Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC10751.3                          11 END     5          33       45                (no blast hit)

 This cluster: approximate FL confidence score = 66%

 1012080759 Xt7.1-CABD7672.3 - 15 ESTs
                                                                       ..-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540......1550......1560......1570......1580......1590......1600......1610......1620......1630......1640......1650......1660......1670......1680......1690......1700......1710......1720......1730......1740......1750......1760......1770......1780......1790......1800......1810......1820......1830......1840......1850......1860......1870......1880......1890......1900......1910......1920......1930......1940......1950......1960......1970......1980......1990......2000......2010......2020......2030......2040......2050......2060......2070......2080......2090......2100......2110......2120......2130......2140......2150......2160......2170......2180......2190......2200......2210......2220......2230......2240......2250......2260......2270......2280......2290......2300......2310......2320......2330......2340......2350......2360......2370......2380......2390......2400......2410......2420......2430......2440......2450......2460......2470......2480......2490......2500......2510......2520......2530......2540......2550......2560......2570......2580......2590......2600......2610......2620......2630......2640......2650......2660......2670......2680......2690......2700......2710......2720
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-CABD7672.3             CTCTGGAAGGAGTTAGGCTTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCAACTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTATAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTATTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGTGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTT
                                                  Xt7.1-CHK-1008232643                   AAGGAGTTAGGCTTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCAACTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTATAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTATTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGTGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTTTTTTTA
                                                      consensus depths                  3     4     4     4     5     5     5     5     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     9     8     9     8     9     8    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10    10    11    10    12    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    11    13    13    15    13    15    13    15    13    15    14    15    14    15    14    14    13    13    13    13    13    13    13    13    13    13    12    12    12    12    11    12    11    12    10    11    10    11    10    11    10    11    10    11     8     9     8     9     8     9     8     9     7     8     7     7     6     6     6     6     6     6     6     6     6     6     5     5     5     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 A-----------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     --------C---
                                               BLH ATG      89     120             
                                               BLH MIN      89      12             
                                               BLH MPR      89      12             
                                               BLH OVR      89       9             
                                               CDS MIN      89      12             
                                               EST CLI     -12      12             
                                                                                                                                                                            PROTEIN === Mm ==== 1e-011     NP_038940.1 apelin [Mus musculus] ===================================================================================================================================================================
                                                                                                                                                                            PROTEIN === Hs ==== 2e-012     NP_059109.3 apelin preproprotein; peptide ligand for APJ receptor [Homo sapiens] ====================================================================================================================
                                                                                                                                                                            PROTEIN === Xl ==== 9e-035     ABF06592.1 preproapelin-a [Xenopus laevis] ==========================================================================================================================================================
                                                                                                                                                                            
                                                      Xt7.1-CABD7672.3                                                                                                      ATG------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------ATG------TAA---TAA---------------------------------------------------------------------ATG------------------ATGTGA------------------------------------------------------------------------------TGA---------ATG---------------------------------------------------TAA------------------------------------------------------------------ATG------------------------------------------TAA---ATG---------------------------------------------TAATGA------------------TAA---ATG------------------------------TGA---------------------------------------------------TAAATG---TGA---------------------ATG---ATG---TAA---------TAG------------------------------------------------------------------------------------------ATG------------------------------------------------------------------TAA------------------------------------TAA------------------------ATG---------------ATG
                                                                   ORF                                                                                                      ... open reading frame                                                                                                                                                                                                             ]
  0   1   1           Gas  FL                     TGas125b18.FL-Sanger                                 TTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGACCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCAACTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTATAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTATTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGTGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTTTTTTTAAGTATGAATGGCTGTATTCTATTTATTTTGTGATATTTTAATTTAATGAGATTGTTAGAGATTTGTGGTTTTTGGGCATTGTCAATGTTATAAAAAAATATTTTAAAGAATACAACATGCTTAATTGTTAGGATCTGACCAAAACTTCCATCTAGACCCCCTTTTTAATGTAAACCCTTTTACCCCATGGTATTGGCAATATTAATTATAATAATTTCCAAGTACATGGTCTTTTTAAAGTGGACTAAAACAGCCAAATCCTAATTCCAGTATGGTGACTTCATGTTATATTTTATAAGGGGTTATTGACTATGCTCCAACTAATTCAGAGCAGATATTGTGGTCTACAAGAAGGCCCATATTCAGCATTTCTGGGGCCCCTTAGATTTCATCCTGAGCCTGTAAGTTGTGCCCTTGAGGCATGGTAGAGGCTCCCCGTCCCACCCTTTGCATTGGTAAAAGGCAAAGCCTCAGACAGTTTTGGCTAGAGTGTGCAAAACTTGGGACTTACAGATATCTGGATACACTGAAAATGAGAAACTATAGAACCATCTCTGTGGTTGGTAGTTTCGATTCTTAATATGGTTGATAGTGGCTTCACAATGAAGCTCACATGGCATAGTGTTTGCTACTATCTAGCAGGTGTTTCCTTGGAAACCTTTAGTTATCTAATAATAAGTTTTATATTCCACCTGACTAATGTATTTAGCCTTTCTGCTGATGAATAAGTCAAATATTATCAAAACATATTCAAATGTAAATGTGCTCATTGTTCAGTAAGTAATAGATAATATATGTAATAGATCAATGGTGGTGCTCATGGCCCTCTTGCCTTAGCTGTCAGGAGATGTAAGCAGTGAGGAAGAACTTAGGACACCCATATCCGGAAAATGTATCTGTGTGGGTCTAATAAATGTAAGAGTTATGTCTAACAAAACAGCTCTGTTTCATATCAATGTCAATAGCTAATTCATCTAAAACACATTTTACAACAACATTGGCCGCAACAAAATGCCTGTGCAGCCACTGGTCATGCTGATGTTATTTTCCCACACTGTAAAGAAGAAAATAGGATACAGACTTGCTATATATTCACTTGACACATCAGCACCTTTTAAAATTCATTAAAAAATCAGATCCAGCACCACACTGCCAACAAAGGCATCTTCTTGTGACACCAAGTATAGATCATATTTCCCTCACGTACCGAGTGAAACATAATGCGCACATGAGAGAATCCTGAACAGCCAGCTGTATTCCATATTCTACTGGGCAGAGATACTGTACACATATCTAGAGTATTTGAAGATCTAGTCTTAATATTCATTTAGCTGTAATACACTATGTAACTAAGCATAATTACTCTGTAACAACCATAGTTTTTTTTATATAATATCTATAGTAAAGACTGTATGATTAACTATAGTAATCAAAGATTATATTTTGTATCCGGATCCCCTTGGTTACAAATACATGAGGTTTAAGCATTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       bld HdA  5g3  out                  THdA041i13.p1kSP6 ACTAGAGCTCCCTCTGGAAGGAGTTAGGGCTTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGACCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAANAATGTTGGTGCTGAGCAAAATTTGTGTCTTANACTGAAAAGGAAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAAATGGGTTTGATCACTGGGACATATCTCATTATGGACATGTCAT
  5   1   2   10  bld Tbd1 5g3  in                         CBXT4667.b1 GACTAGAGCTCCCTCTGGAAGGAGTTAGGCTTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTACAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCA
  5   1   2   12  bld Tad5 PIPE in                         XZT16680.5p ...TAGAGCTCCCTCTGGAAGGAGTTAGGCTTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAAATCAGCGTTTGAGCCTCTAATGAGC
  5   1   2       bld Gas  5g                        TGas044f15.p1kSP6          TCCCTCTGGAAGGAGTTAGGCTTTTCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATTAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATG
  5   1   2       bld Gas  FL   out                  TGas125b18.p1cSP6                                  TCCAATACACACAGCTCGCTTCTTGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATACTTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGACCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGACATTTGTGTATCTCT
  3  -1   2      seed Lun1      in                         CABD7672.3p                                                         TGGATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGACCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACC
  5   1   2   14  bld Brn3 5g3  out                       CAAK11756.5p ..........................................................GATTCAGCACAGTTCTGCTCGCTCGCACTCAGCCACAAGAAACATGAATCTCAGACTTTGGGCACTGGCGCTTCTGCTCTTCATTTTAACCTTGACTTCAGCATTTGGAGCTCCACTGGCTGAAGGCTCAGATAGAAATGATGAAGAACAGAATATCCGGACACTGGTAAACCCAAAAATGGTCCGTAACCCTGCACCTCAACGGCAAGCCAACTGGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATTAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACATGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTANACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACT
  5   1   2       chi HdA       out                  THdA016e24.p1kSP6                                                                                                                                                                                                                                                                AAGCCCTGCACCTGATGCGACACTGTGCTTACGTTTAATGACGCAATGCTCACGTGATGAGACTTGGGCGTAGGGATTTTCAGTAAAATAGGGGGCCAGGAAGCTGCAGTTAATTTTTTTCCGGAGGAGTAAGTAGCGACCGGGAACTGTGGGCTGTGTTTGGGAAATCATGACTGTACGGCAGTATGAAAGCTGTATAGAGGGAAAGAACATGCATGTACCCTAGCAACCGAAGTGTGCGGCTGACACAACGGGGGCAGGATAGCCATGTGTTTGCCGCACTCCCGCCCCTCTTCTCAGCTCCCACCCGGTAGATCCTGATATTGACCACCGGATCTTCACCGACGGCGACCCTGTAAGCGCGATGATATCTCCTTCACTGGCATTGCCCGAGACCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTACGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTC
  3   1   2       bld BrSp                             EC2BBA21BF02.b1                                                                                                                                                                                                                                                                                  GGAGAAAAATCCGACGTCAAAGACCTCGCCTTTCACACAAGGGCCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACACGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTACAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATACATTTAGGTTCCA
  5   1   2       bld Limb      out                       CBSU8123.fwd                                                                                                                                                                                                                                                                                                                         GTCACCCAATGCCCTTCTAAGAATAAAAAGATTTATTGGAATTGAGTTGTCCCCACCAACTGCATAATCTGCTATGTTTGGCATGGAACCCTGTGATGCTCAGAGAGATTGAAAACACGTGAGTCCAGCTGCCTTCGGTCCTATGGATTTGCCTCTTCAACTTTTATTACAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCAACTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTA
  3   1   2       bld Tbd1 5g3  in                         CBXT4667.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCCTCTTCAACTTTTATTACAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCATTTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTGTAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTATTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGTGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTTTTTTTAAGTATGAAAAAAAAAAAAAAA
  5  -1   2       bld Lun1      in                         CABD7672.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAACTTTTATTGCAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGACCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCAACTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTATAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTATTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGTGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTTTTTTTAAGT
  3   1   2       bld Tad5 PIPE in                         XZT16680.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAAGATATATTGGATCAAAGGACACTGCATTGAGGGATTGTCATGTGTTCCCAGGATTCCAGCAATTCATCTCTGCTCCCCAAAGGGAGATCTTCCTAATTACTACTGGATCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCATCTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTGTAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTATTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGTGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTTTTTTT
  5   1   2       bld Fat1      out                       CABC10751.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TCACGAACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCGTGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCAACTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTATAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTATTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGTGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTTTTTTTAAGTATGAATGGCTGTATTCTATTTATTTTGTGATATTTTAATTTAATGAGATTGTTAGAGATTTGTGGTTTTTGGGCATTGTCAATGTTATAAAAAAATATTTTAAAGAATACAACATGCTTAATTGTTAGGATCTGACCAAAACTTCCATCTAGACCCCCTTTTTATGTAAACCCTTTTACCCCATGGTATTGGCAATATTAATATAATAATTTTCCAGTACATGGTCTTTTTT
  5   1   2       bld Neu                            TNeu026p01.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AACAGCTAAAGCAATGTTATTGCACTAAGATCTCCTTCCTGGCATTGCCCATGCCTTACTCTGCATTTTGTGTATCTCTAACATCATCATATGTTTAAGGAATGTCTAACAGCCCTTTTGCACACTTTCCAATCAAGCGTTTGAGCCTCTAATGAGCCAAAAAATGTTTGTGGTAAAAAATGTTGGTGCTGAGCAAAATTTGTGTCTTAAACTGAAAAGGAGGCTGGTGTGAAACATATACTATTTGCATTAGGCTACTTTCAACCTAAATGGGTTGATCCACTGGGACATATCTCATTATGGACATGTCATAAAGATTCCTTTAGGTTCCAAGCCCCTTGCCTGTGGCAACTACCTTATTTCTCCCCAAGAAGCTGTTGGATTTTTTTTCTTTTTTAGAAAAAAAAAAAGTATTAATGAATAGAAGCCATCCAAATAGCACTTTCTATAACACACATGCTTTAACGGGTTCATTTCATGAAAACTAAAAGAAAACAAATAACAGTNTTGTGTTCATTTTTTTGTAATGCTCTTTTCTCTTCTTTAAACAAATGGTTCTCTTTGGGTATATGTATATATATGTATATGTATCTCTGAAAAGAAGATTCTTATTTTT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)