Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 24 Jan 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 74%

 1012081169 Xt7.1-XZT57056.5 - 11 ESTs
                                                                       .-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-XZT57056.5            GCTATATGAGCCAAGAGAGCTGAGCATCGGCATCTGCTTCCAGAGACTGTCTCCATACACCCTACTCTGACATCAAATGCCACATTCCAGGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAATAAATAATTTGACTG
                                                  Xt7.1-CHK-1008235142                  TGAGCCAAGAGAGCTGAGCATCGGCATCTGCTTCCAGAGACTGTCTCCATACACCCTACTCTGACATCAAATGCCACATTCCAGGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAATAAATAATTTGACTGCATAAT
                                                      consensus depths                 2     2     2     2     2     2     2     2     2     2     2     2     2     2     5     5    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11    11     9     9     5     6     5     5
                                               BLH ATG      76      18            
                                               BLH MIN      76      21            
                                               BLH MPR      70      21            
                                               BLH OVR      76      59            
                                               CDS MIN      76      21            
                                               ORF LNG      76       4            
                                                                                                                                                        PROTEIN --- Mm ---- 4e-024     XP_131080.1 RIKEN cDNA 1700013F07 [Mus musculus] -------------------------======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                            PREDICTED - Hs ---- 3e-028     XP_059104.4 PREDICTED: similar to CG5435-PA [Homo sapiens] =================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED = ?? ==== 6e-042     XP_693794.1 PREDICTED: hypothetical protein XP_688702 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                              PREDICTED = Dr ==== 2e-042     XP_696118.1 PREDICTED: hypothetical protein XP_691026 [Danio rerio] ======================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                 PREDICTED = Sp ==== 4e-044     XP_786649.1 PREDICTED: similar to CG5435-PA [Strongylocentrotus purpuratus] ===========================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-XZT57056.5                                                                               TGA------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------TGA------------------------------------TAA---------------------------TAA
                                                                   ORF                                                                                        [ open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       ]
  3   1   2      seed Tad5 5g3  in                         XZT57056.3p CCACGCGTCCGGCTATATGAGCCAAGAGAGCTGAGCATCGGCATCTGCTTCCAGAGACTGTCTCCATACACCCTACTCTGACATCAAATGCCACATTCCAGGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAATAAATAATTTGACTGCAT
  5   1   2   12  bld Tad5 5g3  in                         XZT57056.5p ...........GCTATATGAGCCAAGAGAGCTGAGCATCGGCATCTGCTTCCAGAGACTGTCTCCATACACCCTACTCTGACATCAAATGCCACATTCCAGGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAATAAATAATTTGACTGCATAATAAAAAAAAAAAAAAAAGG
  3   1   2       bld Mus1      in                         CABH2136.3p                                                                                           CCACATTCCAGGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTC
  5   1   2       bld Mus1      in                         CABH2136.5p                                                                                           CCACATTCCAGGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCAAAAAAAAAAAAAAAAA
  5   1   2       bld Ovi1      in                        CABI10218.5p                                                                                           CTCGATTCGAGGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAATAAATAATTTGACTGCAAAAAAAAAAAAAAAAAA
  3   1   2       bld Ovi1      in                        CABI10218.3p                                                                                                     GGGATCCATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAATAAATAATTTGACTGC
  5   1   2       bld Limb      in                       CBSU10309.fwd                                                                                                           CATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATACTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAAT
  3   1   2       bld Limb      in                       CBSU10309.rev                                                                                                           CATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATACTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAAT
  3   1   2       bld Mus1      in                        CABH10946.3p                                                                                                            ATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGC
  5   1   2       bld Mus1      in                        CABH10946.5p                                                                                                            ATATCCTTTCACCAGATATGAGAATGATGACACTTTTCAGGGAAAAGAAATCCAGAGAACAACTGGTAGGAAAAGTCACAATTTGCCACAAAAAGAAGACCCTTGGTATCGACTAAATTCTACTGCAACACTATCCAGTGACAGGAGAGCAGTGTATTACTATGACCCTGAGGCTCCATCTGACAGCTTGGATTTTACATTAAAGTCCCTGTATGATCACCATAACGGTCTTCTAAAAGATCGCAATGAAACGTTGTATCAACCGGAAACATTAACAGAAAGTCATGGAAGAATTTTGAAAAACAGAGTGAAAGAGATACCAGTTTCACAGGAGGAGATACACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGC
  5   1   2       bld Te1                                  CBWN7447.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ACTCTGTGAAACAGTGGGTTAGCCCTCAGAGAGCCAACATGTATAGCATAAATGGTGCTATTGTGAGCCATCATGCAGCTGCTACAAACCGTGGATATTCTCGGAAACAGGATGGAGGCTACTACAGTATCTGACCAGCAAGAGCAAACAAATTCTCTTGTGCTAAAAAATAAACATTGCATCTGTCTGCCTACAATAAATAATTTGACTGCATAATAAATAAATATATATTGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGCCCGA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)