Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 16 Oct 2019 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA005m06.5                          3 END     2          11       66                Unknown (protein for MGC:121304) [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZT26450.5                            3 END     1           5       50                Unknown (protein for MGC:121304) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012080606 Xt7.1-TEgg039j09.3 - 17 ESTs
                                                                       ....-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                    Xt7.1-TEgg039j09.3               CCACAACGTTCTCAACTACTTCGTGTTTGGAGGGTGACGGGCAGGTGGCGCTGTTGTGGCAGGGTGCATTCATATTGACAGTAGTTGTAACCCTTAATATCTTGAAATAAAACAAATAAATAATGAATCTTACATGCATCTAAACTCTACAAATGAATCTCGCACATTAGCATTTACATATATTGCATACATTTTTAGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCACTAAAAAAAGAAAGAAAATCTAATTAAGCTTAGTTTAGCCTTTAAATAATAAAATTCCAGAGATCGAGGGTTATGTATTGGTTGCTTTGTATACTTATACAGTATCTGTATTGAATATGCGTATAATATACTACCATGTGGTTTTAGACACACAATGTTACATTCTACCTTCTTTTTGTATATTGAATCAAATCTCTCTGTATAATCTGTTATAAATTTTTAATCGTTCCAAAGATAAGAGATGTTAGCTCCAGCCTGACACCACTCATCCCCGCACTTGTGCTCTTTTGGCTACTGCTGGCTGGTAGCATTGGATCTTAGCATCGGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTG
                                                  Xt7.1-CHK-1008231722                     CGTTCTCAACTACTTCGTGTTTGGAGGGTGACGGGCAGGTGGCGCTGTTGTGGCAGGGTGCATTCATATTGACAGTAGTTGTAACCCTTAATATCTTGAAATAAAACAAATAAATAATGAATCTTACATGCATCTAAACTCTACAAATGAATCTCGCACATTAGCATTTACATATATTGCATACATTTTTAGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCACTAAAAAAAGAAAGAAAATCTAATTAAGCTTAGTTTAGCCTTTAAATAATAAAATTCCAGAGATCGAGGGTTATGTATTGGTTGCTTTGTATACTTATACAGTATCTGTATTGAATATGCGTATAATATACTACCATGTGGTTTTAGACACACAATGTTACATTCTACCTTCTTTTTGTATATTGAATCAAATCTCTCTGTATAATCTGTTATAAATTTTTAATCGTTCCAAAGATAAGAGATGTTAGCTCCAGCCTGACACCACTCATCCCCGCACTTGTGCTCTTTTGGCTACTGCTGGCTGGTAGCATTGGATCTTAGCATCGGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTA
                                                      consensus depths                    3     3     3     3     4     4     3     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     4     3     4     4     5     5     5     5     6     6     6     6     6     6     6     5     6     6     7     6     7     6     7     6     7     7     8     8     8     8     8     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10     8     9     9     9     9     9     9     9     8     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---G--------
                                                    Xt7.1-TEgg039j09.3                                                                                          TGA---TAG---TAA------------TGA---------------TAATGA---------------------------TGA---------------------------------------TAG---------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATAA------TAA------------------------------------------TAATAA------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAA---------------TAA------------TAA---ATG------------TGA------------------------------------------------------------------------TAG------------------------------------------------------------TAG---TAG---------TAA---------------------------------TAA------------------------------ATG------------------------ATG---------------------------------TAG---------TAA---------------------------------------------------------------------------TGA---------TAG------------------------------TAA---------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------TAA---ATG------------------TGA------------------------------------------------------------------TAA---------------------------------------TAA---TAA------------TGATAG---------------------------------------------------------------------------------------------------------TAATAA
  3   1   2       bld Brn3      out                        CAAK4733.3p CCTGACAAGTTCATCCACAACGTTCTCAACTACTTCATGTTTGGAGGGTGACAAGCAGGTGGCGCTGTTGTGGCAAAATGCATTCATATTAACAGTGGTTGTAGCCCTTAATATCTTGAAATAAAACAAATAAATAATGAATCTTACATGCATCTAAACTCTACAAATGAATCTCGCACATTAGCATTTACATATATTGCATACATTTTTAGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCCCT
  3   1   2       bld Spl1      in                         CABK1573.3p               CCACAACGTTCTCAACTACTTCGTGTTTGGAGGGTGACGGGCAGGTGGCGCTGTTGTGGCAGGGTGCATTCATATTGACAGTAGTTGTAACCCTTAATATCTTGAAATAAAACAAATAAATAATGAATCTTACATGCATCTAAACTCTACAAATGAATCTCGCACATTAGCATTTACATATATTGCATACATTTTTAGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCACT
  5   1   2       bld Spl1      in                         CABK1573.5p               CCACAACGTTCTCAACTACTTCGTGTTTGGAGGGTGACGGGCAGGTGGCGCTGTTGTGGCAGGGTGCATTCATATTGACAGTAGTTGTAACCCTTAATATCTTGAAATAAAACAAATAAATAATGAATCTTACATGCATCTAAACTCTACAAATGAATCTCGCACATTAGCATTTACATATATTGCATACATTTTTAGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCACTAAAAAAAAAAAAAAAAAA
  3   1   2       bld TpA       out                   TTpA005m06.q1kT7                            CAACTACTTCATGTTGGAGGGTGACGAGCAGATGGCGCTGTTGTAACAAAATGCATTCATGTTGACAGTAGTTGTAACCCTTAATATCTTGAAATAAAACAAATAAATAATGAATCTTACATGCATCTAAACTCTACAAATGAATCTCGCACATTAGCATTTACATATATTGCATACATTTTTAGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGCGATAACTGCACTAAAAAAAAAAAAAAAAAA
  5   1   2       bld Spl2      in                        CBSS8302.fwd                                                                                                                                                         TCTAAACTCTACAAATGAATCTCGCACATTAGCATTTACATATATTGCATACATTTTTAGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCACTAAAAAAAGAAAGAAAATCTAATTAAGCTTAGTTTAGCCTTTAAATAATAAAATTCCAGAGATCGAGGGTTATGTATTGGTTGCTTTGTATACTTATACAGTATCTGTATTGAATATGCGTATAATATACTACCATGTGGTTTTAGACACACAATGTTACATTCTACCTTCTTTTTGTATATTGAATCAAATCTCTCTGTATAATCTGTTATAAATTTTTAATCGTTCCAAAGATAAGAGATGTTAGCTCCAGCCTGACACCACTCATCCCCGCACTTGTGCTC
  5   1   2       bld Te5       in                         CAAO5733.5p                                                                                                                                                                                                                   AGCAGTTCCTGAGATATTAGCAGTTTTTGACTGGCAAAACCAGGCTTTTGGCTCACCAGCTCTCTTTGAAAATCAACCTACGGGTAACTGACTACTCAGGAAGCACAGCGCATGTTCATTTAGGGTCGCTGAGTTTGTTGAGACAAAATTGTCACTTGCTAAAGTCCTCAGAAGAGCACGTCAAGCAGTGCATAACTATAGAGGAAGCAGACCCCATTGCGGGAGGACTGGGGTCTGTGGCTGCTTCCGCTATAGCCCACTCTACTACCGTAAAATTTGCACACCTACTACAATGGACCTGGCTCCCTGTCATTACGCCGCTGAATTGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCACTAAAAAAAGAAAGAAAATCTAATTAAGCTTAGTTTAGCCTTTAAATAATAAAATTCCAGAGATCGAGGGTTATGTATTGGTTGCTTTGTATACTTATACAGTATCTGTATTGAATATGCGTATAATATACTACCATGTGGTTTTAGACACACAATGTTACATTCTACCTTCTTTTTGTATATTGAATCAAATCTCTCTGTATAATCTGTTATAAATTTTTAATCGTTCCAAAGATAAGAGATGTTAGCTCCAGCCTGACACCACTCATCCCCGCACTTGTGCTCTTTTGGCTACTGCTGGCTGGTAGCATTGGATCTTAGCATCGGTTTTTAGCAGTGCANATCANACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAACTGGGATAGATCTAGACACTACTGTAAGGNGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAA
  5   1   2       bld Hrt1      in                         CAAQ6991.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CTGAATTGGGCACCTTTTCATCAATTCATATTTTGGTTTTAGTTCTTCTTTAATACATTTCTTCATATTTAATGTCAGCAAAATAATTGTGGGGTGATAACTGCACTAAAAAAAGAAAGAAAATCTAATTAAGCTTAGTTTAGCCTTTAAATAATAAAATTCCAGAGATCGAGGGTTATGTATTGGTTGCTTTGTATACTTATACAGTATCTGTATTGAATATGCGTATAATATACTACCATGTGGTTTTAGACACACAATGTTACATTCTACCTTCTTTTTGTATATTGAATCAAATCTCTCTGTATAATCTGTTATAAATTTTTAATCGTTCCAAAGATAAGAGATGTTAGCTCCAGCCTGACACCACTCATCCCCGCACTTGTGCTCTTTTGGCTACTGCTGGCTGGTAGCATTGGATCTTAGCATCGGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATtcctatgggatttttaaaagtgtatttatcaatgattaaaagtcagaacgcaccatttgataATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCA
  5   1   2       bld TpA       in                   TTpA059e16.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  TTAAGCTTAGTTTAGCCTTTAAATAATAAAATTCCAGAGATCGAGGGTTATGTATTGGTTGCTTTGTATACTTATACAGTATCTGTATTGAATATGCGTATAATATACTACCATGTGGTTTTAGACACACAATGTTACATTCTACCTTCTTTTTGTATATTGAATCAAATCTCTCTGTATAATCTGTTATAAATTTTTAATCGTTCCAAAGATAAGAGATGTTAGCTCCAGCCTGACACCACTCATCCCCGCACTTGTGCTCTTTTGGCTACTGCTGGCTGGTAGCATTGGATCTTAGCATCGGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAANGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCT
  3   1   2       bld Hrt1      in                         CAAQ6991.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGGCTACTGCTGGCTGGTAGCATTGGATCTTAGCATCGGGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATtcctatgggatttttaaaagtgtatttatcaatgattaaaagtcagaacgcaccatttgataATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGTAAAAAA
  3   1   2       bld Egg                             TEgg039j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGCATTGGATCTTAGCATCAGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAGTGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATGTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGAAAAAAAAAAAAAAAAAA
  3   1   2      seed Te5       in                         CAAO5733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATtcctatgggatttttaaaagtgtatttatcaatgattaaaagtcagaacgcaccatttgataATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGT
  3   1   2       bld Te1       out                       CBWN11797.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAATGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGTGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGTAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA059e16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTTTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATTTTTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATTTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS8302.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGT
  5   1   2       bld Egg       in                   TEgg025j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTAAAAGTGTATTTATCAGTGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATGTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAAT
  3   1   2       bld Egg       in                    TEgg025j10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGTGTATTTATCAGTGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATGTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg                             TEgg012p06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCTGATGGCCTTAGTAGATTCCCGGAAATCATGCCATTCCCACTACCGTAAATATTTTTTAGCAACATTCACGCAATTTGCAACACACCCTTGCCCATGAGAATATGTATTGTCGCCATTAAACAGTCATTTGGAGCGTAAGCATATCAGTGTGCTCCTTCGTTGAGCACTGGAATTGATGGGTAAAGCACAGAACCTGTGGGTAAAACATGTCCCTTGGCATCCAAAGTATTGACATTTTGCACCATGCAATGACTTGGTAAAGGTCCCTAATATTTCTTCTGTAGAACTTGACAGAATTTAAAATAGATTAGACCCCGTGGCCAACCCAGATAATGACAAACAAATTTAAAATGTAATGTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTAAAACATTGTTATACATCCAAGAGCAACAGAAATCTGCAAGGACCTATTGTGTTATTCCGCATTGTAATAAACACACTTGTATCAAAATGTTATACCTTATAGAATGCTATTTTTATAAATAATACATTATTTTTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)