Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 08 Aug 2022 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CABC10984.5.5                         8 END     5          50       71                Unknown (protein for MGC:147442) [Xenopus tropicalis]

 This cluster: approximate FL confidence score = 0%

 1012081311 Xt7.1-CABD13506.3 - 10 ESTs
                                                                       .......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860..
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CABD13506.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GTTTTTTTTTTTTACCTAGAAAGAGAATAGACTTATTTGAAACTATGGTAATAATACAACTGCCTTTTTGTATGTTCTGTATCTGTTCATTTTTAGAAAATGAAATGGGCAAATGGGGGCAAGATTTGGGGAATGTAAAAACTGCTGGAACTTGTCACCCAAAGTAGCCAGTCACCAGGAAGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGCA
                                                  Xt7.1-CHK-1008236538                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TTTTTTxxCxTAGAAAGAGAATAGACTTATTTGAAACTATGGTAATAATACAACTGCCTTTTTGTATGTTCTGTATCTGTTCATTTTTAGAAAATGAAATGGGCAAATGGGGGCAAGATTTGGGGAATGTAAAAACTGCTGGAACTTGTCACCCAAAGTAGCCAGTCACCAGGAAGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGCAAAAAAA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       3     3     3     4     4     4     4     4     5     5     5     5     5     5     6     6     6     6     6     6     5     5     5     5     5     5     5     5     5     5     6     6     8     8     8     8     8     8     8     8     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     9     4     4
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ------C-----
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ---A--------
                                                     Xt7.1-CABD13506.3                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             TAG------------------TAATAA---------------------------------------TAG---ATG------------------------------ATGTAA------------------------------------------------------------------------------------------TGA------TAATGA------------TAA---------------------------------ATG---------------------------------------------------------ATG---------------------------TAA------------------------------------------TAG---ATG---------------------ATG------------------------TAA------TGATGA------TAG------TGA------------------TAG------------TAA---------------------------------------------------------------------------------------------TGA------------------------------------------------------------ATG---------------------------------------------------------------TAA------------------------------------------------TGA
  5   1   2       bld Tad5      in                         XZT51042.5p GGAACGGAGAGATCAGAGACAGGAACTAAATTGCACTGAAGAAACTTGATGTATGGCTGTCATGCTGTATTCTCATCAGTGGGAGAAACCATCGAATCATCTGCTGCAGTTATTTCCTCATGTCATATTTATATTGCCTTATTTTATAGCATCTGATAACAATTTTTACATGCAACTCCAGTTTGTTGGGGGAGAAACTATGCAAGCGACTTTTCCATGAAGCTAACACAGGGAAGGCCAATCGGAATATCTCCAGCTGATATAaagacacacggagcttcttagtggcaactacttgtcatggctactaaacaccagataataccctgccatagacaatactgagaattatcagtaaaagatcaacatcgtctattttagtaggcgcagcaagtagctgcttctagtagctctgtgtgtcttcacccTAAAGGTCACCAACAGTCAGAGAGCTTCCAACTGCCCGTGCCTTATCTAACAATATCTTATTCTAATATTAATTAATAGGAGTAATACTAACAATCACCATACACGCCCAGTTTCCCAAAGTTCTTCTTCTTCTTGCTACACAGAAAATATTTTTGTTTAAAAAATATTTTTGATCGCCTACTTCGATATTTTTTATACTTGATTTTTTTTGTCAAAATCAAAATGCTGTTTTTTTTTTTTACCTTAGAAAGAGAATAGACTTATTTGAAACTATGGTAATAATACAACTGCCTTTTTGTATGTTCTGTATCTGTTCATTTTTAGAAAATGAAATGGGCAAATGGGGGCAAGATTT
  3   1   2       bld Lun1      out                       CABD13506.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AATCAAAATGCTGTTTTTTTTTTTACCTAGAAAAGAGAATAGACTTATTTGAAACTATGGTAATAATACAACTGCCTTTTTGTATGTTCTGTATCTGTTCATTTTTAGAAAATGAAATGGGCAAATGGGGGCAAGATTTGGGGAATGTAAAAACTGCTGGAACTTGTCACCCAAAGTAGCCAGTCACCAGGAAGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGCAGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGCAAAAAAA
  3   1   2       bld Fat1 FL   out                       CABC10984.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           AAATGCTGTTTTTTTTTTTTACCTAGAAAGAGAATAGACTTATTTGAAACTATGGTAATAATACAACTGCCTTTTTGTATGTTCTGTATCTGTTCATTTTTAGAAAATGAAATGGGCAAATGGGGGCAAGATTTGGGGAATGTAAAAACTGCTGGAACTTGTCACCCAAAGTAGCCAGTCACCAGGAAGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGC
  3   1   2       bld Lun1      out                        CABD5017.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTTTTACCTAGAAAGAGAATAGACTTATTTGAAACTATGGTAATAATACAACTGCCTTTTTGTATGTTCTGTATCTGTTCATTTTANGAAAATGAAATGGGCAAATGGGGGCAAGATTTGGGGAATGTAAAAACTGCTGGAACTTGTCACCCAAAGTAGCCAGTCACCAGGAAGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGCAAAAAAA
  3   1   2      seed Liv1 5x3  out                       CAAR11836.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           ACTATGGTAATAATACAACTGCCTTTTTGTATGTTCTGTATCTGTTCATTTTTAGAAAATGAAATGGGCAAATGGGGGCAAGATTTGGGGAATGTAAAAACTGCTGGAACTTGTCACCCAAAGTAGCCAGTCACCAGGAAGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGC
  3   1   2       bld Tad5      in                         XZT51042.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCTGTTCATTTTTAGAAAATGAAATGGGCAAATGGGGGCAAGATTTGGGGAATGTAAAAACTGCTGGAACTTGTCACCCAAAGTAGCCAGTCACCAGGAAGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCCTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCAATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGC
  3   1   2       bld Spl2 5g3  out                       CBSS8799.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      AGCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCCTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCAATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCCTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGC
  5   1   2       bld Spl2      in                        CBSS2322.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATANAATGAAAAATAAAGATAAATCAGACCGCANAAAAAAAAAAAA
  3   1   2       bld Spl2      in                        CBSS2322.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                       GCATCTATTGGGCTCCCAGACCTGGATCAATTTTTTGCCAACACGCATGAATAAAATAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCTTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCGATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCTTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGATAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGC
  5  -1   2       bld Liv1      out                        CAAR7425.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               TAATGATGTGCCTTCTGGTAAACCTATTATAACAGGGTGTTTCCCCTTCTACTCATGTGGCCCTGGAGGAAAACCAATGGAAACAGTTTCCTCTTAAACGGCAATTGCAGTCATATGGTACTGCTTGCTCCATGCATTAAACATTAAGGCATATGGATACAGTGGGAAGGTTTAGGCTTTCTGTGCAAGTAGGTGATGGATACAGGTATATGCTTTGTAATGGGACAGGTCAATAAGAAGGCAAAATAAGAAAGATGATGATACTTATAGTACCGTTGAAGACATGGAGGGTTAGGATAGGATAAGATAGGATAAGATGTTGCTGCTGACTGGGGACTAAAAGAAGGATGCTCCAGGGCCTCTAGGGGTGCCAGTGGCAACAGCTGCACTTTATTGACCTCTGATAATTGATTCTATGGCAAATACCCTCTGCCACCAGTTCCAGAATATGCACAAAGATTCATAAACCTGATGTATTCTTTAGCTTGGGGTAGAGATAGCAATGTGGCAACTATATATTTATTATTTGGTTTCCTGTAATATTTCTATTCATTTCTATTAGTTTTTTTTACCTGGTACATCATAAAATGAAAAATAAAGATAAATCAGACCGCATCTTGAG

In case of problems mail me! (mike.gilchrist@crick.ac.uk)