Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 14 Aug 2020 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.01% 0.01%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters

         CS%  VC Transcript                               Size Type    Links    % In    % Out     Identified Blast Description.
     1   2.0    0Xt7.1-CAAL6363.5                            5 END     4          28       80                MTG8 [Xenopus laevis]

         CS%  VC Transcript                               Size Type    Percent  From       To     Identified Blast Description.
     2 252.0    0Xt7.1-CAAK11073.3                           2 PI      78        545      904                MTG16b [Xenopus laevis]

 This cluster: approximate FL confidence score = 0%

 1012081472 Xt7.1-CAAR13181.5 - 14 ESTs
                                                                       -1000.....-990......-980......-970......-960......-950......-940......-930......-920......-910......-900......-890......-880......-870......-860......-850......-840......-830......-820......-810......-800......-790......-780......-770......-760......-750......-740......-730......-720......-710......-700......-690......-680......-670......-660......-650......-640......-630......-620......-610......-600......-590......-580......-570......-560......-550......-540......-530......-520......-510......-500......-490......-480......-470......-460......-450......-440......-430......-420......-410......-400......-390......-380......-370......-360......-350......-340......-330......-320......-310......-300......-290......-280......-270......-260......-250......-240......-230......-220......-210......-200......-190......-180......-170......-160......-150......-140......-130......-120......-110......-100......-90.......-80.......-70.......-60.......-50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......1220......1230......1240......1250......1260......1270......1280......1290......1300......1310......1320......1330......1340......1350......1360......1370......1380......1390......1400......1410......1420......1430......1440......1450......1460......1470......1480......1490......1500......1510......1520...
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                     Xt7.1-CAAR13181.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGAAAATGGCTTTGACAGAGAGCCTTTGCACTCAGAACATCCAAGCAAGCGGCCGTGCACTATAAGCCCAGGTCAGCGGTACAGTCCAAATAATGGTTTATCCTTCCAACCCAATGGACTGCCCCATCCGACCCCACCACCACCTCAGCATTATCGTTTGGATGATATGGCCATTGCCCATCACTACAGGGACTCGTACAGACATCCCAACCACAGGGACCTCAGGGACAGAAATAGACCTATGGGGTTGCACGGAACACGCCAAGAAGAAATGATTGACCACAGACTGACAGACAGAGAATGGGCAGAAGAATGGAAACACCTTGATCATCTGTTAAACTGCATAATGGATATGGTGGAAAAAACAAGAAGATCCCTCACTGTGCTACGGCGTTGCCAGGAGGCCGACCGAGAGGAACTTAATTACTGGATCAGGCGGTACAGTGATGCGGAGGATTTAAAAAAAGGTAGCAGCAGCAGCAGCAGCCATTCCAGACAGCAGAGTCCTGTGAATCCAGAGCCTGTTCCCTTAGAATCGCATCGGGAATTCCTGCACAGGCCTGCTTCTGGATACGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATTTAAAAAAAAAAAAAAACTGAATTGTTCAAAAACATTAAAGACACAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTTAAAAGCAAGGGAGAAAAACAAAAAAGAAATAAAAAATATGAAAACTAAAATCACATTGT
                                                  Xt7.1-CHK-1008233082                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               AAATGGCTTTGACAGAGAGCCTTTGCACTCAGAACATCCAAGCAAGCGGCCGTGCACTATAAGCCCAGGTCAGCGGTACAGTCCAAATAATGGTTTATCCTTCCAACCCAATGGACTGCCCCATCCGACCCCACCACCACCTCAGCATTATCGTTTGGATGATATGGCCATTGCCCATCACTACAGGGACTCGTACAGACATCCCAACCACAGGGACCTCAGGGACAGAAATAGACCTATGGGGTTGCACGGAACACGCCAAGAAGAAATGATTGACCACAGACTGACAGACAGAGAATGGGCAGAAGAATGGAAACACCTTGATCATCTGTTAAACTGCATAATGGATATGGTGGAAAAAACAAGAAGATCCCTCACTGTGCTACGGCGTTGCCAGGAGGCCGACCGAGAGGAACTTAATTACTGGATCAGGCGGTACAGTGATGCGGAGGATTTAAAAAAAGGTAGCAGCAGCAGCAGCAGCCATTCCAGACAGCAGAGTCCTGTGAATCCAGAGCCTGTTCCCTTAGAATCGCATCGGGAATTCCTGCACAGGCCTGCTTCTGGATACGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATTTAAAAAAAAAAAAAAACTGAATTGTTCAAAAACATTAAAGACACAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTTAAAAGCAAGGGAGAAAAACAAAAAAGAAATAAAAAATATGAAAACTAAAATCACATTGTTCTTTA
                                                      consensus depths                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     2     3     2     3     2     3     3     4     3     4     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     4     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     5     7     5     7     5     7     5     7     5     7     5     7     5     7     6     7     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    10    11    11    11    11    12     9    11     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     9    10     8     9     7     9     6     8     4     5     4     5     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     4     6     2     2     2     2     2     2     2     2
                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             PROTEIN --- Ci ---- 8e-010     BAE06369.1 deformed epidermal autoregulatory factor 1 homolog [Ciona intestinalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                       ...PROTEIN --- Dm ---- 3e-033     NP_523841.3 CG3385-PA [Drosophila melanogaster] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                        PREDICTED - Sp ---- 8e-063     XP_781927.2 PREDICTED: hypothetical protein [Strongylocentrotus purpuratus] -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------=========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                              PROTEIN --- Xt ---- 4e-115     AAI35601.1 Unknown (protein for MGC:121424) [Xenopus tropicalis] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                               PREDICTED - Dr ---- 2e-152     XP_686984.1 PREDICTED: similar to MTG8 isoform 1 [Danio rerio] -----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                        PROTEIN --- Gg ---- 0          NP_990075.1 MTG8/ETOb [Gallus gallus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                         PROTEIN --- Mm ---- 0          NP_033952.1 CBFA2T1 identified gene homolog [Mus musculus] ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                                                                       PROTEIN --- Hs ---- 0          NP_783553.1 acute myelogenous leukemia 1 translocation 1 protein isoform MTG8c; acutemyelogenous leukemia 1 translocation 1, cyclin-D related; myeloid translocationgene on 8q22; eight twenty one protein [Homo sapiens] ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- Xl ---- 0          AAW49215.1 MTG8 [Xenopus laevis] --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                                                                                                                                                                                                                                                                                    PROTEIN --- ?? ---- 0          NP_001089065.1 MTG8 [Xenopus laevis] ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                     Xt7.1-CAAR13181.5                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ATG------------------------------------------------------------------------ATG---------------------------ATG------------------------------------------------------------------------ATG---ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG------------------------------------------------ATG---------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TAA------------------------TGA---------------TAA------------------------------------------------ATG------------------------TAA---TGA---------ATG------TAGTAA---------------TAA------------------------------------------------------------------------TAA---------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------TAA
                                                                   ORF                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                             ]
  3  -1   2       bld Liv1      in                        CAAR13181.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                               GGGAAGAGGAGAACTCCAGATAGAACCAAAGAAAATGGCTTTGACAGAGAGCCTTTGCACTCAGAACATCCAAGCAAGCGGCCGTGCACTATAAGCCCAGGTCAGCGGTACAGTCCAAATAATGGTTTATCCTTCCAACCCAATGGACTGCCCCATCCGACCCCACCACCACCTCAGCATTATCGTTTGGATGATATGGCCATTGCCCATCACTACAGGGACTCGTACAGACATCCCAACCACAGGGACCTCAGGGACAGAAATAGACCTATGGGGTTGCACGGAACACGCCAAGAAGAAATGATTGACCACAGACTGACAGACAGAGAATGGGCAGAAGAATGGAAACACCTTGATCATCTGTTAAACTGCATAATGGATATGGTGGAAAAAACAAGAAGATCCCTCACTGTGCTACGGCGTTGCCAGGAGGCCGACCGAGAGGAACTTAATTACTGGATCAGGCGGTACAGTGATGCGGAGGATTTAAAAAAAGGTAGCAGCAGCAGCAGCAGCCATTCCAGACAGCAGAGTCCTGTGAATCCAGAGCCTGTTCCCTTAGAATCGCATCGGGAATTCCTGCACAGGCCTGCTTCTGGATACGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGNCTGCACACTGCGCGGTACTNGCGATCATTTTGTCAGCACAAGACTGGGAGAA
  5   1   2       bld HeRe      in                     EC2CAA15BH09.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         CAAAGAAAATGGCTTTGACAGAGAGCCTTTGCACTCAGAACATCCAAGCAAGCGGCCGTGCACTATAAGCCCAGGTCAGCGGTACAGTCCAAATAATGGTTTATCCTTCCAACCCAATGGACTGCCCCATCCGACCCCACCACCACCTCAGCATTATCGTTTGGATGATATGGCCATTGCCCATCACTACAGGGACTCGTACAGACATCCCAACCACAGGGACCTCAGGGACAGAAATAGACCTATGGGGTTGCACGGAACACGCCAAGAAGAAATGATTGACCACAGACTGACAGACAGAGAATGGGCAGAAGAATGGAAACACCTTGATCATCTGTTAAACTGCATAATGGATATGGTGGAAAAAACAAGAAGATCCCTCACTGTGCTACGGCGTTGCCAGGAGGCCGACCGAGAGGAACTTAATTACTGGATCAGGCGGTACAGTGATGCGGAGGATTTAAAAAAAGGTAGCAGCAGCAGCAGCAGCCATTCCAGACAGCAGAGTCCTGTGAATCCAGAGCCTGTTCCCTTAGAATCGCATCGGGAATTCCTGCACAGGCCTGCTTCTGGATACGTGCC
  5   1   2       bld Brn4      in                        CAAL12111.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  CAGGGACCTCAGGGACAGAAATAGACCTATGGGGTTGCACGGAACACGCCAAGAAGAAATGATTGACCACAGACTGACAGACAGAGAATGGGCAGAAGAATGGAAACACCTTGATCATCTGTTAAACTGCATAATGGATATGGTGGAAAAAACAAGAAGATCCCTCACTGTGCTACGGCGTTGCCAGGAGGCCGACCGAGAGGAACTTATTACTGGATCAGGCGGTACAGTGATGCGGAGGATTTAAAAAAAGGTAGCAGCAGCAGCAGCAGCCATTCCAGACAGCAGAGTCCTGTGAATCCAGAGCCTGTTCCCTTAGAATCGCATCGGGAATTCCTGCACAGGCCTGCTTCTGGATACGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACATAGAGACAGCTGCCCGTTAACT
  3   1   2       bld Brn4 5g3  out                        CAAL6363.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                              ACGCCAAGAAGAAATGATTGACCACAGACTGACAGACAGAGAATGGGCAGAAGAATGGAAACACCTTGATCATCTGTTAAACTGCATAATGGATATGGTGGAAAAAACAAGAAGATCCCTCACTGTGCTACGGCGTTGCCAGGAGGCCGACCGAGAGGAACTTAATTACTGGATCAGGCGGTACAGTGATGCGGAGGATTTAAAAAAAGGTAGCAGCAGCAGCAGCAGCCATTCCAGACAGCAGAGTCCTGTGAATCCAGAGCCTGTTCCCTTAGAATCGCATCGGGAATTCCTGCACAGGCCTGCTTCTGGATACGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATT
  3   1   2       bld Brn4      out                        CAAL9015.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                      CAGACTGACAGACAGAGAATGGGCAGAAGAATGGAAACACCTTGATCATCTGTTAAACTGCATAATGGATATGGTGGAAAAAACAAGAAGATCCCTCACTGTGCTACGGCGTTGCCAGGAGGCCGACCGAGAGGAACTTAATTACTGGATCAGGCGGTACAGTGATGCGGAGGATTTAAAAAAAGGTAGCAGCAGCAGCAGCAGCCATTCCAGACAGCAGAGTCCTGTGAATCCAGAGCCTGTTCCCTTAGAATCGCATCGGGAATTCCTGCACAGGCCTGCTTCTGGATACGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATT
  3   1   2       bld HeRe      in                     EC2CAA44CH07.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                  GGGAGCAGCAGCAGCAGCAGCCCACTAGCCCATTCCAGCAGGCTCCTGTAGACTGGGAGGCAGCTCTGCCCCAGTGATTTATATCTGTATATGATGCTTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATCGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGAC
  5   1   2       bld HeRe      in                     EC2CAA44CH07.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   GGAGCAGCAGCAGCAGCAGCCCACTAGCCCATTCCAGCAGGCTCCTGTAGACTGGGAGGCAGCTCTGCCCCAGTGATTTATATCTGTCTATGATGCCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACT
  5   1   2       bld BrSp      in                    EC0CBA005CD02.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GGTGCCAGAGGAGATCTGGAAGAAAGCTGAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCC
  5  -1   2      seed Liv1      in                        CAAR13181.5p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                     GAGGAAGCAGTCAATGAAGTTAAACGGCAGGCAATGACGGAGCTGCAGAAAGCTGTGTCTGAAGCAGAGAGGAAAGCACACGAAATGATAACTACAGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATTTAAAAAAAAAAAAAAACTGAATTGTTCAAAAACATTAAAGACACAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTAAAAGCAAGGGAGAAAA
  3   1   2       bld Brn4      in                        CAAL12111.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    AGAAAGGGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATTTAAAAAAAAAAAAAAACTGAATTGTTCAAAAACATTAAAGACACAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTTAAAAGCAAGGGAGAAAAACAAAAAAGAAATAAAAAATATGAAAACTAAAATCACATTGTTCTTTATAAC
  3   1   2       bld Te1  5g3  out                        CBWN1965.g1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          GGCAAAGATGGAAAGAACGGTGGCAGAAGCGAAACGCCAGGCGGCAGAAGATGCACTCTCTGTTATCAATCAGCAGGAAGACTCTAGCGAGAGCTGCTGGAATTGCGGTCGTAAGGCGAGCGAAACCTGCAGCGGCTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATTTAAAAAAAACAAAAAACTGAATTGTTCAAAAACATTAAAGACACAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTTAAAAGCAAGGGAAAAAAAAAAAAAAA
  3   1   2       bld Tad5      out                         XZT3740.3p                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         TGCAGCGGTTGCAACACTGCGCGGTACTGCGGATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATTTAAAAAAAAAAAAAAACTGAATTGTTCAAAAACATTAAAGACACAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTAAAAGCAAGGGAG
  3   1   2       bld HeRe      in                     EC2CAA15BH09.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                         GATCATTTTGTCAGCACAAAGACTGGGAGAAACACCACCATATTTGTGGACAGACTCTCCAAGCGCAACAACAAGGGGAGACGCCAGCAGTCAGCTCTTCTGTCACACCCAGCAGTGGAGCAGGAAGTCCCATTGATACACCACCAGCAGCAACACCAAGATCCACCACTCCTGGAACCCCTTCCACCATAGAGACAGCTGCCCGTTAACTCTATTTAAAAAAAAAAAAAACTGAATTGTTCAAAAACATTAAAGACACAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTTAAAAGCAAGGG
  3   1   2       bld BrSp      in                    EC0CBA005CD02.b1                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                 ATTAAAGACCCAATGAAACCAATTCCTCATTTTCAGATGTTCAAAGATTTAAAATGTACTGTCACGATTCAATACTACAATAACAATGAACTTCTTTTATGTTGAAGTAGTAAACACAGAAGGGCCAGTAACGGGTCACAAGGACTTCTTACGGAAAACAAAGATATCTTTTCTTTAGAAAACTGAAAGAGAGCAAAGAAATATAACTCAAACACATGCTAGATTTGACCTCTTCCCTGGTATTTTTCAGTAGCTGGGATTTTAAACTAGATGACCTCATTAAAATAGGCTTTACCAAACAGCAAACCAAGAGATTGCTAATTGCTGTTAAAAGCAAGGGAGAAAAACAAAAAAGAAATAAAAAATATGAAAACTAAAATCACATTGTTCTTTACAAAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)