Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 11 Apr 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 0%

 1012081388 Xt7.1-CBXT15993.5 - 17 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CBXT15993.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTAAGGGATATGAAGCAAATTATTGTTTAGGAAATTGTCCTTACATCTGGAGCACAGATACTCAGTACAGCAAGGTGCTATCACTTTATAATCAGAACAACCCTGGTGCATCTATCTCTCCCTGCTGTGTTCCTGATGTCCTGGAGCCACTACCAATCATTTATTATGTTGGCCGCAATGCCAAGGTGGAGCAGCTTTCTAACATGGTGGTAAGGTCTTGCCACTGCAGCTGAGAAAAGCTTGGGGGCAGAAAGCAAAGCAAAGACATGGTACAGAATCCTAACAAACCACCTTACTGCTGCCAGTTGCCAACATGGATACCATGAAGTCAAGTCATGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACACAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAGATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTTTTTAAACTGTATTATTTTATAGTTTTTTTTTATATTTAAAATATTTTGTTTTAATGAGGAAAAATAAAAAGAGGTAC
                                                  Xt7.1-CHK-1008231408                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGATATGAAGCAAATTATTGTTTAGGAAATTGTCCTTACATCTGGAGCACAGATACTCAGTACAGCAAGGTGCTATCACTTTATAATCAGAACAACCCTGGTGCATCTATCTCTCCCTGCTGTGTTCCTGATGTCCTGGAGCCACTACCAATCATTTATTATGTTGGCCGCAATGCCAAGGTGGAGCAGCTTTCTAACATGGTGGTAAGGTCTTGCCACTGCAGCTGAGAAAAGCTTGGGGGCAGAAAGCAAAGCAAAGACATGGTACAGAATCCTAACAAACCACCTTACTGCTGCCAGTTGCCAACATGGATACCATGAAGTCAAGTCATGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACACAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAAATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTTTTTAAACTGTATTATTTTATAGTTTTTTTTTATATTTAAAATATTTTGTTTTAATGAGGAAAAATAAAAAG
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     3     3     3     3     3     3     4     4     4     4     4     4     4     4     5     5     5     5     5     5     5     5     5     5     5     5     4     5     4     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     4     4     5     5     4     5     5     5     5     5     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     7     8     8     9     8    10     9    10     9    10     9    10     9    10    10    12    11    12    11    12    11    12    10    12    10    12    10    13    10    13     9    13    10    13    10    14    10    13    11    13    11    12    11    12    11    13    12    14    12    14    12    14    13    14    12    14    13    13    13    13    13    13    13    13    13    13    12    12    11    12    12    12    11    12    11    12    10    12    11    12    10    12    11    12    11    12    10    11    10    11     9    11    10    11    10    11     9    10    10    10    10    10     9    10    10    10    10    10     9     9     8     8     7     8     8     8     7     7     7     7     6     6     5     5     5     5     5     5     5     5     5     5     3     5
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     ---------G--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ---------T--
                                                                   SNP                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 --------A---
                                                                       ...PROTEIN --- Dm ---- 3e-007     NP_477340.1 glass bottom boat CG5562-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                        PROTEIN --- Bf ---- 9e-009     AAC97488.1 bone morphogenetic protein 2/4 [Branchiostoma floridae] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                  PROTEIN --- Bb ---- 9e-009     AAF19841.1 bone morphogenetic protein 2/4 [Branchiostoma belcheri] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          PROTEIN --- Xt ---- 2e-008     CAJ81634.1 derriere [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================
                                                                       ...PREDICTED - Sp ---- 1e-018     XP_793246.2 PREDICTED: similar to transforming growth factor beta [Strongylocentrotus purpuratus] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Ci ---- 5e-021     BAE06732.1 transforming growth factor beta superfamily signaling ligand [Ciona intestinalis] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Gg ---- 3e-028     NP_001026216.1 transforming growth factor, beta 2 [Gallus gallus] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                                            PROTEIN --- Dr ---- 4e-029     NP_878293.1 transforming growth factor, beta 1 [Danio rerio] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                     PROTEIN --- Hs ---- 4e-034     NP_000651.3 transforming growth factor, beta 1 [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                     PROTEIN --- Mm ---- 2e-034     NP_035707.1 transforming growth factor, beta 1 [Mus musculus] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN --- Xl ---- 4e-040     AAA49968.1 transforming growth factor-beta (TGF-beta 5) precursor [Xenopus laevis]  --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                                                                                                                             PROTEIN --- ?? ---- 4e-040     NP_001081330.1 transforming growth factor-beta 5 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=======================================================================================================================================================================================================================================
                                                     Xt7.1-CBXT15993.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      ATG------------------------TGA---------------------------------ATG------------------------------------------------------TGA---------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAG------------------ATG---------------------------------------------------------------------TAA---------------------------------------------------------------TAA---------------------------------------------------------------------TAG---------------------------------------------TGA------------------------------------------ATG---------------TAA------TAA---TGA------------------------------------------------------------TAA------------------ATG---TAA---------------------------------------TAA---ATG------------------------------------------------------TAA---------------------------------------------------------------------------------------------------------------------------------------------------------------------TAATAA------------------------------------------------------------------------TAA------------TAATGA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        ... open reading frame                                                                                                                                                                                                                  ]
  5   1   2       bld TbA       in                   TTbA055o18.p1kSP6                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                            CAGAAAGAAGCAGACAGATAAAAATGTGGAACAAAGGATGGAACTCTATGCGGGTAATGGAACTGATTACTCAGGATACCTGGATAGCAAGTTCTTTACTGCAGTAACAGATGATGAGTGGGTGTCATTTGATGTTACAAAGACTGTGAATGAATGGCTGAACCATGCAGAGGAAAATGAAGAATTCAGGTTGAAACCTGCCTGCAAATGTTCAATAACTACACACAGCAAGGTTATAAGTATAGAAGGGTTTTCTATTTTGCGGGGAGACTTGATGAATTTGGGTGGTGATGACCTCAAGAAACCCTACCTCTTGATCACGTCAATGCCAGCAGAGCGAATTGACACTGTCTCACACTCACGGAGAAAGCGTGGGGTTGGACAGGAGTATTGCTTTGGAAATAGTGGGCCAAACTGCTGTGTGAAACCGCTTTACATAAATTTCCGGAAGGATCTAGGCTGGAAGTGGATCCATGAGCCTAAGGGATATGAAGCAAATTATTGTTTAGGAAATTGTCCTTACATCTGGAGCACAGATACTCAGTACAGCAAGGTGCTATCACTTTATAATCAGAACAACCCTGGTGCATCTATCTCTCCCTGCTGTGTTCCTGATGTCCTGNAGCCACTACCAATCATTTATTATGTTGGCCGNNCATGCCAGGTGGAGCAGCTTTCTAACATGGTGGTAAGGTCTTGCCACTGCAGCTG
  5   1   2       bld Thy1      in                        CBST9804.fwd                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GCCTAAGGGATATGAAGCAAATTATTGTTTAGGAAATTGTCCTTACATCTGGAGCACAGATACTCAGTACAGCAAGGTGCTATCACTTTATAATCAGAACAACCCTGGTGCATCTATCTCTCCCTGCTGTGTTCCTGATGTCCTGGAGCCACTACCAATCATTTATTATGTTGGCCGCAATGCCAAGGTGGAGCAGCTTTCTAACATGGTGGTAAGGTCTTGCCACTGCAGCTGAGAAAAGCTTGGGGGCAGAAAGCAAAGCAAAGACATGGTACAGAATCCTAACAAACCACCTTACTGCTGCCAGTTGCCAACATGGATACCATGAAGTCAAGTCATGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACACAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCTAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAACACAACCCCATCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATAAAGAGTG
  5   1   2       bld Eye       in                         CCAX5829.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TATGAAGCAAATTATTGTTTAGGAAATTGTCCTTACATCTGGAGCACAGATACTCAGTACAGCAAGGTGCTATCACTTTATAATCAGAACAACCCTGGTGCATCTATCTCTCCCTGCTGTGTTCCTGATGTCCTGGAGCCACTACCAATCATTTATTATGTTGGCCGCAATGCCAAGGTGGAGCAGCTTTCTAACATGGTGGTAAGGTCTTGCCACTGCAGCTGAGAAAAGCTTGGGGGCAGAAAGCAAAGCAAAGACATGGTACAGAATCCTAACAAACCACCTTACTGCTGCCAGTTGCCAACATGGATACCATGAAGTCAAGTCATGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACGCAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCCTTGATAAATAAACCGAAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCAT
  5   1   2       bld Tad5                                 XZT60053.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CTGGAGCACAGATACTCAGTACAGCAAGGTGCTATCACTTTATAATCAGAACAACCCTGGTGCATCTATCTCTCCCTGCTGTGTTCCTGATGTCCTGGAGCCACTACCAATCATTTATTATGTTGGCCGCAATGCCAAGGTGGAGCAGCTTTCTAACATGGTGGTAAGGTCTTGCCACTGCAGCTGAGAAAAGCTTGGGGGCAGAAAGCAAAGCAAAGACATGGTACAGAATCCTAACAAACCACCTTACTGCTGCCAGTTGCCAACATGGATACCATGAAGTCAAGTCATGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACACAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACAGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATGTTTGGTGCCTATTCCATTATTGTTCAACAAATTAAAGAGTGATCCTTATTCAATAAATGCTGCCTTTCAGGCCACAACACAAAAATGCCTTACAGTATAGATTAATGCATTTAATGCTGAGCACAGATTAGAGAATCT
  3   1   2       bld Fat1      out                        CABC7394.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              CTTTATAATCAGAACAACCCTGGTGCATCTATCTCTCCCTGCTGTGTCCTGGATGTCCTGGAGCCACTACCAATCATTTATTATGTTGGCCGCAATGCCAAGGTGGAGCAGCTTTCTAACATGGTGGTAAGGTCTTGCCACTGCAGCTGAGAAAAGCTTGGGGGCAGAAAGCAAAGCAAAGACATGGTACAGAATCCTAACAAACCACCTTACTGCTGCCAGTTGCCAACATGGATACCATGAAGTCAAGTCATGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACGCAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAGATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAG
  3   1   2       bld Thy1      in                        CBST9804.rev                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                TACTGCTGCCAGTTGCAACATGGGATACCATGAAGTCAAGTCATGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACACAACCCACACATGGATNTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCTAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAAATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGC
  5   1   2       bld Te5                                  CAAO9399.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           TGAAGATCAAGGAACCCTTTGATTTTACATATGCAAGGCACAAATGCCGAAAGCAGTTAGAAACAACACAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCTAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAAATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACANNACTGGATGAAATACAGAATACAGAGTGCCACGTAC
  5   1   2      seed Tbd1      in                        CBXT15993.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             AAGCAGTTAGAAACAACGCAACCCACACATGGATTTAGGATTCATCTACAACAATACACCCTTGGTTACAATATCTGTGTTTCTGGACTTCACTGTTCAGTTACTGTATCGATTTTTTAGCACCCCACTACAGCTTTTATGAAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAGATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTAC
  5   1   2       bld Tad5      in                           XZT340.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCTTTTTGAAGTGCTTCCCTGCCAAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACAGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATGTTTGGTGCCTATTCCATTATTGTTCAACAAATTAAAGAGTGATCCTTATTCAATAAATGCTGCCTTTCAGGCCACAACACAAAAATGCCTTACAGTATAGATTAATGCATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTATCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGATATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAAACAAGAAGGAGCTAATAATTCCTGT
  5   1   2       bld Tad5      in                         XZT13851.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CCAAGGTTATGGACATATACCAAGTTTTGGCAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCTAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAAATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTT
  3   1   2       bld Tbd1      in                        CBXT15993.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                           CCAAGTTTTGGCAAAAGGCAAAATCTTGGTTCAGGGTAAAATAACTCATCTGAAGCATCCAGTCCATGTAAAGAGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGAGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAGATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTTTTTAAACTGTATTATTTTATAGTTTTTTTTTATATTTAAAATATTTTGTTTTAATGAGGAAAAATAAAAAGAGGTACATAAATAAAAAAAAAAAAAAA
  3   1   2       bld Tad5                                 XZT61989.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              GAAGCATCCAGTCCATGTAAAGGGGTTTTATATACAGTTACGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTNCAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAGATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTTTTTAAACTGTATTATTTTATAGTTTTTTTTTATATTTAAAATATTTTGTTTTAATGAGGAAAAATAAAAAGAGGGTACATAAAT
  3   1   2       bld Tad5      in                         XZT13851.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                        TCCCATGTAAAGGGGTTTTATATACAGTTTCGGCAGAGAAATAAGCAGTACTCCCCTTGATAAATAAACCGAAGGCCATTTTACAAGGGACAGAAAAAAACACAACCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTTTCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAAATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTTTTTAAACTGTATTATTTTATAGTTTTTTTTTATATTTAAAATATTTTGTTTTAATGAGGAAAAATAAAAAGAGGTCT
  3   1   2       bld Eye       in                         CCAX5829.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                GCCATTTTACAAGGGACAGAAAAAAAACACCACCCCCATTCTAGAGTATCTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAGATGCTGCCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTTTTTAAACTGTATTATTTTATAGTTTTTTTTTATATTTAAAATATTTTGTTTTAATGAGGAAAAATAAAAAGAGGTACATA
  3   1   2       add TbA       in                    TTbA055o18.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 TTTTGGTGCCTATTGCATTATCGTTCAACAAATTAAAGAGTGATCCTTATTCAATAGATGGTGCCTTTCAGGTCACAACACAAAAATGCCTTCCCGTATAGATTAATACATTTAATGCTGAGCCCAGATTAGAGAATTTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTTTTAAGGTATTTTGCCAAAAAAAAATTTTAAAAACTGTTTTTGGTAAAACATGGGGGTTCATCCATGTTCATATCAACTTTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTTTTTTCAAAGCCCGAATACAGGAATCAATCAGAAAAAGGAACCTTTCGCTGCAGCCTCAGTTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCCCTGAACAAAGAAGGGGGTAATAATTCCTGTTTAAAAGGGGAAGTTTTTTTTTTTACCTTTTTAAACTGTATTATTTTATAGTTTTTTTTTATATTTAAAATATTTTGTTTTAATGGGGAAAAATAAAAAGGGGTTCCTAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
  3   1   2       add Tad5      in                           XZT340.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   TCAATAAATGGTGCCTTTCGGGCCCCAACCCAAAAATCCCTTCCAGTTTGGATTAATGCATTTAATGCTGGGCCCAGATTAGAGAATCTCAACTCTTTATAGATTGTTTTTTTTTTAACATAAATAATTGCCAAAAAAAAAAAAGCTCGAGCATGTTTTAAGGTTTTTTGCCAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACAGGGGGGTTCATCCATGTTCATATCAACTTTCCCAACTTGTAGGGCTTTCAATTTGTTAAAAAGAAACAAAAGGCATTTTTTTTCAAAGCCGGAAACCCGGAATCAATCGGAAAAAGGAACCTATCG
  3   1   2       bld Ovi1 5g3  out                       CABI11151.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                CCTTTCAGGTCACAACACAAAAATGCCTTACAGTATAGATTAATACATTTAATGCTGAGCACAGATTAGAGAATCTCAACTCTTTATAGATTGTATATTTATTAACATAAATAATTGCTAAATAAATAAAAGCTCGAGCATGTCTTAAGGTATATTGACAAAAAAAAATATTAAAAACTGTTTTTGGTAAAACATGGGTGTTCATCCATGTTCATATCAACTCTCCCAACTTGTAGAGCTATCAATATGTTAAAAAGAAACAAAAGGCATTTATTTACAAAGCCAGAATACAGGAATCAATCAGAAAAAGGAACCTATCGCTGCAGCCTCAGCTACAGGGCAGACCTGTAGGACAAAACTGGATGAAATACAGAATACAGAGTGCCACGTACAGGTACCCACTGAACAAAGAAGGAGCTAATAATTCCTGTTTAAAAGGAGAAGTTTTTTTTTTTACCTTTTTAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)