Gurdon Institute Xenopus tropicalis EST Database

+ Application in use by Guest User - 18 Jul 2019 - database INFO-PUBLIC =
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient



Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-TTpA005m06.5                          3 END     2          11       66                Unknown (protein for MGC:121304) [Xenopus tropicalis]
     2   2.0    0Xt7.1-XZT26450.5                            3 END     1           5       50                Unknown (protein for MGC:121304) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012080606 Xt7.1-TEgg039j09.3 - 17 ESTs
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      consensus depths                    3     3     3     3     4     4     3     4     4     4     4     4     3     4     4     4     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     3     3     3     3     3     3     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     4     3     3     3     4     3     4     4     5     5     5     5     6     6     6     6     6     6     6     5     6     6     7     6     7     6     7     6     7     7     8     8     8     8     8     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11    10    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    10    10    10    10    10     8     9     9     9     9     9     9     9     8     9     9     9     9     9     8     9     9     9     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     7     8     7     8     7     8     7     8     7     8     7     8
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       G-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ---G--------
                                                    Xt7.1-TEgg039j09.3                                                                                          TGA---TAG---TAA------------TGA---------------TAATGA---------------------------TGA---------------------------------------TAG---------------TAG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGATAA------TAA------------------------------------------TAATAA------------------------------------------------------------------------------------------------------ATG---------------------------------------------TAA---------------TAA------------TAA---ATG------------TGA------------------------------------------------------------------------TAG------------------------------------------------------------TAG---TAG---------TAA---------------------------------TAA------------------------------ATG------------------------ATG---------------------------------TAG---------TAA---------------------------------------------------------------------------TGA---------TAG------------------------------TAA---------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------TAA---ATG------------------TGA------------------------------------------------------------------TAA---------------------------------------TAA---TAA------------TGATAG---------------------------------------------------------------------------------------------------------TAATAA
  3   1   2       bld Hrt1      in                         CAAQ6991.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTGGCTACTGCTGGCTGGTAGCATTGGATCTTAGCATCGGGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATtcctatgggatttttaaaagtgtatttatcaatgattaaaagtcagaacgcaccatttgataATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGTAAAAAA
  3   1   2       bld Egg                             TEgg039j09.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            TAGCATTGGATCTTAGCATCAGTTTTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAGTGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATGTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGAAAAAAAAAAAAAAAAAA
  3   1   2      seed Te5       in                         CAAO5733.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    TTTAGCAGTGCAAATCAAACAACATATTGTTGAATGTAACTGTTATAGAATGCAAAAAACTGGAATAGATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATtcctatgggatttttaaaagtgtatttatcaatgattaaaagtcagaacgcaccatttgataATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGT
  3   1   2       bld Te1       out                       CBWN11797.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATCTAGACACTACTGTAAGGGGCAGACTTATCGAAATGTGAGTTTAGAGCTTAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAATGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGTGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGTAAAAAAAAAAAAAAA
  3   1   2       bld TpA       in                    TTpA059e16.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TAATACATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTTTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATTTTTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATTTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS8302.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CATAAAAACTCATGTTCTGTTCATTCCTATGGGATTTTTAAAAGTGTATTTATCAATGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATTTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTGT
  5   1   2       bld Egg       in                   TEgg025j10.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTTTTAAAAGTGTATTTATCAGTGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATGTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAAT
  3   1   2       bld Egg       in                    TEgg025j10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AAAAGTGTATTTATCAGTGATTAAAAGTCAGAACGCACCATTTGATAATGAATAGAACATAACCTAACTTTATATTACCAATGTAAAGGTAGTGAGTTGCATCAATAACTGCTACCAACTTGTGCTAGGCAAATTCAGATGCTGATGGCCTTATTAGAATCCTGGAAATCATGCCATTCCCACAACGTAAATATTTTTTAGCAACATTCATGCAATTTGCAAAACACCCATGCTAATGAGAATATGTATTGTTGCATTAAACAGACATTTTAGCGTATGCATATTAGTGTGCACCTACGTTGACACTGGAATTCTGGGTAAAACACAGAACTGTGGGTAAAACATGTCACTTTGCATCCAAAGATGACATTTTGCACCATGCACTGACTTCGTAAATGTCCCTAATATCTCTTCTTTAGAACTTGACAGAATTTAAAATAGATTAGACTTAGTGACCAACCCAGATAATGACAAATAAATTTAAAATGTAATTTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTCAAACATTGTAAACATCCAAGAGCAACAGAAATCTGCAATGACTTATTGTTTTATTTTGCATTGTAATAAACACACTTGTATCAACTGTTATACCTTAAGAATGCTATTTTTATAAATAATACATTATTTTTTAAAAAAAAAAAAAAAAAAAA
  3   1   2       bld Egg                             TEgg012p06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        GATGCTGATGGCCTTAGTAGATTCCCGGAAATCATGCCATTCCCACTACCGTAAATATTTTTTAGCAACATTCACGCAATTTGCAACACACCCTTGCCCATGAGAATATGTATTGTCGCCATTAAACAGTCATTTGGAGCGTAAGCATATCAGTGTGCTCCTTCGTTGAGCACTGGAATTGATGGGTAAAGCACAGAACCTGTGGGTAAAACATGTCCCTTGGCATCCAAAGTATTGACATTTTGCACCATGCAATGACTTGGTAAAGGTCCCTAATATTTCTTCTGTAGAACTTGACAGAATTTAAAATAGATTAGACCCCGTGGCCAACCCAGATAATGACAAACAAATTTAAAATGTAATGTCATGATAGTTTCTGTTTAAAGAAGGGGTTAGAGGTGCAGAGCTTGCATTAAAACATTGTTATACATCCAAGAGCAACAGAAATCTGCAAGGACCTATTGTGTTATTCCGCATTGTAATAAACACACTTGTATCAAAATGTTATACCTTATAGAATGCTATTTTTATAAATAATACATTATTTTTTAAAAAAAAAAAAAAAAAA

In case of problems mail me! (