCAGTGCCCATCCCCGTCGGAAACTTTAATGGGCCATTTTGTGTGCCAAGCCCCCCTCCCCTGGGGTAATCACACCCCCCCTCTCTCCGTTAAAAGATTAGGGAAGGAAGAAGCAGGCCCCANCATCAGAGGTATATGTAATAAAGGATCCTCTCCTTTCCCTGGTGTATTACCTTTTCTGGGTGTAACACGGGGGGACCCCCCCCCTGTCCCCCTTTTGGGGTGGTTGCT
  5   1   2       add Ovi1                                CABI12954.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       CCAGCCCGTCCCTGTGTATCAGCCTCTCCCTGTACATCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCTCTCCCTGTACGTCGGTACCGGCCTCTCCCTGTACGTCGGTACAGGCTCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCTCCTCCCTGTACGTCGGTACAGGCTCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACAGGCTCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACGTCGGTACAGGCCCCTCCCTGTACGTCGGTACCGGCACCTCCCTGTACATCGATACCGGCCCCTCCCTGTACGTCGGAACCGGCCCCTCCCTGTACGTCGGTACC
  3   1   2       bld Tad0                             NISC_no08a02.x1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 CCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCTCTCTCTCCCTGTACGTCGGTACCGGCCCCTCCCTGTACCCCGGCCTCTCCATGACCACTGGGCCCAGTTCCTGGCAGTCCATTAATAAACAACACTTTGGTTTTGTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)