Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 20 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 32%

 1012080860 Xt7.1-CAAJ15237.5.5 - 16 ESTs
                                                                       ...-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520......1530......1540.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                   Xt7.1-CAAJ15237.5.5                                                                                                                                                                                                            GGGTTGTGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAATATGAAATGTTATAAAAGCCATT
                                                  Xt7.1-CHK-1008232022                                                                                                                                                                                                                  TGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTxxAxxTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAxAxxAAATGTTATAAAAxxxAxxGCCATT
                                                      consensus depths                                                                                                                                                                                                                 2     4     4     6     5     7     5     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     8     8     9     9     9     9     9     9    10    10    11    11    11    11    11    11    10    10    10    10    12    12    12    12    12    12    12    12    11    12    11    12    10    11    10    11    10    11    10    10    10    10     9     9     9     9     9     9     9     9    11    11    10    11    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10     9     9     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     7     8     8     8     8     8     8     8     9     9     8     9     9     9     5     9     5     9     5     9     4     8     4     8     4     7     4     7     4     7     3     6     3     6
  5   1   2                                         Xt7.1-TTpA004m10.3                                                                                      TGGCAGTGCGGCCTGTACTTGTTCTGCTCTTCCACTTAGGAATGCAGTGCAGCTGCTCTTGGTATTTTAGTTTGTGTGTGGTTAGTGGCACATTCCCCAGCGAGACTCTGACTCCATGTTAAGCCATAGCAAGCAAATGGGGTACCTAAAATAATTAATCTAAAGGGGAAATAATCTTTATCTTTGAATAAAGAAAAGATGTAATGCAAAATTTGCAGCTTCCAGAATAAGCGCAGCATCTGAACTCATATTGGTACAGCTATAAGTAGAAGACCTGGACCTGTCATGTGGAGAAAAAAAAATAATACATTAGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGC
  5   1   2  SIG                                     Xt7.1-CAAJ15237.5                                                                                                                                                CCGGGGGCAAACACGTGTGCTCTTCTGCTGATATTGGTTTCGTTTTTAAACGCTCCAGAGGGGGTTGTGGGATAGCAATGGCGGTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACAGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCATACCTGAGACTTTCACGGCTTTTTATTTGTGTTATAAAAACCTCTAGGAATAAGTTTAGGCTAAAAGCCATTCTGACAAAATGAAAAATGGGTAAAAGTCTTTTACTCCAGACTACCAAACTGCAAAGCTTTGCTAAAATTAGATTTTTATTTTTTTTAATGCAATTTCTAAACATCGCATGAGAGCTTGCATTTTACAGAATGTTATCTCCCACATTTTCTTTGATATAAATTATATACAAAAATGAAAACAGGGTTAATTTTTATGGCTGATGTTCTGCTACTGCAATAAATGCACATACTATATGCATAGTATGATT
  5   1   2  SIG                                      Xt7.1-XZG29072.3                                                                                                                                                                                         TTTTTAAACGCTCCAGAGGGGGTTGTGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCCA
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AATTTCAAATATTACTAAATTTAAAAAAAGTCAGTT
                                                                   VAR                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCA
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ----------A-
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        --------A--T
                                               BLH ATG      16      49                                                                                                                                                                                                            
                                               EST CLI      -3       5                                                                                                                                                                                                            
                                                                       PREDICTED - Sp ---- 3e-023     XP_001176515.1 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN === Mm ==== 3e-028     NP_113552.2 neugrin; neurite outgrowth associated protein [Mus musculus] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                       PREDICTED - Dr ---- 1e-035     XP_698133.1 PREDICTED: similar to mesenchymal stem cell protein DSC92 [Danio rerio] -----------------------------------------------------------------========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                              PROTEIN --- Hs ---- 5e-039     NP_001028260.2 mesenchymal stem cell protein DSC92 isoform 2 [Homo sapiens] ----======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                         PROTEIN === Xt ==== 0          AAI18832.1 LOC779519 protein [Xenopus tropicalis] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                   Xt7.1-CAAJ15237.5.5                                                                                                                                                                                                                            ATG---------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------ATG---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATGATG------------------------------------------------------------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------------------------ATG------------------------------------------------------------TAA------------------------------------------------TAA------------------------------------------------TAAATGTAA---------------------------------------TGA---------------------ATG---TAA
                                                                   ORF                                                                                                                                                                                                                            ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          ]
  5   1   2                                         Xt7.1-TTpA004m10.3                                                                                      TGGCAGTGCGGCCTGTACTTGTTCTGCTCTTCCACTTAGGAATGCAGTGCAGCTGCTCTTGGTATTTTAGTTTGTGTGTGGTTAGTGGCACATTCCCCAGCGAGACTCTGACTCCATGTTAAGCCATAGCAAGCAAATGGGGTACCTAAAATAATTAATCTAAAGGGGAAATAATCTTTATCTTTGAATAAAGAAAAGATGTAATGCAAAATTTGCAGCTTCCAGAATAAGCGCAGCATCTGAACTCATATTGGTACAGCTATAAGTAGAAGACCTGGACCTGTCATGTGGAGAAAAAAAAATAATACATTAGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGC
                                                  Xt7.1-CHK-1008297386                                                                                            TGCGGCCTGTACTTGTTCTGCTCTTCCACTTAGGAATGCAGTGCAGCTGCTCTTGGTATTTTAGTTTGTGTGTGGTTAGTGGCACATTCCCCAGCGAGACTCTGACTCCATGTTAAGCCATAGCAAGCAAATGGGGTACCTAAAATAATTAATCTAAAGGGGAAATAATCTTTATCTTTGAATAAAGAAAAGATGTAATGCAAAATTTGCAGCTTCCAGAATAAGCGCAGCATCTGAACTCATATTGGTACAGCTATAAGTAGAAGACCTGGACCTGTCATGTGGAGAAAAAAAAATAATACATTAGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTT
  5   1   4      seed TpA       in                   TTpA004m10.p1kSP6                                                                                      TGGCAGTGCGGCCTGTACTTGTTCTGCTCTTCCACTTAGGAATGCAGTGCAGCTGCTCTTGGTATTTTAGTTTGTGTGTGGTTAGTGGCACATTCCCCAGCGAGACTCTGACTCCATGTTAAGCCATAGCAAGCAAATGGGGTACCTAAAATAATTAATCTAAAGGGGAAATAATCTTTATCTTTGAATAAAGAAAAGATGTAATGCAAAATTTGCAGCTTCCAGAATAAGCGCAGCATCTGAACTCATATTGGTACAGCTATAAGTAGAAGACCTGGACCTGTCATGTGGAGAAAAAAAAATAATACATTAGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATG
  3   1   4      seed TpA       in                    TTpA004m10.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCATAAAAAAAAAAAAAAAAAAAAA
  5   1   2  SIG                                     Xt7.1-CAAJ15237.5                                                                                                                                                CCGGGGGCAAACACGTGTGCTCTTCTGCTGATATTGGTTTCGTTTTTAAACGCTCCAGAGGGGGTTGTGGGATAGCAATGGCGGTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACAGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCATACCTGAGACTTTCACGGCTTTTTATTTGTGTTATAAAAACCTCTAGGAATAAGTTTAGGCTAAAAGCCATTCTGACAAAATGAAAAATGGGTAAAAGTCTTTTACTCCAGACTACCAAACTGCAAAGCTTTGCTAAAATTAGATTTTTATTTTTTTTAATGCAATTTCTAAACATCGCATGAGAGCTTGCATTTTACAGAATGTTATCTCCCACATTTTCTTTGATATAAATTATATACAAAAATGAAAACAGGGTTAATTTTTATGGCTGATGTTCTGCTACTGCAATAAATGCACATACTATATGCATAGTATGATT
                                                  Xt7.1-CHK-1008297388                                                                                                                                                      GCAAACACGTGTGCTCTTCTGCTGATATTGGTTTCGTTTTTAAACGCTCCAGAGGGGGTTGTGGGATAGCAAxGxxGxTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACAGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCATACCTGAGACTTTCACGGCTTTTTATTTGTGTTATAAAAACCTCTAGGAATAAGTTTAGGCTAAAAGCCATTCTGACAAAATGAAAAATGGGTAAAAGTCTTTTACTCCAGACTACCAAACTGCAAAGCTTTGCTAAAATTAGATTTTTATTTTTTTTAATGCAATTTCTAAACATCGCATGAGAGCTTGCATTTTACAGAATGTTATCTCCCACATTTTCTTTGATATAAATTATATACAAAAATGAAAACAGGGTTAATTTTTATGGCTGATGTTCTGCTACTGCAATAAATGCACATACTATATGCATAGTATGATTACAACC
  0   1   1           Brn2 FL                         CAAJ15237.FL-MGC                                                                                                                                                                                                                    GGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACAGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  5   1   2       ext Neu  5g                        TNeu135h04.p1cSP6                                                                                                                                                CCGGGGGCAAACACGTGTGCTCTTCTGCTGATATTGGTTTCGTTTTTAAACGCTCCAGAGGGGGTTGTGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAAGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTGTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCT
  5   1   4   14 seed Brn2 FL   in                        CAAJ15237.5p ...................................................................................................................................................................................................................GGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTG
  5   1   2   12  ext Gas7 5g3  in                         XZG21845.5p ........................................................................................................................................................................................................................GCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGG
  3   1   4      seed Brn2 FL   in                        CAAJ15237.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACAGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCTT
  3   1   2       ext Gas7 5g3  in                         XZG21845.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTACCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACAGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCATACCTG
  3   1   3        nb HeRe                              EC2BAA1BH12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGTTCAAACACCCAAGTTTGCCATGTATGATGTTGGTCCGACCTCAGAGGATGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTTTTTGACAGCAATGGTGATTTTTTTTACCGGATTTAGCTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATTTAACATTTTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTTTACCACTGGGATTTTTGC
  3   1   3        nb HeRe                              EC2CAA1BH12.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            GCAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGATGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAGCTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTTTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATAT
  5   1   2       ext Gas7                                  XZG8842.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCATACCTGAGACTTTCACGGCTTTTTATTTGTGTTATAAAAACCTCTAGGAATAAGTTTAGGCTAAAAGCCATTCTGACAAAATGAAAAATGGGTAAAAGTCTTTTACTCCAGACTACCAAACTGCAAAGCTTTGCTAAAATTAGATTTTTATTTTTTTTAATGCAATTTCTAAACATCGCATGAGAGCTTGCATTTTACAGAATGTTATCTCCCACATTTTCTTTGATATAAATTATATACAAAAATGAAAACAGGGTTAATTTTTATGGCTGATGTTCTGCTACTGCAATAAATGCACATACTATATGCATAGTATGATTACAACCCNNaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaGG
  5   1   2  SIG                                      Xt7.1-XZG29072.3                                                                                                                                                                                         TTTTTAAACGCTCCAGAGGGGGTTGTGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCCA
                                                  Xt7.1-CHK-1008297390                                                                                                                                                                                               AACGCTCCAGAGGGGGTTGTGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCCATTTTCA
  5   1   4   12 seed Gas7 PIPE in                         XZG29072.5p ........................................................................................................................................................................................TTTTTAAACGCTCCAGAGGGGGTTGTGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACACCTTATTGCTTAGATCAGAGAATGAAATG
  5   1   2       ext BrSp 5g3  in                     EC2BBA18CF07.g1                                                                                                                                                                                                         GGGGGGTTGTGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCAAAGCTTTCTCCACCCGAGAGACGTAGAGCAAAGCAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAACCTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGG
  5   1   2       ext TpA  5g3  in                   TTpA001e22.p1kSP6                                                                                                                                                                                                                  TGGGATAGCAATGGCGGCTTTAGGGGTCGCCGTGTGTCGCTTTCGAGGAGCTTGCTGCTCTTTAGTTTCATCGTGGTGTAGTTCTCGGAGACTGGTAGTTACCAAAAAAACTTTTTCTTCCAAAACGTGGGGAGAATCTGACTCTGAGACGGAGATGGAGGAAGAGGAGTCGCTGAGTGAAATAACCCGAAAACTTAAAAATCAGCAGAAAGCAATTTTGTTTCAACGAATGAAAAGGCAAATGGAACCTCGTGGTCCACCAGAAAGAAGACTTACATGGAATGCAATAGAAGAAATCAGGTATTTGAAGCAAGAGTTCCCTGATGAGTGGACTGTGCCCAGGCTGGCTGAGGGGTTTAACGTCAGTACTGATGTTATAAGAAGAATTATAAAATCACAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTANATCCTGCCTCAGCACTAATTCCCAGTGGAGCAAATGATAAACTGATAATCAACACACAAGACCTCTGACCTTGTATCTTTCTCCAGGCTCCCTGCCTGCCTCTGNCAACCGTAACAGCTTATTGC
  3   1   4      seed Gas7 PIPE in                         XZG29072.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        AAAATCAAAGCTTTCTCCACCCGAGAGACGTAAAGCAAAACAGGATATAAAGGTTTCAAATGTTTTAATACAACCAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCATTTTCAT
  3   1   2       ext BrSp 5g3  in                     EC2BBA18CF07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAAATAAGCAATCGACAAAGCATCTGTCACAGCCCACCCAAACTCTCCTCCTAGGTGCTCTAAATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCCTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCACCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTCTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAA
  3   1   2       ext TpA  5g3  in                    TTpA001e22.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                AATCCTGCCCAAGCACTAATTCCCAGTGGACAAAATGATAAACTGAAAATCAACACACAAACCTCTGACCTTGTTCTTTCTCCAGGCTCCTTGCCTGCCTCTGCAAACCGTAACAGCTTATTGCTTAGATCAGAGAATGAAATGATGCAAAGAAACAAAGCAAATCTTCAAGTTTGCTCCAAGAAGGCACAAGTTCAAACACCCAAGTCTGCCATGTATGATGTTGGTCCGACCTCAGAGGAAGGCAGCCAAGCAGAGCAGCAGCACTGTGTAGATGATAAGCAGATGGAGCTTGATGAATGGGATGGACAGTTGCTTAGTGACACTGACCTTGAGGAATTATCAAGAAGTGGAATTGAAAACAAAATGAAAGTCATACAGAGAGGCAGGGAGTTCTTTGACAGCAATGGTGATTTTCTTTACCGGATTTAACTCATCAAATGCAAATCCTGTTGTTGTGTGTATGTAAATTGGTATATCTAACATTTTAACTTTCATTTAATTTCAAATATTACTAAATTTAAAAAAAGTCAGTTGTAAATATATTTATTTTTCATTCTACCATGTGATTCTTGCCACTGAGGATATATCAAAGAAGAGCAATATGAAATGTTATAAAAGCCCATTTTCATAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)