Gurdon Institute Xenopus tropicalis EST Database

Menus
+ Application in use by Guest User - 21 Sep 2021 - database INFO-PUBLIC =
==
Introduction
Find Expressed Sequences
Unique Expressed Sequence Set
Translated ORFs
FL Clone Sets
Custom Set Data
Find Images
.
Find Expressed Sequences
Key Word Search
By Clone or Sequence Name
By Gene Symbol
Via Blast
By Plate
.
=
By Clone or Sequence Name
Enter clone name to retrieve cluster
clone or transcript name . (Qiagen Xt oligo IDs are also recognised)
which clone end? . 5' 3' cDNA
font size for cluster .
Set frame . 1 2 3 auto find
Manage display
switch off ... . expression profile related clusters menus
activate ... . blast hits
Data may take 10 - 20 seconds to download, please be patient

.
.
=

.


Estimated expression levels relative to total library clones.
(detailed explanation)

0.001% 0.001%
Stage specific expression levels Tissue specific expression levels
stage 1 5 10 15 20 25 30 35 40 45 50 55 60tissue Bod Bone Brn Eye Fat Hrt Int Kid Liv Lun Mus Ova Ovi Panc Ski Spl Sto Te Thy

 Related Clusters
(none)

 This cluster: approximate FL confidence score = 93%

 1012081532 Xt7.1-ANBT2582.5 - 10 ESTs
                                                                       -50.......-40.......-30.......-20.......-10.......0.........10........20........30........40........50........60........70........80........90........100.......110.......120.......130.......140.......150.......160.......170.......180.......190.......200.......210.......220.......230.......240.......250.......260.......270.......280.......290.......300.......310.......320.......330.......340.......350.......360.......370.......380.......390.......400.......410.......420.......430.......440.......450.......460.......470.......480.......490.......500.......510.......520.......530.......540.......550.......560.......570.......580.......590.......600.......610.......620.......630.......640.......650.......660.......670.......680.......690.......700.......710.......720.......730.......740.......750.......760.......770.......780.......790.......800.......810.......820.......830.......840.......850.......860.......870.......880.......890.......900.......910.......920.......930.......940.......950.......960.......970.......980.......990.......1000......1010......1020......1030......1040......1050......1060......1070......1080......1090......1100......1110......1120......1130......1140......1150......1160......1170......1180......1190......1200......1210......
 ?   ?   ?    ?    ?     ?    ?   ? 
                                                      Xt7.1-ANBT2582.5                                                   CGCACTTCGCACAACTGCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTCTCAGCTGACATTGGCTACAAGGAGGTGGAGACACCATAAATGTTGATACAACTCTTTTACTTTATTGCATGTAAATACTCAAGGCACTCTTTTAAAAAGGACACTATGTAAATATATAGTTTCTATTCATATATATATATATTGTAAAATATAAAGCCTTATTATATCAGCTGGATTGAGTGTAGCAGGTCAGCTATGTCCAAGCGCATCCCATAACCATGCTGTATAAGAAGAATATAACATTGCAGCAATTATATGAGCATTGTATAAACTGAGCAAATATTATATGTATAAAGTGAGAAAATATTAAATATTTATGTCAAGACTTTTTTGTTTTCTATTTAAGCATTTTGTCATTAAAAATATTCTAGTACAAAAAAAAAAAAAAAA
                                                  Xt7.1-CHK-1008236536                                                         TCGCACAACTGCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTCTCAGCTGACATTGGCTACAAGGAGGTGGAGACACCATAAATGTTGATACAACTCTTTTACTTTATTGCATGTAAATACTCAAGGCACTCTTTTAAAAAGGACACTATGTAAATATATAGTTTCTATTCATATATATATATATTGTAAAATATAAAGCCTTATTATATCAGCTGGATTGAGTGTAGCAGGTCAGCTATGTCCAAGCGCATCCCATAACCATGCTGTATAAGAAGAATATAACATTGCAGCAATTATATGAGCATTGTATAAACTGAGCAAATATTATATGTATAAAGTGAGAAAATATTAAATATTTATGTCAAGACTTTTTTGTTTTCTATTTAAGCATTTTGTCATTAAAAATATTCTAGTACAAAAAAAAAA
                                                      consensus depths                                                        2     2     4     4     5     5     5     5     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     6     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     7     8     8     8     8     9     9     9     9     9     9     9     9     8     9     8     9     8     9     8     9     8     9     8     8     8     8     8     8     8     8     8     8     8     8     9     9     9     9     9     9     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     8     7     7     7     7     7     7     7     7     7     7     6     6     6     6     6     6     5     5     5     5     5     5     5     5     4     4     4     4     4     4     4     4     4     4     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     3     2     3     2     3     3     3
                                               BLH ATG      22     617                                                   
                                               BLH MIN      22      96                                                   
                                               BLH OVR      22     100                                                   
                                               EST CLI       0      42                                                   
                                               ORF LNG      22       4                                                   
                                                                                                                    PROTEIN --- Cs ---- 2e-015     BAB68350.1 Cs-frizzled3 [Ciona savignyi] ------------------------------------------------------------------------------==========================================================================================================================================================================================================================================================================================
                                                                       PROTEIN --- Dm ---- 1e-017     NP_524812.1 CG17697-PA [Drosophila melanogaster] ----------------------------------------------------------------------------------=================================================================================================================================================================================================================================================================================================================================
                                                                       PREDICTED - Sp ---- 4e-030     XP_781087.1 PREDICTED: similar to secreted frizzled-related protein 5 [Strongylocentrotus purpuratus] -----------================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                 PROTEIN --- Ce ---- 4e-032     NP_500977.2 Y73B6BL.21 [Caenorhabditis elegans] --------------------------=====================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                             PROTEIN --- Ci ---- 3e-034     BAE06683.1 secreted frizzled-related protein [Ciona intestinalis] -----------------------------------------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                        PROTEIN --- Mm ---- 5e-040     NP_033170.1 secreted frizzled-related sequence protein 2; stromal cell derived factor 5;secreted frizzled-related sequence protein 5 [Mus musculus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                        PROTEIN --- Hs ---- 2e-040     NP_003004.1 secreted frizzled-related protein 2 precursor [Homo sapiens] -------===================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN --- Dr ==== 1e-084     NP_858049.1 sizzled [Danio rerio] ==========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                         PREDICTED = Gg ==== 3e-116     XP_415985.2 PREDICTED: similar to secreted Xwnt8 inhibitor sizzled [Gallus gallus] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN === Xl ==== 2e-161     AAC15063.1 secreted Xwnt8 inhibitor sizzled [Xenopus laevis] ===============================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN === ?? ==== 2e-161     NP_001081748.1 secreted Xwnt8 inhibitor sizzled [Xenopus laevis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                                                                                                               PROTEIN === Xt ==== 6e-170     CAJ83869.1 secreted Xwnt8 inhibitor sizzled [Xenopus tropicalis] ===========================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================================
                                                      Xt7.1-ANBT2582.5                                                                         ATG------------------------------ATG---------------------------------------------------------------ATG---ATG------------------------ATG---------------ATG------------ATG---------------------------------------------------------------------ATG------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------ATG------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ATG---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------TGA---------------------------------------------------------------------------------------------------------TAA------------------------------------------------------------------------TAA---------------------------TGA---------------------------ATG------------------TAA------ATG
                                                                   ORF                                                                         ... open reading frame                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                    ]
  0   1   1           Gas  FL                     TGas144c13.FL-Sanger                                                                  TGCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACTCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATAAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTCTCAGCTGACATTGGCTACAAGGAGGTGGAGACACCATAAATGTTGATACAACTCTTTTACTTTATTGCATGTAAATACTCAAGGCACTCTTTTAAAAAGGACACTATGTAAATATATAGTTTCTATTCATATATATATATATTGTAAAATATAAAGCCTTATTATAACAGCTGGATTGAGTGTAGCAGGTCAGCTATGTCCAAGCGCATCCCATAACCATGCTGTATAAGAAGAATATAACATTGCAGCAATTATATGAGCATTGTATAAACTGAGCAAATATTATATGTATAAAGTGAGAAAATATTAAATATTTATGTCAAGACTTTTTTGGTTTCTATTTAAGCATTTTGTCATTAAAAATATTCTAGTACAAACAAAAAAAAAAAAAAAAAAA
  5   1   2   24  bld Gas6 5g                              ANBT1358.5p ..................................................CGCACTTCGCACAACTGCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAAC
  5   1   2   24 seed Gas6 5g                              ANBT2582.5p ..................................................CGCACTTCGCACAACTGCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTCTCAGCTGACATTGGCTACAA
  5   1   2       bld Neu  5g3  in                   TNeu088h06.p1cSP6                                                       CTTCGCACAACTGCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCACAAAGAGTATCAGTACTCCTAT
  5   1   2       bld Neu  5g                        TNeu024k17.p1kSP6                                                       CTTCGCACAACTGCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATG
  5   1   2       bld Gas  FL   in                   TGas144c13.p1kSP6                                                                   GCAAACATGACTGGAGTCTTCCTGCTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACTCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCT
  5   1   2       bld TbA       in                   TTbA050k17.p1kSP6                                                                                           CTCCTCTCCGCCTCCATGCTGGCCTGCGCCGCCGCCTTTGACATTGGATTATCCACTAAGTGCGTCTCCATTCCAAAAGAGATGGCCATGTGCAATGACATCGGCTACTCGGAGATGAGACTGCCGAACCTGATGGGACACACTAGCATGGCAGAAGTCGTGCCCAAGTCAGCAGAGTGGCAGAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCT
  5   1   2       bld Gas7                                 XZG26262.5p                                                                                                                                                                                                                                                                                 GAACCTCCTACAGACCGGCTGTCACCCATATGCCAGGATGTTCCTATGCTCCCTCTTCGCCCCAGTCTGCCTGGATACGTTCATCCAGCCCTGCCGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTCTCAGCTGACATTGGCTACAAGGAGGTGGAGACACCATAAATGTTGATACAACTCTTTTACTTTATTGCAGGTAAATACTCAAGGCACT
  3   1   2       bld Gas  FL   in                    TGas144c13.q1kT7                                                                                                                                                                                                                                                                                                                                                                               CGCAGCATGTGTGTTGCTGTAAGAGACAGTTGTGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACTCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATAAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTCTCAGCTGACATTGGCTACAAGGAGGTGGAGACACCATAAATGTTGATACAACTCTTTTACTTTATTGCATGTAAATACTCAAGGCACTCTTTTAAAAAGGACACTATGTAAATATATAGTTTCTATTCATATATATATATATTGTAAAATATAAAGCCTTATTATAACAGCTGGATTGAGTGTAGCAGGTCAGCTATGTCCAAGCGCATCCCATAACCATGCTGTATAAGAAGAATATAACATTGCAGCAATTATATGAGCATTGTATAAACTGAGCAAATATTATATGTATAAAGTGAGAAAATATTAAATATTTATGTCAAGACTTTTTTGGTTTCTATTTAAGCATTTTGTCCATTAAAAATATTCTAGTACAAACAAAAAAAAAAAAAAAAAAA
  3   1   2       bld TbA       in                    TTbA050k17.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                               TGCCCCAGTTCTGGCATGTCATGGGCACGCCTGGCCTGAGAGCTTAGACTGTGACAGGTTCCCAGCTGGGGAAGACATGTGCCTGGACACCCTCAGCAAAGAGTATCAGTACTCCTATAAAGAATTGCCAAAGCCAAGCTGCCAGGGCTGCCCACTAATTGAGGATTTTTTTTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTTTCAGCTGACATTGGCTACAAGGAGGTGGAGACACCATAAATGTTGATACAACTCTTTTACTTTATTGCATGTAAATACTCAAGGCACTCTTTTAAAAAGGACACTATGTAAATATATAGTTTCTATTCATATATATATATATTGTAAAATATAAAGCCTTATTATATCAGCTGGATTGAGTGTAGCAGGTCAGCTATGTCCAAGCGCATCCCATAACCATGCTGTATAAGAAGAATATAACATTGCAGCAATTATATGAGCATTGTATAAACTGAGCAAATATTATATGTATAAAGTGAGAAAATATTAAATATTTATGTCAAGACTTTTTTGTTTTCTATTTAAGCATTTTGTCATTAAAAATATTCTAGTACAAAAAAAAAAAAAAAAAAAAG
  3   1   2       bld Neu  5g3  in                    TNeu088h06.q1kT7                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                          TTCACACAAGACAGTTTTGGAAGCTTTCTGTGACAATAACTTTGCTGTGAAAGTGAAATTGGCAAAGAAGAAAACAACTTCAGGAATCTATGTATATGAGACAGAAGGCCCAGTTGAGTTCATTAAACAAGGTCTGCTCCTTCCATATGACACACGTACCATGATTGAGCAGTGGCTGCTAATTAATGAGAACTGTGCTCAGAGGCTGATACGGAACAGACCCACAGTGTATGTTATTGCTGGTGACATCCATCATGGCAAGGTTTCAGTCAACAGAGTTTTCCACTGGCAGAAAAAGGACTCTCAGCTGACATTGGCTACAAGGAGGTGGAGACACCATAAATGTTGATACAACTCTTTTACTTTATTGCATGTAAATACTCAAGGCACTCTTTTAAAAAGGACACTATGTAAATATATAGTTTCTATTCATATATATATATATTGTAAAATATAAAGCCTTATTATATCAGCTGGATTGAGTGTAGCAGGTCAGCTATGTCCAAGCGCATCCCATAACCATGCTGTATAAGAAGAATATAACATTGCAGCAATTATATGAGCATTGTATAAACTGAGCAAATATTATATGTATAAAGTGAGAAAATATTAAATATTTATGTCAAGACTTTTTTGTTTTCTATTTAAGCATTTTGTCATTAAAAATATTCTAGTACAAAAAAAAAAAAAAAAAA

In case of problems mail me! (mike.gilchrist@crick.ac.uk)