Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 94%

 1012080921 Xt7.1-CAAO10684.5 - 17 ESTs
                                                                       .........0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAO10684.5          CTTGATGAGACTTCCGGTGGGATTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCAC
                                                  Xt7.1-CHK-1008231609                GAGACTTCCGGTGGGATTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCACTTCGAC
                                                      consensus depths               2     2     4     4     6     8     7     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9     8     9    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    12    13    11    13    13    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    13    12    12    12    12    11    11    11    11    11    11    11    11    10    10    10    11    10    11     9    10     9    10     8     9     9    10     9    10     9    10     8     9     8     9     8     9     8     9     8     9     6     9     7     8     7     7     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     6     7     6     7     6     7     6     7     5     7     4     4
                                                                   SNP                                                                      --T---------
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                          ---------A--
                                               BLH ATG      57     781          
                                               BLH MIN      57     135          
                                               BLH MPR      57     135          
                                               BLH OVR      57      34          
                                               CDS MIN      57      28          
                                               EST CLI      10      28          
                                               ORF LNG      57       4          
                                                                                                                                            PROTEIN === Sc ==== 5e-018     NP_010587.1 Functions in cleavage of 3'-ends of pre-mRNAs, prior to polyadenylation; 23.5%identical to the 160-kDa subunit of mammalian cleavage and polyadenylationspecificity factor (CPSF-160); Cft1p [Saccharomyces cerevisiae] =============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED = Sp ==== 3e-068     XP_001201130.1 PREDICTED: similar to LOC564406 protein [Strongylocentrotus purpuratus] =========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Ce ==== 1e-069     NP_500157.2 cleavage polyadenylation specific factor 1 160kDa (4C774) [Caenorhabditiselegans] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Dm ==== 1e-115     NP_995833.1 CG10110-PA, isoform A [Drosophila melanogaster] ================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                           PREDICTED - Dr ---- 6e-132     XP_692836.1 PREDICTED: similar to Cleavage and polyadenylation specificity factor, 160 kDa subunit (CPSF 160 kDa subunit) [Danio rerio] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Mm ==== 0          NP_444423.1 cleavage and polyadenylation specificity factor 1; CPSF160 [Mus musculus] ======================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PROTEIN === Hs ==== 0          NP_037423.2 cleavage and polyadenylation specific factor 1, 160kDa [Homo sapiens] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED = Xl ==== 0          AAH60475.1 Unknown (protein for IMAGE:4032917) [Xenopus laevis] ============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAO10684.5                                                                   ATG------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------ATG---ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------ATG
                                                                   ORF                                                                   ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   ...
  0   1   1           Neu  FLt3                   TNeu108p17.FL-Sanger                     GGGAATCCCCGGGCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGAGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCACTTCGACAAGGCGGCC
  5   1   1           Gas  FLt3                   TGas031f16.FL-Sanger                                TTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTATGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCACTTCGACAAG
  5   1   2       bld Egg       in                  TEgg076j04.p1kSP6w CCAGTCTCGCTTGATGAGACTTCCGGTGGGATTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAA
  5   1   2       bld Te5       in                        CAAO12543.5p          CTTGATGAGACTTCCGGTGGGATTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCTAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCCTCACCATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCC
  5   1   2      seed Te5       in                        CAAO10684.5p                    CTTCCGGTGGGATTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCATCTGCCATACGACTG
  5   1   2       bld AbdN 5g                            IMAGE:7022338                      TCCGGTGGGATTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTATGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGNAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTTCCCTGAACATCATGCAGAAAAGTGCACCCAGTCATTTGGTCCCCTCACCAATCTGGCATACGACTA
  5   1   2       bld Gas  5g                        TGas006c08.p1cSP6                       TCCGGTGGGATTCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTATGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTTCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCACGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGC
  5   1   2       bld Neu  FLt3 out                  TNeu108p17.p1cSP6                          TCCCCGGGCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGAGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGA
  5   1   2       bld Gas       in                   TGas066a04.p1cSP6                                 TCTCTGTGAGAGCCGGAGGGTCGGAACCTGCAGGATGTATGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCATCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCA
  5   1   2       bld Gas  FLt3                      TGas031f16.p1kSP6                                  TTCTCTGTGAGAGCCGAGGTCGGAACCTGCAGGATGTATGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACG
  5   1   2       bld Gas       in                   TGas062c20.p1cSP6                                             CCGGAGGGTCGGAACCTGCAGGATGTACGCTGTGTACCGACAAGCGCATCCCCCCACCGGGCTGGAGTTCTCCATGTACTGCAACTTCTTCTCCAACTCGGAGAGGAACCTGGTGGTGGCGGGAACGTCCCAGCTCTACGTGTATCGGCTGAACCCCAACTGCGAGAGCTCGTCCAAAGGGGAGAAAGGCTCAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGAGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATAT
  3   1   2       bld Gas       in                    TGas062c20.q1kT7                                                                                                                                                                                                                                            CAGAAGTGAAAGGCCACAAGGAGAAGCTGGAGCTCATGGCTTCCTTCTCGTTCTTCGGTAACGTCATGTCCATGGCGAGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCCAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGAGGGACGGCTTCGTGCAGAACGTTCACAACCCCCAAGGTGGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACNGGGATGCGCAGCGTCCGATCA
  3   1   2       bld Te5       in                        CAAO12543.3p                                                                                                                                                                                                                                                                                                                         AGTGTCCAGCTGGCCGGAGCCAAGAGAGACGCCCTGTTACTGAGCTTTAAGGAGGCTAAGCTTTCAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTNTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCCCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCACTTCGACAA
  3   1   2       bld Te5       in                        CAAO10684.3p                                                                                                                                                                                                                                                                                                                                                                              GGCCAAGCTTCNAGTAGTGGAGTATGATCCTGGCACCCACGATCTGAAGACTCTCTCCTTACATTACTTTGAGGAGCCGGAACTGCGGGACGGCTTCGTGCAGAACGTTCACAACCNCAAGGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCACTTCGACAA
  5   1   2       bld Gas       in                   TGas052j24.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GACGGCTTCGTGCAGAACGTTCACAACCCCAAGTGCGGGTGGATCCCAGCGGGCGCTGCGCAGTGATGCTGATATACGGCACCCAGCTGGTGGTGCTGCCCTTCCGGCGGGATACCCTGGCAGAGGAGCACGACGGACTGGTGGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCT
  3   1   2       bld Egg       in                    TEgg076j04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              TGCAGAGGAGCACGACGGACTGGTGGAGAGGGGCAGAAGTCCAGCTTCCTGCCCAGTTATATCATCGACGTGCGGGAACTGGACGAGAAGCTGCTGAATATCATCGACATGCAGTTCCTCCATGGATACTACGAGCCCACCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTTGCTGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCACTTCGACAAGGC
  3   1   2       bld Gas       in                    TGas066a04.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAGTTCCTNNNCCATGGATACTACGAGCCCACCCCTTCTCATCCTGTTTGAGCCCAACCAGACATGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGA
  5   1   2       bld Neu                            TNeu100f18.p1cSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               CCCAACCGACTGGCCCGGGAGAGTTGCTGTGCGACAGGACACCTGTAGCATCGTAGCTATTTCCCTGAACATCATGCAGAAAGTGCACCCAGTCATTTGGTCCCTCACCAATCTGCCATACGACTGCACCCAGGCACTGGCGGTGCCCAAACCCATTGGTGGGGTGGTGATATTCGCCGTGAACTCCCTTCTGTATCTGAATCAGAGTGTCCCTCCCTACGGCGTGTCACTGAACAGCCTGACCAATGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGTACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGATCATTTCACTTCGACAAGGCGGC
  3   1   2       bld Gas       in                    TGas052j24.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       AACAGCCTGACCAAAGGAACCACTTCCTTCCCTCTCAAGCCGCAGGAGGGGCTGCGCGTCACACTCGATTGCTCCCAGGCCACCTTCATCTCCTATGACAAGATGGTGATTTCCTTAAAGGGAGGAGAAATCTACGCACTGACTCTCATCACAGACGGGATGCGCAGCGTCCGAT

In case of problems mail me! (mike.gilchrist@crick.ac.uk)